The DOI matches its Crossref record; 268 of the 268 references it cites were found in a registry or an index; none of the 253 sources its claims cite is checked for support yet.
Principles of interleukin (IL)-6-type cytokine signalling and its regulation
Open accessAbstract
The IL (interleukin)-6-type cytokines IL-6, IL-11, LIF (leukaemia inhibitory factor), OSM (oncostatin M), ciliary neurotrophic factor, cardiotrophin-1 and cardiotrophin-like cytokine are an important family of mediators involved in the regulation of the acute-phase response to injury and infection. Besides their functions in inflammation and the immune response, these cytokines play also a crucial role in haematopoiesis, liver and neuronal regeneration, embryonal development and fertility. Dysregulation of IL-6-type cytokine signalling contributes to the onset and maintenance of several diseases, such as rheumatoid arthritis, inflammatory bowel disease, osteoporosis, multiple sclerosis and various types of cancer (e.g. multiple myeloma and prostate cancer). IL-6-type cytokines exert their action via the signal transducers gp (glycoprotein) 130, LIF receptor and OSM receptor leading to the activation of the JAK/STAT (Janus kinase/signal transducer and activator of transcription) and MAPK (mitogen-activated protein kinase) cascades. This review focuses on recent progress in the understanding of the molecular mechanisms of IL-6-type cytokine signal transduction. Emphasis is put on the termination and modulation of the JAK/STAT signalling pathway mediated by tyrosine phosphatases, the SOCS (suppressor of cytokine signalling) feedback inhibitors and PIAS (protein inhibitor of activated STAT) proteins. Also the cross-talk between the JAK/STAT pathway with other signalling cascades is discussed.
Overview
AI snapshot
Written from the paper’s full text.
TL;DR
This review summarizes IL-6-type cytokine signalling through gp130, LIFR and OSMR, covering JAK/STAT and MAPK activation and the mechanisms that terminate or modulate these pathways. It emphasizes negative regulation by tyrosine phosphatases, SOCS feedback inhibitors and PIAS proteins, as well as cross-talk with other signalling cascades.
Key findings
- IL-6-type cytokines (IL-6, IL-11, LIF, OSM, CNTF, CT-1 and CLC) signal via gp130 homodimers or gp130–LIFR/OSMR heterodimers; all potently activate STAT3 and, to a lesser extent, STAT1 through gp130, while OSMR is the most potent activator of STAT5.
- Receptor activation requires more than simple dimerization: efficient gp130 activation by monoclonal antibodies required two distinct antibodies, with the minimal requirement being one intact antibody plus the Fab of a second; insertion of one to four alanines into the gp130 membrane-proximal intracellular region gave full activation only with wild-type and the +3A mutant, interpreted as an approx. 110° twist per alanine and approx. 330° for three.
- JAK1 is essential for IL-6 signalling; gp130, LIFR and OSMR bind JAK1, JAK2 and TYK2. JAK1 mobility is approx. 100-fold lower than that of a typical cytoplasmic protein, and gp130 residues including box1 prolines and Trp666 are critical for JAK binding, while W652A abrogates JAK1 activation without affecting JAK1 association.
- Signal termination involves SHP2 and SOCS3 at gp130 pTyr759, with SOCS3 binding gp130 peptides with slightly higher affinity than SHP2; SOCS1 and SOCS3 inhibit JAKs, PIAS1 inhibits STAT1 and PIAS3 inhibits STAT3. Reported half-lives include SOCS1 1.5 h, SOCS2 1 h, SOCS3 1.6 h, IL-6Rα 2–3 h, gp130 2.5 h, JAK1 3.2 h, JAK2 1.9 h, TYK2 2 h, STAT3α 8.5 h, STAT3β 4.5 h, STAT1 16 h and SHP-2 18–20 h.
Methods
- Narrative review of molecular mechanisms of IL-6-type cytokine signal transduction, focusing on advances made during the previous 5 years in receptor activation, JAK–receptor interactions, STAT activation, signal modulation and cross-talk.
- Synthesizes structural, mutagenesis, biochemical and in vivo findings from the literature; no primary experimental dataset is presented, and the text includes models and a table of half-lives drawn from cited studies.
Limitations
- The authors state that key structural data are still missing, including the structure and conformational states of the cytoplasmic parts of cytokine receptors, and that three-dimensional structures of JAKs and SOCS proteins would be extremely valuable.
- The authors state that mathematical models of this complexity suffer from a lack of sufficient quantitative experimental data, and that cross-talk and biological outcomes depend on cell type and differentiation state.
- Evident from the text: as a narrative review, it does not use a systematic search or meta-analysis, and it includes unpublished work/personal communications and unresolved conflicting findings, such as JNK versus p38 involvement in STAT3 Ser727 phosphorylation and the positive versus negative regulatory functions reported for STAT3β.
Model-written summary. Check it against the paper before relying on it.
Integrity signals
Registry
Cites
Statistics
Verification
Claims the paper makes
172 Sources not found · 17 Own interpretation · 16 No basis given · 7 Not checked yet · 2 Own result
None of the sources cited for this claim could be matched to a paper in Crossref, so there is nothing to check it against.
In the paper
“Human OSM has the exceptional capability to recruit two different receptor complexes.It forms both LIFR-gp130 and OSMR-gp130 heterodimers.”
§ Principles of interleukin (IL)-6-type cytokine signalling and its regulation 1 > INTRODUCTION
What the sources say
- Not matchedcites [4]
Couldn’t be matched to a paper in Crossref, so it can’t be checked.
- Not matchedcites [6]
Couldn’t be matched to a paper in Crossref, so it can’t be checked.
plaindirect- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: unclear — It is unclear whether the paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
- Not matched
None of the sources cited for this claim could be matched to a paper in Crossref, so there is nothing to check it against.
In the paper
“LIF and OSM directly engage their signalling receptor subunits without requirement for additional α-receptor subunits (Figure 2) [4,6].”
§ Principles of interleukin (IL)-6-type cytokine signalling and its regulation 1 > INTRODUCTION
What the sources say
- Not matchedcites [4]
Couldn’t be matched to a paper in Crossref, so it can’t be checked.
- Not matchedcites [6]
Couldn’t be matched to a paper in Crossref, so it can’t be checked.
plaindirect- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: unclear — It is unclear whether the paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
- Not matched
In the paper
“Soluble forms of cytokine receptors in vivo are formed either by limited proteolysis (shedding) of membrane-bound receptors or by translation from an alternatively spliced mRNA [4].”
§ Principles of interleukin (IL)-6-type cytokine signalling and its regulation 1 > INTRODUCTION
What the sources say
- Not matchedcites [4]
Couldn’t be matched to a paper in Crossref, so it can’t be checked.
plaindirect- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: unclear — It is unclear whether the paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
- Not matched
In the paper
“It has been demonstrated that sIL-6Rα potentiates the antagonistic activity of sgp130.”
§ Principles of interleukin (IL)-6-type cytokine signalling and its regulation 1 > INTRODUCTION
What the sources say
- Not matchedcites [7]
Couldn’t be matched to a paper in Crossref, so it can’t be checked.
boosteddirect- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: unclear — It is unclear whether the paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
- Not matched
None of the sources cited for this claim could be matched to a paper in Crossref, so there is nothing to check it against.
In the paper
“In contrast with IL-6, and presumably also IL-11, where all the helices are straight, the A helix of LIF, OSM and CNTF is kinked [17,18].”
§ Principles of interleukin (IL)-6-type cytokine signalling and its regulation 1 > INTRODUCTION
What the sources say
- Not matchedcites [17]
Couldn’t be matched to a paper in Crossref, so it can’t be checked.
- Not matchedcites [18]
Couldn’t be matched to a paper in Crossref, so it can’t be checked.
plain- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: unclear — It is unclear whether the paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
- Not matched
None of the sources cited for this claim could be matched to a paper in Crossref, so there is nothing to check it against.
In the paper
“The minimal requirement for receptor activation is one intact antibody and the Fab (fragment antigen binding) of the second antibody.”
§ Principles of interleukin (IL)-6-type cytokine signalling and its regulation 1 > Receptors at work: let's do the twist
What the sources say
- Not matchedcites [39]
Couldn’t be matched to a paper in Crossref, so it can’t be checked.
- Not matchedcites [40]
Couldn’t be matched to a paper in Crossref, so it can’t be checked.
plaindirect- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: passes — The paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
- Not matched
None of the sources cited for this claim could be matched to a paper in Crossref, so there is nothing to check it against.
In the paper
“It has been shown that these domains are necessary for coupling ligand binding and signal transduction, since deletion of these domains leads to signalling incompetent receptors [36,37].”
§ Principles of interleukin (IL)-6-type cytokine signalling and its regulation 1 > Receptors at work: let's do the twist
What the sources say
- Not matchedcites [36]
Couldn’t be matched to a paper in Crossref, so it can’t be checked.
- Not matchedcites [37]
Couldn’t be matched to a paper in Crossref, so it can’t be checked.
boosteddirect- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: passes — The paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
- Not matched
In the paper
“Thus in the homodimer two different binding epitopes of gp130 are involved in ligand recognition [23].”
§ Principles of interleukin (IL)-6-type cytokine signalling and its regulation 1 > INTRODUCTION
What the sources say
- Not matchedcites [23]
Couldn’t be matched to a paper in Crossref, so it can’t be checked.
plaincorrelational- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: unclear — It is unclear whether the paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
- Not matched
In the paper
“The interaction sites predicted by mutagenesis studies have recently been confirmed by the X-ray structure of KSHV-IL-6 bound to a soluble gp130 fragment comprising the CBM and the Ig-like domain [24].”
§ Principles of interleukin (IL)-6-type cytokine signalling and its regulation 1 > INTRODUCTION
What the sources say
- Not matchedcites [24]
Couldn’t be matched to a paper in Crossref, so it can’t be checked.
plaindirect- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: unclear — It is unclear whether the paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
- Not matched
In the paper
“In contrast with the α-receptors, the receptors that initiate signal transduction have three additional membrane-proximal FNIII domains [4].”
§ Principles of interleukin (IL)-6-type cytokine signalling and its regulation 1 > INTRODUCTION
What the sources say
- Not matchedcites [4]
Couldn’t be matched to a paper in Crossref, so it can’t be checked.
plain- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: unclear — It is unclear whether the paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
- Not matched
- Probably not a substantial claim. 16
- It may state two separate claims as one. 55
A conclusion the paper draws from its own results — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“This structural divergence might reflect differences in the mechanisms of receptor recruitment, since the straight cytokines signal via gp130 homodimers, whereas the kinked cytokines signal via LIFR-gp130 or OSMR-gp130 heterodimers.”
§ Principles of interleukin (IL)-6-type cytokine signalling and its regulation 1 > INTRODUCTION
hedgedconditional- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: fails — The paper’s conclusions may not depend on it.
- Based: passes — The paper gives a reason why it holds.
Probably not a substantial claim. The paper’s conclusions may not depend on it. It may state two separate claims as one.
None of the sources cited for this claim could be matched to a paper in Crossref, so there is nothing to check it against.
In the paper
“Of these, JAK1 plays an essential role, because in cells lacking JAK1 IL-6 signal transduction is greatly impaired [51,52,134].”
§ Principles of interleukin (IL)-6-type cytokine signalling and its regulation 1 > Receptor-JAK interaction: more than just a rendez-vous
What the sources say
- Not matchedcites [51]
Couldn’t be matched to a paper in Crossref, so it can’t be checked.
- Not matchedcites [52]
Couldn’t be matched to a paper in Crossref, so it can’t be checked.
- Not matchedcites [134]
Couldn’t be matched to a paper in Crossref, so it can’t be checked.
plaindirect- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: passes — The paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
It may state two separate claims as one.
- Not matched
In the paper
“This finding has been interpreted in a way that the bivalent intact antibody enforces receptor dimerization and the monovalent Fab adjusts the conformation required for JAK activation and downstream signalling [40].”
§ Principles of interleukin (IL)-6-type cytokine signalling and its regulation 1 > Receptors at work: let's do the twist
What the sources say
- Not matchedcites [40]
Couldn’t be matched to a paper in Crossref, so it can’t be checked.
hedgeddirect- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: passes — The paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
Probably not a substantial claim. It may state two separate claims as one.
- Not matched
None of the sources cited for this claim could be matched to a paper in Crossref, so there is nothing to check it against.
In the paper
“Some evidence has been provided that under certain circumstances gp130 and LIFR are degraded after internalization [30][31][32].”
§ Principles of interleukin (IL)-6-type cytokine signalling and its regulation 1 > INTRODUCTION
What the sources say
- Not matchedcites [30]
Couldn’t be matched to a paper in Crossref, so it can’t be checked.
- Not matchedcites [31]
Couldn’t be matched to a paper in Crossref, so it can’t be checked.
- Not matchedcites [32]
Couldn’t be matched to a paper in Crossref, so it can’t be checked.
hedgedconditional- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: fails — The paper’s conclusions may not depend on it.
- Based: passes — The paper gives a reason why it holds.
Probably not a substantial claim. The paper’s conclusions may not depend on it.
- Not matched
None of the sources cited for this claim could be matched to a paper in Crossref, so there is nothing to check it against.
In the paper
“While for gp130, the STATs were found to depend on a specific conformation in order to become phosphorylated, for the EpoR the receptor phosphorylation seems to be sensitive to changes in orientation.”
§ Principles of interleukin (IL)-6-type cytokine signalling and its regulation 1 > Receptors at work: let's do the twist
What the sources say
- Not matchedcites [45]
Couldn’t be matched to a paper in Crossref, so it can’t be checked.
- Not matchedcites [46]
Couldn’t be matched to a paper in Crossref, so it can’t be checked.
hedgedconditional- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: unclear — It is unclear whether the paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
It may state two separate claims as one.
- Not matched
In the paper
“KSHV-IL-6 binds the gp130 homodimer in the absence of any α-receptor [16], but with lower affinity as compared with IL-6-IL-6Rα-gp130 ternary complexes.”
§ Principles of interleukin (IL)-6-type cytokine signalling and its regulation 1 > INTRODUCTION
What the sources say
- Not matchedcites [16]
Couldn’t be matched to a paper in Crossref, so it can’t be checked.
plaincorrelational- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: unclear — It is unclear whether the paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
It may state two separate claims as one.
- Not matched
None of the sources cited for this claim could be matched to a paper in Crossref, so there is nothing to check it against.
In the paper
“Internalization of gp130 seems to be independent from ligand binding [28], and is modulated by phosphorylation at Ser 782 [29] which is located adjacent to the dileucine motif.”
§ Principles of interleukin (IL)-6-type cytokine signalling and its regulation 1 > INTRODUCTION
What the sources say
- Not matchedcites [28]
Couldn’t be matched to a paper in Crossref, so it can’t be checked.
- Not matchedcites [29]
Couldn’t be matched to a paper in Crossref, so it can’t be checked.
hedgedconditional- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: unclear — It is unclear whether the paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
It may state two separate claims as one.
- Not matched
In the paper
“ErbB2 forms a complex with gp130 in an IL-6-dependent manner in prostate carcinoma cells [35].”
§ Principles of interleukin (IL)-6-type cytokine signalling and its regulation 1 > INTRODUCTION
What the sources say
- Not matchedcites [35]
Couldn’t be matched to a paper in Crossref, so it can’t be checked.
plaindirect- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: fails — The paper’s conclusions may not depend on it.
- Based: passes — The paper gives a reason why it holds.
Probably not a substantial claim. The paper’s conclusions may not depend on it.
- Not matched
None of the sources cited for this claim could be matched to a paper in Crossref, so there is nothing to check it against.
In the paper
“In certain cell types, a localization of gp130 in plasma membrane microdomains, such as lipid rafts and caveolae, has been observed [9][10][11].”
§ Principles of interleukin (IL)-6-type cytokine signalling and its regulation 1 > INTRODUCTION
What the sources say
- Not matchedcites [9]
Couldn’t be matched to a paper in Crossref, so it can’t be checked.
- Not matchedcites [10]
Couldn’t be matched to a paper in Crossref, so it can’t be checked.
- Not matchedcites [11]
Couldn’t be matched to a paper in Crossref, so it can’t be checked.
plaincorrelational- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: fails — The paper’s conclusions may not depend on it.
- Based: passes — The paper gives a reason why it holds.
Probably not a substantial claim. The paper’s conclusions may not depend on it.
- Not matched
None of the sources cited for this claim could be matched to a paper in Crossref, so there is nothing to check it against.
In the paper
“After secretion of the CLC-CLF-1 or CLC-CNTFRα complexes, signalling is dependent on CNTFRα and occurs via gp130-LIFR heterodimers.”
§ Principles of interleukin (IL)-6-type cytokine signalling and its regulation 1 > INTRODUCTION
What the sources say
- Not matchedcites [12]
Couldn’t be matched to a paper in Crossref, so it can’t be checked.
- Not matchedcites [13]
Couldn’t be matched to a paper in Crossref, so it can’t be checked.
plaindirect- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: unclear — It is unclear whether the paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
It may state two separate claims as one.
- Not matched
In the paper
“Constantinescu et al. [46] identified a hydrophobic motif in the EpoR membrane-proximal domain (Leu 253 , Ile 257 and Trp 258 ) which is conserved in many cytokine receptors and needs to be precisely orientated in order to promote signalling.”
§ Principles of interleukin (IL)-6-type cytokine signalling and its regulation 1 > Receptors at work: let's do the twist
What the sources say
- Not matchedcites [46]
Couldn’t be matched to a paper in Crossref, so it can’t be checked.
plaindirect- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: unclear — It is unclear whether the paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
It may state two separate claims as one.
- Not matched
In the paper
“PKCδ enhances the association of STAT3 with the receptor, which possibly involves the phosphorylation of Thr 890 of gp130 [67].”
§ Principles of interleukin (IL)-6-type cytokine signalling and its regulation 1 > Receptor-JAK interaction: more than just a rendez-vous
What the sources say
- Not matchedcites [67]
Couldn’t be matched to a paper in Crossref, so it can’t be checked.
hedgedconditional- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: unclear — It is unclear whether the paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
It may state two separate claims as one.
- Not matched
In the paper
“All IL-6-type cytokines potently activate STAT3, and to a minor extent STAT1 through their common receptor subunit gp130 [4].”
§ Principles of interleukin (IL)-6-type cytokine signalling and its regulation 1 > Another face of JAKs: determination of the receptor's fate
What the sources say
- Not matchedcites [4]
Couldn’t be matched to a paper in Crossref, so it can’t be checked.
plaindirect- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: unclear — It is unclear whether the paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
It may state two separate claims as one.
- Not matched
In the paper
“The Cterminal tyrosine kinase domain is preceded by a pseudokinase domain, which itself is devoid of catalytic activity, but regulates the activity of the kinase domain [3].”
§ Principles of interleukin (IL)-6-type cytokine signalling and its regulation 1 > Receptor-JAK interaction: more than just a rendez-vous
What the sources say
- Not matchedcites [3]
Couldn’t be matched to a paper in Crossref, so it can’t be checked.
plaindirect- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: unclear — It is unclear whether the paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
It may state two separate claims as one.
- Not matched
In the paper
“In the cases of LIFR and OSMR, STAT3 and STAT1, as well as STAT5, activation has been observed, with OSMR being the most potent activator of STAT5 [56].”
§ Principles of interleukin (IL)-6-type cytokine signalling and its regulation 1 > Another face of JAKs: determination of the receptor's fate
What the sources say
- Not matchedcites [56]
Couldn’t be matched to a paper in Crossref, so it can’t be checked.
plaindirect- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: unclear — It is unclear whether the paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
It may state two separate claims as one.
- Not matched
In the paper
“These results were confirmed by Chung et al. [105], who also observed that IL-6-induced STAT3 activation is MAPK independent, but sensitive to H7.”
§ Principles of interleukin (IL)-6-type cytokine signalling and its regulation 1 > Serine phosphorylation
What the sources say
- Not matchedcites [105]
Couldn’t be matched to a paper in Crossref, so it can’t be checked.
plain- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: unclear — It is unclear whether the paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
It may state two separate claims as one.
- Not matched
In the paper
“Cdk9 (cyclin-dependent kinase 9) was also found to bind to gp130, and the association increased upon IL-6 stimulation of HEK 293 cells over-expressing gp130 and Cdk9 [66].”
§ Principles of interleukin (IL)-6-type cytokine signalling and its regulation 1 > Receptor-JAK interaction: more than just a rendez-vous
What the sources say
- Not matchedcites [66]
Couldn’t be matched to a paper in Crossref, so it can’t be checked.
plaindirect- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: unclear — It is unclear whether the paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
It may state two separate claims as one.
- Not matched
In the paper
“Deletion of these amino acids reduces IL-6-induced Hck kinase activity, ERK (extracellular-regulated kinase) activation, dephosphorylation of Pyk2 and proliferation of transfected pro-B Ba/F3 cells [65].”
§ Principles of interleukin (IL)-6-type cytokine signalling and its regulation 1 > Receptor-JAK interaction: more than just a rendez-vous
What the sources say
- Not matchedcites [65]
Couldn’t be matched to a paper in Crossref, so it can’t be checked.
plaindirect- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: unclear — It is unclear whether the paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
It may state two separate claims as one.
- Not matched
In the paper
“A conformational change in the SH2 domain may account for this dual specificity [91].”
§ Principles of interleukin (IL)-6-type cytokine signalling and its regulation 1 > Another face of JAKs: determination of the receptor's fate
What the sources say
- Not matchedcites [91]
Couldn’t be matched to a paper in Crossref, so it can’t be checked.
hedgedconditional- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: fails — The paper’s conclusions may not depend on it.
- Based: passes — The paper gives a reason why it holds.
Probably not a substantial claim. The paper’s conclusions may not depend on it.
- Not matched
In the paper
“The recruitment of STATs to the activated receptors has been shown to be mediated by their SH2 domain and requires the phosphorylation of receptor tyrosine motifs [74,[81][82][83].”
§ Principles of interleukin (IL)-6-type cytokine signalling and its regulation 1 > Another face of JAKs: determination of the receptor's fate
What the sources say
- Not matchedcites [74,[81][82][83]
Couldn’t be matched to a paper in Crossref, so it can’t be checked.
boosteddirect- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: passes — The paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
It may state two separate claims as one.
- Not matched
In the paper
“substitution of Trp 652 with alanine (W652A) within the box1 region has no effect on JAK1 association but abrogates JAK1 activation.”
§ Principles of interleukin (IL)-6-type cytokine signalling and its regulation 1 > Receptor-JAK interaction: more than just a rendez-vous
What the sources say
- Not matchedcites [55]
Couldn’t be matched to a paper in Crossref, so it can’t be checked.
plaindirect- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: passes — The paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
It may state two separate claims as one.
- Not matched
In the paper
“Mutations with similar consequences (no JAK activation in spite of JAK association) have been described for the EpoR [59], indicating that cytokine receptors in general contribute to the JAK-activation process.”
§ Principles of interleukin (IL)-6-type cytokine signalling and its regulation 1 > Receptor-JAK interaction: more than just a rendez-vous
What the sources say
- Not matchedcites [59]
Couldn’t be matched to a paper in Crossref, so it can’t be checked.
hedgeddirect- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: passes — The paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
It may state two separate claims as one.
- Not matched
In the paper
“human fibrosarcoma cells lacking JAK1 express less OSMR at their surface compared with the parental cells, but transient transfection of JAK1 can again increase the amount of surface-expressed receptors [49].”
§ Principles of interleukin (IL)-6-type cytokine signalling and its regulation 1 > Another face of JAKs: determination of the receptor's fate
What the sources say
- Not matchedcites [49]
Couldn’t be matched to a paper in Crossref, so it can’t be checked.
plaindirect- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: passes — The paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
It may state two separate claims as one.
- Not matched
In the paper
“Box2 of gp130, a sequence dominated by hydrophobic amino acids followed by charged ones, contributes to JAK binding, presumably by increasing the affinity; a gp130 construct lacking box2 coprecipitates with JAK1 only when the kinase is over-expressed [55].”
§ Principles of interleukin (IL)-6-type cytokine signalling and its regulation 1 > Receptor-JAK interaction: more than just a rendez-vous
What the sources say
- Not matchedcites [55]
Couldn’t be matched to a paper in Crossref, so it can’t be checked.
hedgedconditional- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: unclear — It is unclear whether the paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
It may state two separate claims as one.
- Not matched
In the paper
“This leads to the formation of active STAT dimers, also shown to be mediated by their SH2 domains [90].”
§ Principles of interleukin (IL)-6-type cytokine signalling and its regulation 1 > Another face of JAKs: determination of the receptor's fate
What the sources say
- Not matchedcites [90]
Couldn’t be matched to a paper in Crossref, so it can’t be checked.
plaindirect- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: unclear — It is unclear whether the paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
It may state two separate claims as one.
- Not matched
The paper states this without a source or data behind it here, so there is nothing to check it against. The quote shows it is in the paper.
In the paper
“In response to IL-6, Gab1 is tyrosine phosphorylated and interacts subsequently with SHP2 and PI3K.”
§ Principles of interleukin (IL)-6-type cytokine signalling and its regulation 1 > Activation of MAPK cascades: one tyrosine to make things more complicated
plaindirect- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: unclear — It is unclear whether the paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
It may state two separate claims as one.
In the paper
“A recent study [112] on STAT3 activation in response to EGF (epidermal growth factor) suggests that receptor-mediated endocytosis is required for shuttling of STAT3 from the plasma membrane to the perinuclear region.”
§ Principles of interleukin (IL)-6-type cytokine signalling and its regulation 1 > STAT nuclear translocation: not a one way ticket
What the sources say
- Not matchedcites [112]
Couldn’t be matched to a paper in Crossref, so it can’t be checked.
hedgedconditional- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: fails — The paper’s conclusions may not depend on it.
- Based: passes — The paper gives a reason why it holds.
Probably not a substantial claim. The paper’s conclusions may not depend on it.
- Not matched
In the paper
“In the DNA-binding domain of STAT1, initially an NES was postulated that comprises residues 399-410 [108].”
§ Principles of interleukin (IL)-6-type cytokine signalling and its regulation 1 > STAT nuclear translocation: not a one way ticket
What the sources say
- Not matchedcites [108]
Couldn’t be matched to a paper in Crossref, so it can’t be checked.
plain- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: fails — The paper’s conclusions may not depend on it.
- Based: passes — The paper gives a reason why it holds.
Probably not a substantial claim. The paper’s conclusions may not depend on it.
- Not matched
In the paper
“Compared with the unmethylated protein, methylated STAT1 has a higher tendency to associate with DNA, since its interaction with PIAS (protein inhibitor of activated STATs) 1 (see the subsection below entitled 'PIAS -more than inhibitors of activated STATs?') seems to be weaker [106].”
§ Principles of interleukin (IL)-6-type cytokine signalling and its regulation 1 > Methylation of STATs
What the sources say
- Not matchedcites [106]
Couldn’t be matched to a paper in Crossref, so it can’t be checked.
hedgeddirect- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: unclear — It is unclear whether the paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
It may state two separate claims as one.
- Not matched
None of the sources cited for this claim could be matched to a paper in Crossref, so there is nothing to check it against.
In the paper
“The family of IL-6-type cytokines not only activates ERK1/2, a MAPK known for cellular processes that maintain cell survival, but also the stress-activated members of the MAPK family: p38 and JNK [140-142] (Figure 6).”
§ Principles of interleukin (IL)-6-type cytokine signalling and its regulation 1 > Activation of MAPK cascades: one tyrosine to make things more complicated
What the sources say
- Not matchedcites [140]
Couldn’t be matched to a paper in Crossref, so it can’t be checked.
- Not matchedcites [141]
Couldn’t be matched to a paper in Crossref, so it can’t be checked.
- Not matchedcites [142]
Couldn’t be matched to a paper in Crossref, so it can’t be checked.
plaindirect- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: unclear — It is unclear whether the paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
It may state two separate claims as one.
- Not matched
None of the sources cited for this claim could be matched to a paper in Crossref, so there is nothing to check it against.
In the paper
“Sensitivity to leptomycin suggests that nuclear export of STAT1 involves the nuclear export receptor CRM-1 that also acts in a Randependent manner [108,109].”
§ Principles of interleukin (IL)-6-type cytokine signalling and its regulation 1 > STAT nuclear translocation: not a one way ticket
What the sources say
- Not matchedcites [108]
Couldn’t be matched to a paper in Crossref, so it can’t be checked.
- Not matchedcites [109]
Couldn’t be matched to a paper in Crossref, so it can’t be checked.
hedgedconditional- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: unclear — It is unclear whether the paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
It may state two separate claims as one.
- Not matched
In the paper
“However, from an earlier study [113], it was concluded that nuclear translocation of STAT1 in response to IFNγ does not require cytoskeletal structures, such as actin filaments or microtubules.”
§ Principles of interleukin (IL)-6-type cytokine signalling and its regulation 1 > STAT nuclear translocation: not a one way ticket
What the sources say
- Not matchedcites [113]
Couldn’t be matched to a paper in Crossref, so it can’t be checked.
plain- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: passes — The paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
Probably not a substantial claim.
- Not matched
None of the sources cited for this claim could be matched to a paper in Crossref, so there is nothing to check it against.
In the paper
“According to the current view of the SHP2-dependent activation of MAPKs adopted from EGF and PDGF (platelet-derived growth factor) signal transduction, SHP2 links the Grb2-SOS (growthfactor-receptor-bound protein/Son of Sevenless) complex and/or Gab1 (Grb2-associated binder-1) to gp130 [127,129,130].”
§ Principles of interleukin (IL)-6-type cytokine signalling and its regulation 1 > Activation of MAPK cascades: one tyrosine to make things more complicated
What the sources say
- Not matchedcites [127]
Couldn’t be matched to a paper in Crossref, so it can’t be checked.
- Not matchedcites [129]
Couldn’t be matched to a paper in Crossref, so it can’t be checked.
- Not matchedcites [130]
Couldn’t be matched to a paper in Crossref, so it can’t be checked.
plaincorrelational- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: unclear — It is unclear whether the paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
It may state two separate claims as one.
- Not matched
In the paper
“In response to IL-2, Epo, EGF, and PDGF, SOCS3 (suppressor of cytokine signalling 3) becomes tyrosine phosphorylated, and subsequently binds and inactivates Ras/GTPase-activating protein.This results in the inhibition of the GTPase activity of Ras, leading to a sustained Ras/GTP and MAPK activity [139].”
§ Principles of interleukin (IL)-6-type cytokine signalling and its regulation 1 > Activation of MAPK cascades: one tyrosine to make things more complicated
What the sources say
- Not matchedcites [139]
Couldn’t be matched to a paper in Crossref, so it can’t be checked.
plaindirect- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: unclear — It is unclear whether the paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
It may state two separate claims as one.
- Not matched
In the paper
“SHP2 is rapidly recruited to tyrosine-phosphorylated gp130 and becomes also phosphorylated in a JAK1-dependent manner [131].”
§ Principles of interleukin (IL)-6-type cytokine signalling and its regulation 1 > Activation of MAPK cascades: one tyrosine to make things more complicated
What the sources say
- Not matchedcites [131]
Couldn’t be matched to a paper in Crossref, so it can’t be checked.
plaindirect- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: unclear — It is unclear whether the paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
It may state two separate claims as one.
- Not matched
The paper states this without a source or data behind it here, so there is nothing to check it against. The quote shows it is in the paper.
In the paper
“Dimerization of IL-6-type cytokine receptors does not only lead to activation of the JAK/STAT-signalling pathway, but also to the induction of the MAPK cascade.”
§ Principles of interleukin (IL)-6-type cytokine signalling and its regulation 1 > Activation of MAPK cascades: one tyrosine to make things more complicated
plaindirect- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: passes — The paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
It may state two separate claims as one.
None of the sources cited for this claim could be matched to a paper in Crossref, so there is nothing to check it against.
In the paper
“Furthermore, nuclear accumulation of constitutively active STAT proteins is independent from endocytosis, because in these cases the STATs are not recruited to any plasma membrane receptor [110,114].”
§ Principles of interleukin (IL)-6-type cytokine signalling and its regulation 1 > STAT nuclear translocation: not a one way ticket
What the sources say
- Not matchedcites [110]
Couldn’t be matched to a paper in Crossref, so it can’t be checked.
- Not matchedcites [114]
Couldn’t be matched to a paper in Crossref, so it can’t be checked.
plain- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: passes — The paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
It may state two separate claims as one.
- Not matched
None of the sources cited for this claim could be matched to a paper in Crossref, so there is nothing to check it against.
In the paper
“PIAS1 inhibits STAT1 signalling [179], but conversely enhances the transcriptional activity of nuclear hormone receptors [180].”
§ Principles of interleukin (IL)-6-type cytokine signalling and its regulation 1 > PIAS -more than inhibitors of activated STATs?
What the sources say
- Not matchedcites [179]
Couldn’t be matched to a paper in Crossref, so it can’t be checked.
- Not matchedcites [180]
Couldn’t be matched to a paper in Crossref, so it can’t be checked.
plaindirect- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: unclear — It is unclear whether the paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
It may state two separate claims as one.
- Not matched
None of the sources cited for this claim could be matched to a paper in Crossref, so there is nothing to check it against.
In the paper
“Whereas SHP2 modulates the amount and amplitude of STAT3 activity [131,158], PTPεC affects the kinetics of the onset of STAT3 activation [169].”
§ Principles of interleukin (IL)-6-type cytokine signalling and its regulation 1 > Protein tyrosine phosphatases (PTPs): what goes up must come down
What the sources say
- Not matchedcites [131]
Couldn’t be matched to a paper in Crossref, so it can’t be checked.
- Not matchedcites [158]
Couldn’t be matched to a paper in Crossref, so it can’t be checked.
- Not matchedcites [169]
Couldn’t be matched to a paper in Crossref, so it can’t be checked.
plaindirect- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: unclear — It is unclear whether the paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
It may state two separate claims as one.
- Not matched
In the paper
“It should be noted, however, that PI3K activation upon IL-6 treatment is observed in a cell-type specific manner; e.g.no significant Akt activation could be observed in IL-6treated HepG2 hepatoma cells [149].”
§ Principles of interleukin (IL)-6-type cytokine signalling and its regulation 1 > Activation of the PI3K cascade: the lipid connection
What the sources say
- Not matchedcites [149]
Couldn’t be matched to a paper in Crossref, so it can’t be checked.
hedged- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: unclear — It is unclear whether the paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
It may state two separate claims as one.
- Not matched
The paper states this without a source or data behind it here, so there is nothing to check it against. The quote shows it is in the paper.
In the paper
“This enzyme modifies certain phosphatidylinositides, so that the serine/threonine kinase protein kinase B/Akt is recruited to the plasma membrane, where it becomes activated through phosphorylation by PDK1 (phosphoinositide-dependent kinase-1).”
§ Principles of interleukin (IL)-6-type cytokine signalling and its regulation 1 > Activation of the PI3K cascade: the lipid connection
plaindirect- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: unclear — It is unclear whether the paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
It may state two separate claims as one.
None of the sources cited for this claim could be matched to a paper in Crossref, so there is nothing to check it against.
In the paper
“Early results suggested the presence of a nuclear phosphatase which counteracts IFNγ -activated STAT1 and contributes to its nuclear export [121,173].”
§ Principles of interleukin (IL)-6-type cytokine signalling and its regulation 1 > Protein tyrosine phosphatases (PTPs): what goes up must come down
What the sources say
- Not matchedcites [121]
Couldn’t be matched to a paper in Crossref, so it can’t be checked.
- Not matchedcites [173]
Couldn’t be matched to a paper in Crossref, so it can’t be checked.
hedgeddirect- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: unclear — It is unclear whether the paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
It may state two separate claims as one.
- Not matched
None of the sources cited for this claim could be matched to a paper in Crossref, so there is nothing to check it against.
In the paper
“Interaction of SHP2 with JAK1, JAK2 and TYK2, and phosphorylation of SHP2 by JAK1 and JAK2, have at least been shown to occur in vitro [131,162].”
§ Principles of interleukin (IL)-6-type cytokine signalling and its regulation 1 > Protein tyrosine phosphatases (PTPs): what goes up must come down
What the sources say
- Not matchedcites [131]
Couldn’t be matched to a paper in Crossref, so it can’t be checked.
- Not matchedcites [162]
Couldn’t be matched to a paper in Crossref, so it can’t be checked.
hedgeddirect- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: unclear — It is unclear whether the paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
It may state two separate claims as one.
- Not matched
None of the sources cited for this claim could be matched to a paper in Crossref, so there is nothing to check it against.
In the paper
“IL-6-induced activation of the PI3K/Akt pathway is involved in protection against apoptosis, as well as in enhanced proliferation of multiple myeloma cells [145][146][147].”
§ Principles of interleukin (IL)-6-type cytokine signalling and its regulation 1 > Activation of the PI3K cascade: the lipid connection
What the sources say
- Not matchedcites [145]
Couldn’t be matched to a paper in Crossref, so it can’t be checked.
- Not matchedcites [146]
Couldn’t be matched to a paper in Crossref, so it can’t be checked.
- Not matchedcites [147]
Couldn’t be matched to a paper in Crossref, so it can’t be checked.
plaindirect- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: unclear — It is unclear whether the paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
It may state two separate claims as one.
- Not matched
In the paper
“The cytoplasmic variant of PTPε, PTPεC, is expressed in haematopoietic cells and has been shown to selectively inhibit IL-6-induced gp130, JAK and STAT activation [168].”
§ Principles of interleukin (IL)-6-type cytokine signalling and its regulation 1 > Protein tyrosine phosphatases (PTPs): what goes up must come down
What the sources say
- Not matchedcites [168]
Couldn’t be matched to a paper in Crossref, so it can’t be checked.
plaindirect- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: unclear — It is unclear whether the paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
It may state two separate claims as one.
- Not matched
A conclusion the paper draws from its own results — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“On the other hand, the IL-6induced activation of the MAPK cascade is impaired by mutation of Tyr 759 within gp130, indicating that SHP2, as an adaptor, has a positive function on the activation of the MAPK cascade (as shown in Figure 1).”
§ Principles of interleukin (IL)-6-type cytokine signalling and its regulation 1 > Protein tyrosine phosphatases (PTPs): what goes up must come down
hedgeddirect- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: passes — The paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
It may state two separate claims as one.
The paper states this without a source or data behind it here, so there is nothing to check it against. The quote shows it is in the paper.
In the paper
“The family of PIAS comprises five mammalian members: PIAS1, PIAS3, PIASxα, PIASxβ, and PIASy.”
§ Principles of interleukin (IL)-6-type cytokine signalling and its regulation 1 > PIAS -more than inhibitors of activated STATs?
plain- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: fails — The paper’s conclusions may not depend on it.
- Based: passes — The paper gives a reason why it holds.
Probably not a substantial claim. The paper’s conclusions may not depend on it.
A conclusion the paper draws from its own results — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“Thus methylation not only supports STAT activity (by preventing PIAS association), but also promotes its inactivation by dephosphorylation.”
§ Principles of interleukin (IL)-6-type cytokine signalling and its regulation 1 > Protein tyrosine phosphatases (PTPs): what goes up must come down
plaindirect- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: passes — The paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
It may state two separate claims as one.
In the paper
“Experiments in vivo underscore the in vitro findings in demonstrating that mice expressing gp130 lacking Tyr 759 display splenomegaly, lymphadenopathy and an enhanced acute-phase reaction [161].”
§ Principles of interleukin (IL)-6-type cytokine signalling and its regulation 1 > Protein tyrosine phosphatases (PTPs): what goes up must come down
What the sources say
- Not matchedcites [161]
Couldn’t be matched to a paper in Crossref, so it can’t be checked.
boosteddirect- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: passes — The paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
It may state two separate claims as one.
- Not matched
A conclusion the paper draws from its own results — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“These differences suggest that signalling components requiring posttranslational modifications for their activation are long-lived, whereas the activity of short-lived proteins is regulated mainly at the transcriptional level.”
§ Principles of interleukin (IL)-6-type cytokine signalling and its regulation 1 > Half-lives of signalling components: party as long as you live
hedgedcorrelational- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: passes — The paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
It may state two separate claims as one.
None of the sources cited for this claim could be matched to a paper in Crossref, so there is nothing to check it against.
In the paper
“Whereas the feedback inhibitors SOCS1, SOCS2 and SOCS3 are very short-lived, STAT1, STAT3α and SHP2 have slow turnover rates.”
§ Principles of interleukin (IL)-6-type cytokine signalling and its regulation 1 > Half-lives of signalling components: party as long as you live
What the sources say
- Not matchedcites [222]
Couldn’t be matched to a paper in Crossref, so it can’t be checked.
- Not matchedcites [223]
Couldn’t be matched to a paper in Crossref, so it can’t be checked.
plain- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: unclear — It is unclear whether the paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
It may state two separate claims as one.
- Not matched
The paper states this without a source or data behind it here, so there is nothing to check it against. The quote shows it is in the paper.
In the paper
“The eight members of this family (CIS and SOCS1-SOCS7) contain a central SH2 domain, as well as a C-terminal domain called a SOCS box (Figure 4).”
§ Principles of interleukin (IL)-6-type cytokine signalling and its regulation 1 > The SOCS family of feedback inhibitors: natural born terminators
plainn = 8- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: fails — The paper’s conclusions may not depend on it.
- Based: passes — The paper gives a reason why it holds.
Probably not a substantial claim. The paper’s conclusions may not depend on it.
None of the sources cited for this claim could be matched to a paper in Crossref, so there is nothing to check it against.
In the paper
“For gp130, SOCS3 has been found to bind to the phosphotyrosine motif 759 [197,198], which is also the binding site for SHP2.”
§ Principles of interleukin (IL)-6-type cytokine signalling and its regulation 1 > The SOCS family of feedback inhibitors: natural born terminators
What the sources say
- Not matchedcites [197]
Couldn’t be matched to a paper in Crossref, so it can’t be checked.
- Not matchedcites [198]
Couldn’t be matched to a paper in Crossref, so it can’t be checked.
plaincorrelational- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: unclear — It is unclear whether the paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
It may state two separate claims as one.
- Not matched
In the paper
“Phosphorylation occurs at two tyrosine residues (Tyr 204 and Tyr 221 ) within the SOCS box and phosphorylation of Tyr 221 recruits p120 RasGAP leading to sustained ERK activation [139].”
§ Principles of interleukin (IL)-6-type cytokine signalling and its regulation 1 > The SOCS family of feedback inhibitors: natural born terminators
What the sources say
- Not matchedcites [139]
Couldn’t be matched to a paper in Crossref, so it can’t be checked.
plaindirect- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: unclear — It is unclear whether the paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
It may state two separate claims as one.
- Not matched
None of the sources cited for this claim could be matched to a paper in Crossref, so there is nothing to check it against.
In the paper
“Other reports, however, suggest that elongin C binding can stabilize SOCS1 and that the disruption of the interaction leads to proteasomal degradation of SOCS1 [206,215].”
§ Principles of interleukin (IL)-6-type cytokine signalling and its regulation 1 > The SOCS family of feedback inhibitors: natural born terminators
What the sources say
- Not matchedcites [206]
Couldn’t be matched to a paper in Crossref, so it can’t be checked.
- Not matchedcites [215]
Couldn’t be matched to a paper in Crossref, so it can’t be checked.
hedgeddirect- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: fails — The paper’s conclusions may not depend on it.
- Based: passes — The paper gives a reason why it holds.
Probably not a substantial claim. The paper’s conclusions may not depend on it. It may state two separate claims as one.
- Not matched
None of the sources cited for this claim could be matched to a paper in Crossref, so there is nothing to check it against.
In the paper
“Expression of SOCS proteins was found to be rapidly up-regulated by IL-6 (CIS, SOCS1, SOCS2 and SOCS3), LIF (CIS, SOCS1, SOCS2 and SOCS3), IL-11 (SOCS3) and OSM (CIS, SOCS1 and SOCS3) [32,190,192,193].”
§ Principles of interleukin (IL)-6-type cytokine signalling and its regulation 1 > The SOCS family of feedback inhibitors: natural born terminators
What the sources say
- Not matchedcites [32]
Couldn’t be matched to a paper in Crossref, so it can’t be checked.
- Not matchedcites [190]
Couldn’t be matched to a paper in Crossref, so it can’t be checked.
- Not matchedcites [192]
Couldn’t be matched to a paper in Crossref, so it can’t be checked.
plaindirect- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: unclear — It is unclear whether the paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
It may state two separate claims as one.
- Not matched
The paper states this without a source or data behind it here, so there is nothing to check it against. The quote shows it is in the paper.
In the paper
“As SOCS proteins are induced via the JAK/STAT pathway and subsequently inhibit STAT-mediated signal transduction, they are acting as classical feedback inhibitors.”
§ Principles of interleukin (IL)-6-type cytokine signalling and its regulation 1 > The SOCS family of feedback inhibitors: natural born terminators
plaindirect- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: passes — The paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
It may state two separate claims as one.
In the paper
“These phosphotyrosine residues may be part of an activated receptor or the tyrosine-phosphorylated C-terminal tail of SHP2 (from [156]).”
§ Principles of interleukin (IL)-6-type cytokine signalling and its regulation 1 > PERSPECTIVES
What the sources say
- Not matchedcites [156]
Couldn’t be matched to a paper in Crossref, so it can’t be checked.
hedgedconditional- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: fails — The paper’s conclusions may not depend on it.
- Based: passes — The paper gives a reason why it holds.
Probably not a substantial claim. The paper’s conclusions may not depend on it. It may state two separate claims as one.
- Not matched
None of the sources cited for this claim have been checked yet.
In the paper
“FKHR specifically enhanced the activity of STAT3-dependent promoters, such as the α 2 M promoter, but not that of a STAT5-responsive promoter.”
§ Principles of interleukin (IL)-6-type cytokine signalling and its regulation 1 > STAT action within the transcriptosome: where transcription factors gather
plaindirect- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: unclear — It is unclear whether the paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
It may state two separate claims as one.
None of the sources cited for this claim could be matched to a paper in Crossref, so there is nothing to check it against.
In the paper
“Other signalling pathways have been shown to induce stabilization of cytokine mRNAs as well: the JNK pathway induces stabilization of the short-lived IL-2 mRNA [219], and PI3K activation induces stabilization of IL-3 mRNA [220].”
§ Principles of interleukin (IL)-6-type cytokine signalling and its regulation 1 > PERSPECTIVES
What the sources say
- Not matchedcites [219]
Couldn’t be matched to a paper in Crossref, so it can’t be checked.
- Not matchedcites [220]
Couldn’t be matched to a paper in Crossref, so it can’t be checked.
plaindirect- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: fails — The paper’s conclusions may not depend on it.
- Based: passes — The paper gives a reason why it holds.
Probably not a substantial claim. The paper’s conclusions may not depend on it.
- Not matched
In the paper
“PI3K activation induces stabilization of IL-3 mRNA [220]”
§ Principles of interleukin (IL)-6-type cytokine signalling and its regulation 1 > PERSPECTIVES
What the sources say
- Not matchedcites [220]
Couldn’t be matched to a paper in Crossref, so it can’t be checked.
plaindirect- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: fails — The paper’s conclusions may not depend on it.
- Based: passes — The paper gives a reason why it holds.
Probably not a substantial claim. The paper’s conclusions may not depend on it.
- Not matched
In the paper
“The nuclear receptor co-repressor SMRT (silencing mediator of retinoic and thyroid hormone receptors) is a potential binding partner for STAT5 and represses STAT5-dependent transcription [255].”
§ Principles of interleukin (IL)-6-type cytokine signalling and its regulation 1 > STAT action within the transcriptosome: where transcription factors gather
What the sources say
- Not matchedcites [255]
Couldn’t be matched to a paper in Crossref, so it can’t be checked.
hedgedconditional- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: unclear — It is unclear whether the paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
It may state two separate claims as one.
- Not matched
In the paper
“Furthermore, FKHR and STAT3 can be co-immunoprecipitated and co-localize in the nucleus of IL-6-treated HepG2 cells [149].”
§ Principles of interleukin (IL)-6-type cytokine signalling and its regulation 1 > STAT action within the transcriptosome: where transcription factors gather
What the sources say
- Not matchedcites [149]
Couldn’t be matched to a paper in Crossref, so it can’t be checked.
plaincorrelational- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: passes — The paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
It may state two separate claims as one.
- Not matched
In the paper
“the JNK pathway induces stabilization of the short-lived IL-2 mRNA [219]”
§ Principles of interleukin (IL)-6-type cytokine signalling and its regulation 1 > PERSPECTIVES
What the sources say
- Not matchedcites [219]
Couldn’t be matched to a paper in Crossref, so it can’t be checked.
plaindirect- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: fails — The paper’s conclusions may not depend on it.
- Based: passes — The paper gives a reason why it holds.
Probably not a substantial claim. The paper’s conclusions may not depend on it.
- Not matched
A result the paper reports from its own data — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“Interestingly, an EZI mutant predominantly localized in the cytoplasm inhibited nuclear localization of STAT3, as well as STAT3-mediated transactivation.”
§ Principles of interleukin (IL)-6-type cytokine signalling and its regulation 1 > STAT action within the transcriptosome: where transcription factors gather
plaindirect- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: passes — The paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
It may state two separate claims as one.
In the paper
“Interestingly, Nmi itself is induced by IL-2 and IFNγ , indicating a positive feedback loop within this signal transduction.”
§ Principles of interleukin (IL)-6-type cytokine signalling and its regulation 1 > STAT action within the transcriptosome: where transcription factors gather
What the sources say
- Not matchedcites [253]
Couldn’t be matched to a paper in Crossref, so it can’t be checked.
hedgeddirect- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: unclear — It is unclear whether the paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
It may state two separate claims as one.
- Not matched
In the paper
“This interaction is further modulated by Nmi (N-Myc interactor) which augments CBP recruitment to STAT1 and STAT5, and potentiates IL-2 and IFNγ signalling [253].”
§ Principles of interleukin (IL)-6-type cytokine signalling and its regulation 1 > STAT action within the transcriptosome: where transcription factors gather
What the sources say
- Not matchedcites [253]
Couldn’t be matched to a paper in Crossref, so it can’t be checked.
plaindirect- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: unclear — It is unclear whether the paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
It may state two separate claims as one.
- Not matched
The authors state this as an assumption.
The membrane-proximal FNIII domains bridge the ~9 nm distance between the CBM C-termini so that the cytoplasmic parts are close enough to become activated by associated JAKs.
“The membrane-proximal FNIII domains might bridge this distance so that the cytoplasmic parts are in close enough proximity to become activated by the associated JAKs (Figure 5).This assumption is supported by a recent study on the role of the gp130 FNIII domains for heterodimerization with the LIFR [38].”
The paper relies on this without support.
gp130 is ubiquitously expressed.
“Although gp130 is ubiquitously expressed, the number of cells that respond to a certain IL-6-type cytokine is limited, since the expression of the other receptor subunits, especially of the α-receptors, is more restricted and tightly regulated.”
The paper relies on this without support.
IL-6-type cytokines form a subfamily of helix bundle cytokines.
“IL-6-type cytokines form a subfamily of the helix bundle cytokines.”
The paper relies on this without support.
All IL-6-type cytokines comprise four long α-helices A-D arranged in an up-up-down-down topology.
“All IL-6-type cytokines comprise four long α-helices termed A, B, C and D, which are arranged in a way that leads to an up-up-down-down topology (Figure 3).”
The paper relies on this without support.
Each receptor contains at least one cytokine-binding module (CBM) comprising two FNIII domains.
“Each receptor contains at least one cytokine-binding module (CBM) that comprises two FNIII-domains.”
The paper relies on this without support.
JAKs bind to the membrane-proximal region of cytokine receptors, which contains conserved box1 and box2 motifs.
“JAKs bind to the membrane-proximal region of cytokine receptors, which contains conserved so-called box1 and box2 motifs.”
The paper relies on this without support.
The N-terminal region of JAKs comprises a FERM domain crucial for receptor association.
“The N-terminal region of JAKs comprises a FERM (fourpoint-one, ezrin, radixin and moesin) domain which is crucial for receptor association.”
The paper relies on this without support.
The STAT family encompasses seven mammalian members.
“The STAT family of transcription factors encompasses seven mammalian members, designated STAT1, -2, -3, -4, -5a, -5b and -6.”
The paper relies on this without support.
In response to IL-6 stimulation, cytoplasmic STAT3 rapidly accumulates in the nucleus.
“In response to IL-6 stimulation, cytoplasmic STAT3 rapidly accumulates in the nucleus.”
The paper relies on this without support.
Nuclear accumulation is triggered by STAT dimerization in response to tyrosine phosphorylation.
“Nuclear accumulation is triggered by STAT dimerization in response to tyrosine phosphorylation.”
Claims other papers make about this one
Each is checked against this paper’s own text: does it say what the citing paper says it does?
The source backs part of the claim, not all of it — or backs it for a different population, condition or comparison.
In the citing paper
“IL-6Rα expression is normally associated with hepatocytes and leukocytes but has also been described in cancer cells, including PDAC.”
From Dynamic IL-6R/STAT3 signaling leads to heterogeneity of metabolic phenotype in pancreatic ductal adenocarcinoma cells (2024) · cites this paper as [40]
Experimental — accuracy not yet measuredThe source backs part of the claim, not all of it — or backs it for a different population, condition or comparison.
In the citing paper
“The cytokine IL-6 triggers multiple downstream responses, including metabolic regulation.”
From Dynamic IL-6R/STAT3 signaling leads to heterogeneity of metabolic phenotype in pancreatic ductal adenocarcinoma cells (2024) · cites this paper as [40]
Experimental — accuracy not yet measuredThe source backs part of the claim, not all of it — or backs it for a different population, condition or comparison.
In the citing paper
“IL-6, which was discovered in 1986 (27), is a pleiotropic cytokine involved not only in immune responses but also in inflammation, hematopoiesis, bone metabolism, embryonic development and other fundamental processes (1, 21, 28–32).”
From IL-6 in inflammation, autoimmunity and cancer (2021) · cites this paper as [30]
Experimental — accuracy not yet measured
Citations
Cites
STATs: transcriptional control and biological impact
Levy, D. E., & Darnell, J. E. (2002) · Nature Reviews Molecular Cell Biology · doi:10.1038/nrm909 · Cited by 3,201
Bromberg, J. F., Wrzeszczynska, M. H., Devgan, G., Zhao, Y., Pestell, R. G., Albanese, C., & Darnell, J. E. (1999) · Cell · doi:10.1016/s0092-8674(00)81959-5 · Cited by 2,790
Interleukin-6-type cytokine signalling through the gp130/Jak/STAT pathway
HEINRICH, P. C., BEHRMANN, I., MÜLLER-NEWEN, G., SCHAPER, F., & GRAEVE, L. (1998) · Biochemical Journal · doi:10.1042/bj3340297 · Cited by 2,130
Self-citationA family of cytokine-inducible inhibitors of signalling
Starr, R., Willson, T. A., Viney, E. M., Murray, L. J. L., Rayner, J. R., Jenkins, B. J., Gonda, T. J., Alexander, W. S., Metcalf, D., Nicola, N. A., et al. (1997) · Nature · doi:10.1038/43206 · Cited by 2,066
A new protein containing an SH2 domain that inhibits JAK kinases
Endo, T. A., Masuhara, M., Yokouchi, M., Suzuki, R., Sakamoto, H., Mitsui, K., Matsumoto, A., Tanimura, S., Ohtsubo, M., Misawa, H., et al. (1997) · Nature · doi:10.1038/43213 · Cited by 1,408
Interleukin-6 family of cytokines and gp130.
Kishimoto, T., Akira, S., Narazaki, M., & Taga, T. (1995) · Blood · doi:10.1182/blood.v86.4.1243.bloodjournal8641243 · Cited by 1,362
O’Shea, J. J., Gadina, M., & Schreiber, R. D. (2002) · Cell · doi:10.1016/s0092-8674(02)00701-8 · Cited by 1,137
Structure and function of a new STAT-induced STAT inhibitor
Naka, T., Narazaki, M., Hirata, M., Matsumoto, T., Minamoto, S., Aono, A., Nishimoto, N., Kajita, T., Taga, T., Yoshizaki, K., et al. (1997) · Nature · doi:10.1038/43219 · Cited by 1,040
Crystal Structure of the Tyrosine Phosphatase SHP-2
Hof, P., Pluskey, S., Dhe‐Paganon, S., Eck, M. J., & Shoelson, S. E. (1998) · Cell · doi:10.1016/s0092-8674(00)80938-1 · Cited by 997
Specific Inhibition of Stat3 Signal Transduction by PIAS3
Chung, C. D., Liao, J., Liu, B., Rao, X., Jay, P., Berta, P., & Shuai, K. (1997) · Science · doi:10.1126/science.278.5344.1803 · Cited by 980
Cited by
Sorted by citations
Items 801–900 of 3,269
Extracranial origin of headache
Burstein, R., Blake, P., Schain, A. J., & Perry, C. J. (2017) · Current Opinion in Neurology · doi:10.1097/wco.0000000000000437 · Cited by 62
Won, H., Moreira, D., Gao, C., Duttagupta, P. A., Zhao, X., Manuel, E. R., Diamond, D. J., Yuan, Y., Liu, Z., Jones, J. O., et al. (2017) · Journal of Leukocyte Biology · doi:10.1189/jlb.3ma1016-451rr · Cited by 62
“of the specific LIFR with a shared IL-6Rb subunit (gp130) to activate downstream signaling through the Jak/STAT, MAPK, and PI3K signaling pathways [9, 10].”
BackgroundInhibition of STAT3 Signaling Reduces IgA1 Autoantigen Production in IgA Nephropathy
Yamada, K., Huang, Z.-Q., Raška, M., Reily, C., Anderson, J. C., Suzuki, H., Ueda, H., Moldoveanu, Z., Kiryluk, K., Suzuki, Y., et al. (2017) · Kidney International Reports · doi:10.1016/j.ekir.2017.07.002 · Cited by 64
“The activation of STAT signaling pathways requires tyrosine phosphorylation of STAT proteins.(62) In our study, IL-6 activation of STAT3 phosphorylation (Y705) was greater and persisted longer in IgA1-producing cells from IgAN patients compared with those from control subjects.”
ResultDiomede, F., Caputi, S., Merciaro, I., et al. (2013) · International Endodontic Journal · doi:10.1111/iej.12230 · Cited by 61
MeCP2/H3meK9 are involved in IL-6 gene silencing in pancreatic adenocarcinoma cell lines
Dandrea, M., Donadelli, M., Costanzo, C., Scarpa, A., & Palmieri, M. (2009) · Nucleic Acids Research · doi:10.1093/nar/gkp723 · Cited by 61
Ichikawa, T., Zhang, J., Chen, K., Liu, Y., Schopfer, F. J., Baker, P. R. S., Freeman, B. Α., Chen, Y. E., & Cui, T. (2008) · Endocrinology · doi:10.1210/en.2007-1639 · Cited by 61
“We did not observe any effects of LNO2 on the expression of SOCS or PIAS genes (28, 29).”
Zobel, K., Martus, P., Pletz, M. W., et al. (2012) · BMC Pulmonary Medicine · doi:10.1186/1471-2466-12-6 · Cited by 61
“The concentrations of interleukin 6 (IL-6) [5] and interleukin 10 (IL-10) [6] reflect inflammatory and anti-inflammatory reactions, respectively.”
BackgroundHou, J., Lv, A., Deng, Q., Zhang, G., Hu, X., & Cui, H. (2018) · Oncology Reports · doi:10.3892/or.2018.6859 · Cited by 60
“Interleukin-6 (IL-6), a well-characterized proinflammatory cytokine, has been shown to play a crucial role in driving many of the ‘hallmarks’ of cancer including activation of the signaling of cell proliferation, enhancement of migration and invasion, resistance to cell death and induction of angiogenesis through down…”
BackgroundMoradian, N., Gouravani, M., Salehi, M. A., Heidari, A., Shafeghat, M., Hamblin, M. R., & Rezaei, N. (2020) · European Cytokine Network · doi:10.1684/ecn.2020.0451 · Cited by 60
“Other cascades that can be activated by IL-6 include SHP-2/ERK MAPK, PI3K-AKT-mTORC1, and SRC-YAPNOTCH pathways [69-71].”
BackgroundIL-6 family cytokines in respiratory health and disease
Dawson, R., Jenkins, B. J., & Saad, M. I. (2021) · Cytokine · doi:10.1016/j.cyto.2021.155520 · Cited by 68
Malengier‐Devlies, B., Metzemaekers, M., Wouters, C. H., Proost, P., & Matthys, P. (2021) · Frontiers in Immunology · doi:10.3389/fimmu.2021.766620 · Cited by 64
Prapiadou, S., Živković, L., Thorand, B., George, M. J., van der Laan, S. W., Malik, R., Herder, C., Köenig, W., Ueland, T., Kleveland, O., et al. (2023) · Circulation · doi:10.1161/circulationaha.123.064974 · Cited by 63
Li, Y., Hsieh, L., Tang, R., Liao, S.-K., & Yeh, K. (2009) · Human Immunology · doi:10.1016/j.humimm.2009.01.004 · Cited by 60
Mirowska-Guzel, D. M., Gromadzka, G., Mach, A., Członkowski, A., & Członkowska, A. (2011) · Journal of Neuroimmunology · doi:10.1016/j.jneuroim.2011.04.014 · Cited by 59
“IL-1, TNF-α, IL-6 are expressed by many cell types within MS lesions (Selmaj et al., 1991, Woodroofe and Cuzner, 1993, Cannella and Raine, 1995, Schönrock et al., 2000, Heinrich et al., 2003).”
Epithelial gp130/Stat3 functions: An intestinal signaling node in health and disease
Ernst, M., Thiem, S., Nguyen, P. M., Eissmann, M. F., & Putoczki, T. L. (2014) · Seminars in Immunology · doi:10.1016/j.smim.2013.12.006 · Cited by 63
Howlett, M., Judd, L. M., Jenkins, B. J., Gruta, N. L. L., Grail, D., Ernst, M., & Giraud, A. S. (2005) · Gastroenterology · doi:10.1053/j.gastro.2005.06.068 · Cited by 60
Dohgu, S., Fleegal, M. A., & Banks, W. A. (2011) · Journal of Neuroinflammation · doi:10.1186/1742-2094-8-167 · Cited by 60
Morton, S. D., Cadamuro, M., Brivio, S., et al. (2015) · Oncotarget · doi:10.18632/oncotarget.4482 · Cited by 60
“LIF did not induce any significant changes in the phosphorylation levels of STAT3 (Figure 5A, 5B), an effector classically activated by LIF [21], or of ERK1/2 (Figure 5C, 5D) in either CCA cell line.”
BackgroundForrai, A., Boyle, K., Hart, A. H., Hartley, L., Rakar, S., Willson, T. A., Simpson, K., Roberts, A. W., Alexander, W. S., Voss, A. K., et al. (2005) · Stem Cells · doi:10.1634/stemcells.2005-0323 · Cited by 65
TNF-α-induced miR-155 regulates IL-6 signaling in rheumatoid synovial fibroblasts
Migita, K., Iwanaga, N., Izumi, Y., Kawahara, C., Kumagai, K., Nakamura, T., Koga, T., & Kawakami, A. (2017) · BMC Research Notes · doi:10.1186/s13104-017-2715-5 · Cited by 61
“Intracellular signaling pathways, that concurrently activated by the inflammatory stimulus, often interact with one another cross-regulatory feedback mechanism [19].”
Speirs, C., Williams, J. J. L., Riches‐Suman, K., Salt, I. P., & Palmer, T. M. (2017) · Pharmacological Research · doi:10.1016/j.phrs.2017.10.001 · Cited by 61
“However, soluble IL-6R (sIL-6R ) is produced during inflammation thus increasing the repertoire of IL-6-responsive cells [10,11].”
Interleukin-6 induces drug resistance in renal cell carcinoma
Ishibashi, K., Koguchi, T., Matsuoka, K., Onagi, A., Tanji, R., Takinami-Honda, R., Hoshi, S., Onoda, M., Kurimura, Y., Hata, J., et al. (2018) · FUKUSHIMA JOURNAL OF MEDICAL SCIENCE · doi:10.5387/fms.2018-15 · Cited by 61
Kuang, Y., Guo, W., Jing, L., Xu, D., Liao, Y., Zhao, H., Du, X., Wang, H., Xu, M., Song, H., et al. (2019) · Cell Death and Disease · doi:10.1038/s41419-019-1528-y · Cited by 62
Increased Circulating Levels of Interleukin-6 Affect the Redox Balance in Skeletal Muscle
Forcina, L., Miano, C., Scicchitano, B. M., Rizzuto, E., Berardinelli, M. G., Benedetti, F. D., Pelosi, L., & Musarò, A. (2019) · Oxidative Medicine and Cellular Longevity · doi:10.1155/2019/3018584 · Cited by 63
Molecular Structure and Function of Janus Kinases: Implications for the Development of Inhibitors
Garrido-Trigo, A., & Salas, A. (2019) · Journal of Crohn s and Colitis · doi:10.1093/ecco-jcc/jjz206 · Cited by 63
Adipocyte activation of cancer stem cell signaling in breast cancer
Wolfson, B. (2015) · World Journal of Biological Chemistry · doi:10.4331/wjbc.v6.i2.39 · Cited by 60
Haan, S., Margue, C., Engrand, A., Rolvering, C., de Leur, H. S.-V., Heinrich, P. C., Behrmann, I., & Haan, C. (2008) · The Journal of Immunology · doi:10.4049/jimmunol.180.2.998 · Cited by 63
“The STAT transcription factors are then tyrosine phosphorylated and translocate to the nucleus where they bind to specific DNA sequences in the promoter regions of their respective target genes (2, 3).”
BackgroundSelf-citationMoran, D. M., Mattocks, M. A., Cahill, P. A., Koniaris, L. G., & McKillop, I. H. (2007) · Journal of Surgical Research · doi:10.1016/j.jss.2007.04.022 · Cited by 61
IL-6 receptor blockade does not slow β cell loss in new-onset type 1 diabetes
Greenbaum, C. J., Serti, E., Lambert, K., Weiner, L. J., Kanaparthi, S., Lord, S. M., Gitelman, S. E., Wilson, D. M., Gaglia, J. L., Griffin, K., et al. (2021) · JCI Insight · doi:10.1172/jci.insight.150074 · Cited by 62
“Classical IL-6 signaling occurs after IL-6 binds to membrane-bound IL-6 receptor (IL-6R) and associates with gp130, forming an active ligand-receptor complex and activating, via phosphorylation, the JAK/signal transducer and activator of transcription protein 3 (JAK/STAT3) cascade (12).”
Area postrema neurons mediate interleukin-6 function in cancer cachexia
Sun, Q., van de Lisdonk, D., Ferrer, M., Gegenhuber, B., Wu, M. V., Park, Y., Tuveson, D. A., Tollkühn, J., Janowitz, T., & Li, B. (2024) · Nature Communications · doi:10.1038/s41467-024-48971-1 · Cited by 63
Liang, H., Block, T. M., Wang, M., et al. (2012) · Cancer Biomarkers · doi:10.3233/cbm-2012-00276 · Cited by 59
“IL-6 is the protoype for a family of structurally related cytokines that share a common receptor subunit, gp130 [28,29].”
Robson, M. J., Turner, R. C., Naser, Z. J., McCurdy, C. R., O'Callaghan, J. P., Huber, J. D., & Matsumoto, R. R. (2014) · Experimental Neurology · doi:10.1016/j.expneurol.2014.01.020 · Cited by 59
“Our findings are consistent with earlier reports that METH-induced activation of astrocytes involves OSM interactions with OSMR and subsequent induction of JAK2/STAT3 signaling (Chen and Benveniste 2004; Hebert and O'Callaghan 2000; Heinrich et al. 2003).”
ResultInterleukin 11 regulates endometrial cancer cell adhesion and migration via STAT3
LAY, V., Yap, J., Sonderegger, S., et al. (2012) · International Journal of Oncology · doi:10.3892/ijo.2012.1486 · Cited by 59
Yang, X. P., Irani, K., Mattagajasingh, S. N., DiPaula, A., Khanday, F. A., Ozaki, M., Fox-Talbot, K., Baldwin, W. M., & Becker, L. C. (2005) · Arteriosclerosis Thrombosis and Vascular Biology · doi:10.1161/01.atv.0000168428.96177.24 · Cited by 60
Burger, R., Gouill, S. L., Tai, Y., Shringarpure, R., Tassone, P., Neri, P., Podar, K., Catley, L. P., Hideshima, T., Chauhan, D., et al. (2009) · Molecular Cancer Therapeutics · doi:10.1158/1535-7163.mct-08-0149 · Cited by 59
“The gp130 signal transducer chains of the IL-6R complex are constitutively associated with JAK kinases, which play a critical role in IL-6-mediated cellular response (11).”
BackgroundSmith, D. A., Kiba, A., Zong, Y., et al. (2013) · Molecular Cancer Research · doi:10.1158/1541-7786.mcr-13-0238 · Cited by 59
“Invasive tumor foci identified in grafts expressing IL6 or OSMwith loss of PTEN exhibited increased activation of JAK/STAT pathway Ligand engagement of IL6 family members activates constitutively Janus-activated kinases (JAK), resulting in activation of the signal transduction and transcription factor (STAT), mitogen-…”
BackgroundInfluentialA panoramic review and in silico analysis of IL-11 structure and function
Negahdaripour, M., Nezafat, N., & Ghasemi, Y. (2016) · Cytokine & Growth Factor Reviews · doi:10.1016/j.cytogfr.2016.06.002 · Cited by 59
Multiple reasons for an inefficient STAT1 response upon IL-6-type cytokine stimulation
Haan, S., Keller, J. F., Behrmann, I., Heinrich, P. C., & Haan, C. (2005) · Cellular Signalling · doi:10.1016/j.cellsig.2005.03.010 · Cited by 59
Self-citationIgaz, P., Salvi, R., Rey, J.-P., Glauser, M., Pralong, F. P., & Gaillard, R. C. (2005) · Endocrinology · doi:10.1210/en.2005-0729 · Cited by 60
“1 TCGGACGCTGGATGGTGTATTTG GGTTCACCTCAGTCACATTGATCCG 317 45 OSMR XM_226814.”
BackgroundInfluentialBellezza, I., Neuwirt, H., Nemes, C., Cavarretta, I. T. R., Puhr, M., Steiner, H., Minelli, A., Bartsch, G. C., Offner, F. A., Hobisch, A., et al. (2006) · American Journal Of Pathology · doi:10.2353/ajpath.2006.060171 · Cited by 59
Advances in understanding the mechanism of zebrafish heart regeneration
Kikuchi, K. (2014) · Stem Cell Research · doi:10.1016/j.scr.2014.07.003 · Cited by 61
“By using proteomics and biochemical approaches, Oncostatin M (OSM), an interleukin-6 family cytokine with pleiotropic functions (Heinrich et al., 2003; Tanaka and Miyajima, 2003), was found to be highly expressed in hearts with dilated cardiomyopathy but not in healthy hearts.”
MethodGiannitrapani, L. (2013) · World Journal of Gastroenterology · doi:10.3748/wjg.v19.i16.2449 · Cited by 58
Combination treatment for myeloproliferative neoplasms using JAK and pan‐class I PI 3K inhibitors
Choong, M. L., Pecquet, C., Pendharkar, V. V., Diaconu, C. C., Yong, J. W. Y., Tai, S. J., Wang, S. F., Defour, J., Sangthongpitag, K., Villeval, J., et al. (2013) · Journal of Cellular and Molecular Medicine · doi:10.1111/jcmm.12156 · Cited by 59
“The receptor tyrosine kinase/RAS/mitogen-activated protein kinase (RTK/RAS/ MAPK) pathway was found to interact with the JAK/STAT pathway at multiple levels [21, 22].”
BackgroundKinome Analysis Reveals Nongenomic Glucocorticoid Receptor-Dependent Inhibition of Insulin Signaling
Löwenberg, M., Tuynman, J. B., Scheffer, M., Verhaar, A. P., Vermeulen, L., van Deventer, S. J. H., Hommes, D. W., & Peppelenbosch, M. P. (2006) · Endocrinology · doi:10.1210/en.2005-1602 · Cited by 59
“6B), key players in IL-6-induced signaling (25, 26).”
BackgroundSaxena, R. (2015) · World Journal of Hepatology · doi:10.4254/wjh.v7.i11.1572 · Cited by 58
Al‐Massri, K. F., Ahmed, L. A., & El-Abhar, H. S. (2018) · Neurochemistry International · doi:10.1016/j.neuint.2018.08.007 · Cited by 58
“In addition, IL-6 mainly activates the janus-activated kinase–signal transducer and activator of transcription (JAK/STAT) transduction pathway and mitogen-activated protein kinase (MAPK) cascade contributing to neuropathic pain (Dubovy et al., 2010; Heinrich et al., 2003).”
Verstockt, S., Verstockt, B., & Vermeire, S. (2019) · Expert Opinion on Therapeutic Targets · doi:10.1080/14728222.2019.1677608 · Cited by 60
d’Alessandro, M., Perillo, F., Refini, R. M., et al. (2020) · International Immunopharmacology · doi:10.1016/j.intimp.2020.106748 · Cited by 58
gp130 dimerization in the absence of ligand: Preformed cytokine receptor complexes
Tenhumberg, S., Schuster, B., Zhu, L., Kovaleva, M., Scheller, J., Kallen, K., & Rose‐John, S. (2006) · Biochemical and Biophysical Research Communications · doi:10.1016/j.bbrc.2006.05.173 · Cited by 58
Recent advances in defining the hematopoietic stem cell niche
Moore, K. A. (2004) · Current Opinion in Hematology · doi:10.1097/01.moh.0000133652.06863.47 · Cited by 58
IL6 Signaling in Peripheral Blood T Cells Predicts Clinical Outcome in Breast Cancer
Wang, L., Miyahira, A. K., Simons, D. L., Lu, X., Chang, A. Y., Wang, C., Suni, M. A., Maino, V. C., Dirbas, F. M., Yim, J., et al. (2017) · Cancer Research · doi:10.1158/0008-5472.can-16-1373 · Cited by 55
“IL6 signals through the common gp130 receptor and the specific IL6Ra coreceptor to activate the Janus kinase (JAK)-signal transducer and activator of transcription (STAT) signaling pathway (2).”
Dinca, S. C., Greiner, D., Weidenfeld, K., Bond, L., Barkan, D., & Jorcyk, C. L. (2021) · Breast Cancer Research · doi:10.1186/s13058-021-01430-x · Cited by 58
Inflammatory bowel disease, colitis, and cancer: unmasking the chronic inflammation link
Khaze, V., Noorolyai, S., Youshanlui, M. A., Hossein, S., Nasiri, H., Mansoori, B., Holmskov, U., & Baradaran, B. (2024) · International Journal of Colorectal Disease · doi:10.1007/s00384-024-04748-y · Cited by 69
Chronic inflammation and the development of malignancy in the GI tract
Fichtner‐Feigl, S., Kesselring, R., & Strober, W. (2015) · Trends in Immunology · doi:10.1016/j.it.2015.06.007 · Cited by 58
Zahs, A., Bird, M. D., Ramírez, L., Choudhry, M. A., & Kovacs, E. J. (2013) · Shock · doi:10.1097/shk.0b013e318289d6c6 · Cited by 57
“Many immune cells are known to express IL-6R! (hepatocytes, neutrophils, macrophages, T and B cells) (9); however, with the dis-”
BackgroundMcCall, K. D., Holliday, D. K., Dickerson, E., Wallace, B., Schwartz, A. L., Schwartz, C., Lewis, C. J., Kohn, L. D., & Schwartz, F. (2010) · Journal of Endocrinology · doi:10.1677/joe-09-0370 · Cited by 59
Serum interleukin-6 as a prognostic biomarker in patients with metastatic melanoma
Hoejberg, L., Bastholt, L., Johansen, J. S., Christensen, I. J., Gehl, J., & Schmidt, H. (2012) · Melanoma Research · doi:10.1097/cmr.0b013e3283550aa5 · Cited by 57
Interleukin-6 subfamily cytokines and rheumatoid arthritis: Role of antagonists
Jazayeri, J. A., Carroll, G. J., & Vernallis, A. B. (2009) · International Immunopharmacology · doi:10.1016/j.intimp.2009.09.019 · Cited by 58
Concurrent Isolation of Lymphocytes and Granulocytes Using Prefocused Free Flow Acoustophoresis
Grenvall, C., Magnusson, C., Lilja, H. G., et al. (2015) · Analytical Chemistry · doi:10.1021/acs.analchem.5b00370 · Cited by 57
Jeong, S. K., Kim, J., Lee, C. G., Park, Y.-S., Kim, S., Yoon, S. O., Han, D. H., Lee, K. Y., Jeong, M. H., & Jo, W. S. (2015) · Immunobiology · doi:10.1016/j.imbio.2015.11.010 · Cited by 58
Pohin, M., Guesdon, W., Mekouo, A. A. T., Rabeony, H., Pâris, I., Atanassov, H., Favot, L., Mcheik, J. N., Bernard, F., Richards, C. D., et al. (2016) · European Journal of Immunology · doi:10.1002/eji.201546216 · Cited by 58
He, M., Shi, X., Yang, M., Yang, T., Li, T., & Chen, J. (2018) · Experimental Neurology · doi:10.1016/j.expneurol.2018.09.006 · Cited by 57
“IL-6 exerts its action via the signal transduction receptor glycoprotein (gp) 130, which is the core receptor of IL-6, to activate its downstream signaling pathways (Heinrich et al., 2003).”
Komyod, W., Böhm, M., Metze, D., Heinrich, P. C., & Behrmann, I. (2007) · Molecular Cancer Research · doi:10.1158/1541-7786.mcr-06-0274 · Cited by 56
“Upon phosphorylation of a single tyrosine residue, the STATs translocate as dimers to the nucleus, where they regulate the transcription of target genes (1, 2).”
BackgroundSelf-citationRegueiro, V., Campos, M. A. L., Morey, P., et al. (2008) · European Respiratory Journal · doi:10.1183/09031936.00087708 · Cited by 57
Saylor, P. J., Kozak, K. R., Smith, M. R., Ancukiewicz, M., Efstathiou, J. A., Zietman, A. L., Jain, R. K., & Duda, D. G. (2012) · The Oncologist · doi:10.1634/theoncologist.2011-0321 · Cited by 57
“IL-6 Interleukin 6 Cytokine that functions in inflammation and the maturation of B cells; produced at sites of acute and chronic inflammation [43]”
BackgroundJäger, B., Klatt, D., Plappert, L., Golpon, H. A., Lienenklaus, S., Barbosa, P. D., Schambach, A., & Prasse, A. (2020) · Cellular Signalling · doi:10.1016/j.cellsig.2020.109672 · Cited by 56
Orchestrated modulation of rheumatoid arthritis via crosstalking intracellular signaling pathways
Ibrahim, S. S. A., & Huttunen, K. M. (2021) · Inflammopharmacology · doi:10.1007/s10787-021-00800-3 · Cited by 56
Mechanisms by which mastitis affects reproduction in dairy cow: A review
Wang, N., Zhou, C., Basang, W., Zhu, Y., Wang, X., Li, C., Chen, L., & Zhou, X. (2021) · Reproduction in Domestic Animals · doi:10.1111/rda.13953 · Cited by 61
Exacerbation of allergic rhinitis by the commensal bacterium Streptococcus salivarius
Miao, P., Jiang, Y., Jian, Y., Shi, J., Liu, Y., Piewngam, P., Zheng, Y., Cheung, G. Y. C., Liu, Q., Otto, M. J., et al. (2023) · Nature Microbiology · doi:10.1038/s41564-022-01301-x · Cited by 56
Chen, C., Chu, C., Liu, K., Huang, C. F., Chang, J., Pan, W., Chen, H.-H., Cheng, Y.-H., Lee, K., Chen, M., et al. (2013) · Biochemical Pharmacology · doi:10.1016/j.bcp.2013.07.025 · Cited by 56
“However, flow cytometric analysis showed that the expression level of both IL-6R/gp80 and gp130, 2 receptor subunits of the IL-6 signaling system [18,19] was identical between parental and drug-resistant cells (Fig.”
BackgroundKurosaka, M., & Machida, S. (2013) · Cell Proliferation · doi:10.1111/cpr.12045 · Cited by 58
Ghosh, M. K., Sharma, P., Harbor, P. C., Rahaman, S. O., & Haque, S. J. (2005) · Oncogene · doi:10.1038/sj.onc.1208894 · Cited by 54
Kirsch, M., Trautmann, N., Ernst, M., & Hofmann, H. (2010) · Glia · doi:10.1002/glia.20961 · Cited by 57
Signal transducers and activators of transcription—from cytokine signalling to cancer biology
Santos, C. I., & Costa‐Pereira, A. P. (2011) · Biochimica et Biophysica Acta (BBA) - Reviews on Cancer · doi:10.1016/j.bbcan.2011.03.003 · Cited by 59
Ishdorj, G., Johnston, J. B., & Gibson, S. B. (2010) · Molecular Cancer Therapeutics · doi:10.1158/1535-7163.mct-10-0550 · Cited by 57
IL-6 induces MUC4 expression through gp130/STAT3 pathway in gastric cancer cell lines
Mejías‐Luque, R., Peiró, S., Vincent, A., SEUNINGEN, I. V., & de Bolós, C. (2008) · Biochimica et Biophysica Acta (BBA) - Molecular Cell Research · doi:10.1016/j.bbamcr.2008.05.020 · Cited by 55
“IL-6 belongs to a family of cytokines including interleukin-11 (IL-11), leukaemia inhibitory factor (LIF), oncostatin M (OSM), ciliary neurotrophic factor (CNFT), cardiotrophin-1 (CT-1), cardiotrophin-like cytokine (CLC) and interleukin-27 (IL-27), that can activate target genes involved in differentiation, survival,…”
BackgroundRole of STAT3 in Transformation and Drug Resistance in CML
Nair, R. R., Tolentino, J. H. G., & Hazlehurst, L. (2012) · Frontiers in Oncology · doi:10.3389/fonc.2012.00030 · Cited by 57
“Irrespective of the activating kinase protein, STAT3 gets phosphorylated at the Tyr705 residue in the C-terminal domain and this phosphorylation leads to its activation (Heinrich et al., 1998, 2003; Quesnelle et al., 2007).”
BackgroundCaspase-1 induces smooth muscle cell growth in hypoxia-induced pulmonary hypertension
Udjus, C., Cero, F. T., Halvorsen, B. L., Behmen, D., Carlson, C. R., Bendiksen, B. A., Espe, E. K. S., Sjaastad, I., Løberg, E. M., Yndestad, A., et al. (2019) · American Journal of Physiology-Lung Cellular and Molecular Physiology · doi:10.1152/ajplung.00322.2018 · Cited by 56
Werner‐Klein, M., Grujovic, A., Irlbeck, C., Obradović, M. M. S., Hoffmann, M., Koerkel-Qu, H., Lu, X., Treitschke, S., Köstler, C., Botteron, C., et al. (2020) · Nature Communications · doi:10.1038/s41467-020-18701-4 · Cited by 55
Humanin and the Receptors for Humanin
Matsuoka, M., & Hashimoto, Y. (2009) · Molecular Neurobiology · doi:10.1007/s12035-009-8090-z · Cited by 56
“There are two types of receptors belonging to IL-6 receptor family [58, 59 ].”
BackgroundKreis, S., Munz, G. A., Haan, S., Heinrich, P. C., & Behrmann, I. (2007) · Molecular Cancer Research · doi:10.1158/1541-7786.mcr-07-0317 · Cited by 58
“Such activated STAT dimers finally translocate to the nucleus where they initiate transcription by binding to response elements in the promoter of target genes (3).”
BackgroundSelf-citationMammary Gland Remodeling Depends on gp130 Signaling through Stat3 and MAPK
Zhao, L., Hart, S., Cheng, J., Melenhorst, J. J., Bierie, B., Ernst, M., Stewart, C. L., Schaper, F., Heinrich, P. C., Ullrich, A., et al. (2004) · Journal of Biological Chemistry · doi:10.1074/jbc.m313131200 · Cited by 56
Self-citationCosta, D. J., Favali, C. B. F., Clarêncio, J., et al. (2004) · Infection and Immunity · doi:10.1128/iai.72.3.1298-1305.2004 · Cited by 56
“It has pleiotropic effects on diverse cell types and is recognized for its proinflammatory properties (17).”
BackgroundLin, J., Li, Q., Chen, H., Lin, H., Lai, Z., & Peng, J. (2015) · Oncology Letters · doi:10.3892/ol.2015.2956 · Cited by 53
“IL‑6 is key in promoting cellular proliferation and the inhibition of apoptosis (32), and acts by binding to its receptor (soluble IL‑6R) and co‑receptor [glycoprotein 130 (gp130)], resulting in activation of the associated Janus kinases (JAKs).”
The Pathogenesis and Therapeutic Approaches of Diabetic Neuropathy in the Retina
Oshitari, T. (2021) · International Journal of Molecular Sciences · doi:10.3390/ijms22169050 · Cited by 58
“A common receptor component of the IL-6 family is gp130 and after binding cytokines, the JAK/STAT pathway is activated [107].”
BackgroundInfluentialCao, J., Ji, L., Zhan, Y., Shao, X., Pengcheng, X., Wu, B., Chen, P., Cheng, L., Zhuang, X., Ou, Y., et al. (2023) · Cellular and Molecular Immunology · doi:10.1038/s41423-023-01089-8 · Cited by 55
Meng, C., Zhang, J.-C., Shi, R.-L., Zhang, S.-H., & Yuan, S. (2015) · Neuroscience · doi:10.1016/j.neuroscience.2015.08.055 · Cited by 55
A Current View of Functional Biomaterials for Wound Care, Molecular and Cellular Therapies
Piraino, F., & Selimović, Š. (2015) · BioMed Research International · doi:10.1155/2015/403801 · Cited by 55
Pregnane X Receptor Modulates the Inflammatory Response in Primary Cultures of Hepatocytes
Sun, M., Cui, W., Woody, S. K., & Staudinger, J. L. (2014) · Drug Metabolism and Disposition · doi:10.1124/dmd.114.062307 · Cited by 57
STAT3 in tissue fibrosis: Is there a role in the lung?
Knight, D. A., Mutsaers, S. E., & Prêle, C. M. (2010) · Pulmonary Pharmacology & Therapeutics · doi:10.1016/j.pupt.2010.10.005 · Cited by 55
Kloesch, B., Liszt, M., Krehan, D., Broell, J., Kiener, H. P., & Steiner, G. E. (2011) · Immunology Letters · doi:10.1016/j.imlet.2011.10.004 · Cited by 55
Pathophysiology of pruritus in primary localized cutaneous amyloidosis
Tey, H. L., Cao, T., Nattkemper, L. A., et al. (2016) · British Journal of Dermatology · doi:10.1111/bjd.14391 · Cited by 55
The Immunophysiology of Male Reproduction
Hedger, M. P. (2014) · Elsevier eBooks · doi:10.1016/b978-0-12-397175-3.00019-3 · Cited by 61
“501 In lymphocytes and hepatocytes, IL6 binds to its specific membrane-bound receptor (IL6R; CD126), which has no intrinsic kinase activity and dimerization with IL6ST leads to activation of the Janus kinase (JAK)/signal transducer and activator of transcription (STAT) and MAP kinase signaling pathways (classic IL6 si…”
BackgroundEGFR-mediated apoptosis via STAT3
Jackson, N. M., & Ceresa, B. P. (2017) · Experimental Cell Research · doi:10.1016/j.yexcr.2017.04.016 · Cited by 55
“Oncostatin M (OSM) belongs to the Interleukin-6 (IL-6) family of cytokines [41].”
Basu, A., Das, A. S., Sharma, M., Pathak, M. P., Chattopadhyay, P., Biswas, K., & Mukhopadhyay, R. (2017) · Biochemistry and Biophysics Reports · doi:10.1016/j.bbrep.2017.08.005 · Cited by 55
“Binding sites of STATs are reported to be in close proximity with the binding sites of some other transcription factors, like the nuclear factor κB (NF-κB), which cooperate with the STATs in their function of co-regulating gene expression [20].”
BackgroundInfluentialSTAT3 induces anti-hepatitis C viral activity in liver cells
Zhu, H., Shang, X., Terada, N., & Liu, C. (2004) · Biochemical and Biophysical Research Communications · doi:10.1016/j.bbrc.2004.09.081 · Cited by 55
Oncostatin M causes VEGF release from human airway smooth muscle: synergy with IL-1β
Faffe, D. S., Flynt, L., Mellema, M. S., Whitehead, T. R., Bourgeois, K., Panettieri, R. A., Silverman, E. S., & Shore, S. A. (2005) · American Journal of Physiology-Lung Cellular and Molecular Physiology · doi:10.1152/ajplung.00333.2004 · Cited by 56
“Members of the IL-6 cytokine family share a common receptor subunit, gp130 (17).”
BackgroundImmunomodulatory properties of the IL‐6 cytokine family in multiple sclerosis
Janssens, K., Slaets, H., & Hellings, N. (2015) · Annals of the New York Academy of Sciences · doi:10.1111/nyas.12821 · Cited by 53
Hepatocellular Carcinoma Biology
Blechacz, B. R. A., & Mishra, L. (2012) · Recent results in cancer research/Recent Results in Cancer Research · doi:10.1007/978-3-642-16037-0_1 · Cited by 54
Szabo‐Fresnais, N., Lefebvre, F., Germain, A., Fischmeister, R., & Pomérance, M. (2010) · Cellular Signalling · doi:10.1016/j.cellsig.2010.03.009 · Cited by 55
Metadata
- Authors
- HEINRICH, P. C., BEHRMANN, I., HAAN, S., HERMANNS, H. M., MÜLLER-NEWEN, G., & SCHAPER, F.
- Affiliations
- Universitätsklinikum Aachen (DE)
- Institut für Biochemie, RWTH Aachen, Universitätsklinikum, Pauwelsstrasse 30, D-52074 Aachen, Germany
- Venue
- Biochemical Journal
- Publisher
- Portland Press Ltd.
- Published
- 2003-08-15
- Volume
- 374
- Issue
- 1
- Pages
- 1-20
- ISSN
- 0264-6021 (ISSN-L)
- 1470-8728
- PMC
- PMC1223585
- OpenAlex
- W2086840459
- Cited by
- 3,272
- References
- 265
- Citations by year
- 2026: 70 · 2025: 114 · 2024: 106 · 2023: 121 · 2022: 138 · 2021: 146 · 2020: 129 · 2019: 151 · 2018: 141 · 2017: 141 · 2016: 176 · 2015: 157 · 2014: 171 · 2013: 190 · 2012: 179
- FWCI
- 50.93
- Type
- journal article
- Language
- en
- Open access
- bronze
- doi.org
- Locations
- Biochemical Journal (publishedVersion)
- PubMed (publishedVersion)
- PubMed Central (submittedVersion)
- Open Repository and Bibliography (University of Luxembourg) (submittedVersion)
- RWTH Publications (RWTH Aachen) (submittedVersion)
- Funders
- Deutsche Forschungsgemeinschaft
- Topics
- Life Sciences › Immunology and Microbiology › Immunology › Cytokine Signaling Pathways and Interactions
- Life Sciences › Biochemistry, Genetics and Molecular Biology › Molecular Biology › Protein Tyrosine Phosphatases
- Life Sciences › Biochemistry, Genetics and Molecular Biology › Cancer Research › NF-κB Signaling Pathways
- Keywords
- cytokine signaling, gp130, LIF receptor, OSM receptor, JAK/STAT signaling, MAPK signaling, protein tyrosine phosphatase, suppressor of cytokine signaling, PIAS, signal termination, signal transduction, acute phase response, inflammation, rheumatoid arthritis, multiple myeloma, prostate cancer
- MeSH terms
- Animals, Humans, Infections, Models, Molecular, Phosphorylation, Protein Conformation, Wounds and Injuries, Signal Transduction, Interleukin-6, Cytokines, Protein Structure, Secondary, Receptors, Interleukin-6
About these checks
Registry, retraction, Cites and statistics results are computed, not judged, with one exception: a printed reference that no index lists is read once by a model before it counts as a citation error. Claims are extracted by a model and kept only when their quote appears verbatim in the text; each cited source is then checked, with a model’s help, for whether it says what the claim relies on. Those verdicts can be wrong — read the claim’s quote and the cited source before relying on one.
A language model drew the claims from the paper on 2026-10-23, under version 3 of the claim definition (model deepseek-v4.1-flash, prompt extract-v3).
A second model labelled each claim on 2026-10-23 (model jev-1.13-20260917, definition revision gold-guideline-v0.2).
Statistics and arithmetic are recomputed, not judged.
Confidence bands are shown only for fields calibrated on our annotated test set. None is calibrated yet, so no band is shown.
What counts as a claim ›How we measure confidence ›How we check this ›
Are you an author, or do you see a problem with this page? Request a review
