The DOI matches its Crossref record; 9 of the 9 references it cites were found in a registry or an index.
Induction and regulatory function of miR-9 in human monocytes and neutrophils exposed to proinflammatory signals
Open accessAbstract
Inflammation involves a coordinated, sequential, and self limiting sequence of events controlled by positive and negative regulatory mechanisms. Recent studies have shown that microRNAs (miRNAs), an evolutionarily conserved class of endogenous 22-nucleotide noncoding RNAs, contribute to the regulation of inflammation by repressing gene expression at the posttranscriptional level. In this study, we characterize the profile of miRNAs induced by LPS in human polymorphonuclear neutrophils (PMN) and monocytes. In particular, we identify miR-9 as the only miRNA (among 365 analyzed) up-regulated in both cell types after TLR4 activation. miR-9 is also induced by TLR2 and TLR7/8 agonists and by the proinflammatory cytokines TNF-alpha and IL-1beta, but not by IFNgamma. Among the 3 different genes encoding miR-9 precursors in humans, we show that LPS selectively induces the transcription of miR-9-1 located in the CROC4 locus, in a MyD88- and NF-kappaB-dependent manner. In PMN and monocytes, LPS regulates NFKB1 at both the transcriptional and posttranscriptional levels, and a conserved miR-9 seed sustained a miR-9-dependent inhibition of the NFKB1 transcript. Overall, these data suggest that TLR4-activated NF-kappaB rapidly increases the expression of miR-9 that operates a feedback control of the NF-kappaB-dependent responses by fine tuning the expression of a key member of the NF-kappaB family.
Overview
The claims and statistics of this paper haven’t been checked yet.
Run the check — free, no account needed. It reads the open-access text and checks the sources it cites.
Integrity signals
Registry
Cites
Statistics
Verification
Claims the paper makes
The claims and statistics of this paper haven’t been checked yet.
Run the check — free, no account needed. It reads the open-access text and checks the sources it cites.
Claims other papers make about this one
Each is checked against this paper’s own text: does it say what the citing paper says it does?
The source backs part of the claim, not all of it — or backs it for a different population, condition or comparison.
In the citing paper
“It was shown that NF-κB, upon its activation in response to LPS, initiates transcription of miR-9-1, which subsequently downregulates NF-κB [112].”
From MicroRNAs as Regulators of Phagocytosis (2022) · cites this paper as [112]
Experimental — accuracy not yet measured
Self-check
Percentages, sums and reported differences re-computed from the paper’s own numbers.
The self-check needs the paper’s full text.
Citations
Cites
Analysis of Relative Gene Expression Data Using Real-Time Quantitative PCR and the 2−ΔΔCT Method
Livak, K. J., & Schmittgen, T. D. (2001) · Methods · doi:10.1006/meth.2001.1262 · Cited by 180,860
The functions of animal microRNAs
Ambros, V. (2004) · Nature · doi:10.1038/nature02871 · Cited by 10,728
Akira, S., & Takeda, K. (2004) · Nature reviews. Immunology · doi:10.1038/nri1391 · Cited by 8,312
Combinatorial microRNA target predictions
Krek, A., Grün, D., Poy, M. N., Wolf, R., Rosenberg, L., Epstein, E. J., MacMenamin, P., da Piedade, I., Gunsalus, K. C., Stoffel, M., et al. (2005) · Nature Genetics · doi:10.1038/ng1536 · Cited by 4,603
Taganov, K. D., Boldin, M. P., Chang, K.-J., & Baltimore, D. (2006) · Proceedings of the National Academy of Sciences · doi:10.1073/pnas.0605298103 · Cited by 4,317
Nuclear factor-κB in cancer development and progression
Karin, M. (2006) · Nature · doi:10.1038/nature04870 · Cited by 3,519
Requirement of bic/microRNA-155 for Normal Immune Function
Rodriguez, A., Vigorito, E., Clare, S., Warren, M. V., Couttet, P., Soond, D. R., van Dongen, S., Grocock, R. J., Das, P. P., Miska, E. A., et al. (2007) · Science · doi:10.1126/science.1139253 · Cited by 1,833
Sempere, L. F., Freemantle, S., Pitha-Rowe, I., Moss, E., Dmitrovsky, E., & Ambros, V. (2004) · Genome Biology · doi:10.1186/gb-2004-5-3-r13 · Cited by 1,578
Negative regulation of Toll-like receptor-mediated immune responses
Liew, F. Y., Xu, D., Brint, E. K., & O'Neill, L. A. J. (2005) · Nature Reviews Immunology · doi:10.1038/nri1630 · Cited by 1,509
Flagged first, then by citations
Research works printed but not linked: 31
- 10.1016/j.cell.2006.02.015 · DOI
- 10.1016/j.coi.2005.11.012 · DOI
- 10.1189/jlb.1003473 · DOI
- 10.1016/S0092-8674(04)00045-5 · DOI
- 10.1016/j.ceb.2008.01.006 · DOI
- 10.4049/jimmunol.180.8.5689 · DOI · Paper page
- 10.1073/pnas.0610731104 · DOI · Paper page
- 10.4049/jimmunol.179.8.5082 · DOI · Paper page
- 10.4049/jimmunol.181.9.6563 · DOI
- 10.1006/mcne.2000.0866 · DOI
- 10.1016/j.molimm.2007.10.035 · DOI
- 10.1371/journal.pbio.0020363 · DOI · Paper page
- 10.1016/S0092-8674(03)01018-3 · DOI · Paper page
- 10.1038/nature05992 · DOI
- 10.1038/nrg1328 · DOI
- 10.1016/j.immuni.2007.02.005 · DOI
- 10.1016/j.cell.2005.09.023 · DOI · Paper page
- 10.1038/ncb1613 · DOI · Paper page
- 10.1016/j.cell.2007.07.021 · DOI
- 10.1084/jem.20050572 · DOI
- 10.1126/science.1141229 · DOI
- 10.1038/nn.2115 · DOI · Paper page
- 10.1074/jbc.M601225200 · DOI · Paper page
- 10.2353/ajpath.2008.080009 · DOI
- 10.4049/jimmunol.178.11.7344 · DOI
- 10.1016/j.biocel.2007.05.004 · DOI
- 10.1074/jbc.M602222200 · DOI
- 10.1146/annurev.immunol.16.1.225 · DOI
- 10.1158/0008-5472.CAN-06-1867 · DOI
- 10.1038/nprot.2007.528 · DOI
- 10.4049/jimmunol.167.4.2312 · DOI
Cited by
Sorted by citations
Items 201–300 of 519
Micromanagement of Immune System: Role of miRNAs in Helminthic Infections
Arora, N., Tripathi, S., Singh, A. K., Mondal, P., Mishra, A., & Prasad, A. (2017) · Frontiers in Microbiology · doi:10.3389/fmicb.2017.00586 · Cited by 60
“…had shown that the activation of TIRs and TNF-α receptor results in rapid expression of a host of miRNAs including let-7, miR-9, miR-99b, let-7e, miR-125a, miR-132, miR146a, miR-146b, miR-155, miR-187, and miR-223 (Taganov et al., 2006; Tili et al., 2007; Bazzoni et al., 2009; Ceppi et al., 2009).”
BackgroundOwczarz, M., Budzińska, M., Domaszewska-Szostek, A., Borkowska, J., Połosak, J., Gewartowska, M., Ślusarczyk, P., & Puzianowska‐Kuźnicka, M. (2017) · Experimental Biology and Medicine · doi:10.1177/1535370217720884 · Cited by 55
“In activated monocytes, NF-kB rapidly increases the expression of miR-9, which in turn reduces the expression of NF-kB, thus closing the negative feedback loop.(67) In contrast to miR-34a, miR-9 induces M1 polarization of macrophages, which is associated with the production of pro-inflammatory cytokines.”
BackgroundChakraborty, S., Zawieja, D. C., Davis, M. J., & Muthuchamy, M. (2015) · American Journal of Physiology-Cell Physiology · doi:10.1152/ajpcell.00122.2015 · Cited by 63
“TNF- is induced by LPS, which also significantly affects lymphatic function (5, 26).”
BackgroundMethodResultInfluentialQian, D., Wei, G., Xu, C., He, Z., Hua, J., Li, J. J., Hu, Q., Lin, S., Gong, J., Meng, H., et al. (2017) · Scientific Reports · doi:10.1038/s41598-017-00629-3 · Cited by 60
Epigenetic silencing of miR-708 enhances NF-κB signaling in chronic lymphocytic leukemia
Baer, C. R., Oakes, C. C., Ruppert, A. S., Claus, R., Kim-Wanner, S.-Z., Mertens, D., Zenz, T., Stilgenbauer, S., Byrd, J. C., & Plass, C. (2015) · International Journal of Cancer · doi:10.1002/ijc.29491 · Cited by 57
“Furthermore, MiR-9 targets the transcription factors NFKB1 and thereby functions in NF-jB transcriptional regulation.(33) As NF-jB signaling enhances cell survival and growth, miR-708 likely provides a tumor-suppressor function in CLL.”
BackgroundMiller, D. L., Davis, J., Taylor, K. H., Johnson, J. J., Shi, Z.-G., Williams, R. D., Atasoy, U., Lewis, J., & Stack, M. (2015) · American Journal of Pathology · doi:10.1016/j.ajpath.2014.11.018 · Cited by 57
“Physiologic miR-9 expression may temper innate immune responses.(47) In cancer, there is limited evidence that miR-9 may be involved in modulating immunoregulatory genes, including major histocompatibility complex class Ie and interferon-regulated genes.”
BackgroundMicroRNA in human cancer and chronic inflammatory diseases
Kanwar, R. K. (2010) · Frontiers in Bioscience-Scholar · doi:10.2741/s121 · Cited by 52
Chu, Q., & Xu, T. (2020) · Reviews in Aquaculture · doi:10.1111/raq.12428 · Cited by 56
Gender and Obesity Specific MicroRNA Expression in Adipose Tissue from Lean and Obese Pigs
Mentzel, C. M. J., Anthon, C., Jacobsen, M., Karlskov-Mortensen, P., Bruun, C. S., Jørgensen, C., Gorodkin, J., Cirera, S., & Fredholm, M. (2015) · PLoS ONE · doi:10.1371/journal.pone.0131650 · Cited by 56
“NFKB1, an inflammation relevant transcription factor, is identified as the potential target gene [61].”
BackgroundMicroRNAs and the immune response to respiratory virus infections
Głobińska, A., Pawelczyk, M., & Kowalski, M. L. (2014) · Expert Review of Clinical Immunology · doi:10.1586/1744666x.2014.913482 · Cited by 56
“Another miRNA, miR-9, is upregulated after TLR4 activation in human neutrophils and monocytes [26,27].”
BackgroundSeddiki, N., Phetsouphanh, C., Swaminathan, S., Xu, Y., Rao, S., Li, J., Sutcliffe, E. L., Denyer, G. S., Finlayson, R. J., Gelgor, L., et al. (2012) · European Journal of Immunology · doi:10.1002/eji.201242695 · Cited by 55
Understanding Alcoholism Through microRNA Signatures in Brains of Human Alcoholics
Núnez, Y. O., & Mayfield, R. D. (2012) · Frontiers in Genetics · doi:10.3389/fgene.2012.00043 · Cited by 64
“…implicated in controlling the activity of the TLR signaling pathway through direct targeting of the NFKB1 gene in human monocytes and neutrophils (Bazzoni et al., 2009; O’Neill et al., 2011), was demonstrated to regulate ethanol sensitivity of BK channels by selectively destabilizing splice…”
BackgroundInvolvement of micro RNA s in epileptogenesis
Cattani, A., Allène, C., Seifert, V., Rosenow, F., Henshall, D. C., & Freiman, T. M. (2016) · Epilepsia · doi:10.1111/epi.13404 · Cited by 54
“miR-9 was demonstrated to be up-regulated in TLE, and has been shown to be proinflammatory by inhibiting the nuclear factor kappa-B1 (NF-jB1) transcript.(37) Similarly, miR-155 has been linked to control inflammatory pathways in studies of immature rats subject to status epilepticus, during the acute period, as well a…”
BackgroundToiyama, Y., Okugawa, Y., Tanaka, K., Araki, T., Uchida, K., Hishida, A., Uchino, M., Ikeuchi, H., Hirota, S., Kusunoki, M., et al. (2017) · Gastroenterology · doi:10.1053/j.gastro.2017.08.037 · Cited by 55
Tsang, D. P., Wu, W. K. K., Kang, W., Lee, Y., Wu, F., Yu, Z., Xiong, L., Chan, A. W. H., TONG, J. H. M., Yang, W., et al. (2016) · The Journal of Pathology · doi:10.1002/path.4688 · Cited by 56
“Indeed, nine H3K27me3-occupied miRNA loci corresponding to five mature miRNAs, ie miR-7 [28], miR-9 [29], miR-124 [28], miR-196 [30], and miR-218 [25], have been reported to directly suppress genes in this pathway in various physiological and pathological conditions.”
BackgroundBandyopadhyay, S., Long, M. E., & Allen, L. H. (2014) · PLoS ONE · doi:10.1371/journal.pone.0109525 · Cited by 60
Stress in Obesity and Associated Metabolic and Cardiovascular Disorders
Holvoet, P. (2012) · Scientifica · doi:10.6064/2012/205027 · Cited by 53
Moret‐Tatay, I., Iborra, M., Cerrillo, E., Tortosa, L., Nos, P., & Beltrán, B. (2015) · Oxidative Medicine and Cellular Longevity · doi:10.1155/2016/2325162 · Cited by 53
“Although the first studies were focused on the general mechanisms of inflammation, late they noticed that there were several miRNAs capable of regulating cytokines involved in the inflammatory response of the CD [78].”
BackgroundNever underestimate the power of a neutrophil.
Cassatella, M., Locati, M., & Mantovani, A. (2009) · Immunity · doi:10.1016/j.immuni.2009.10.003 · Cited by 53
“Human PMNs and monocytes have also recently shown to express a selected microRNA repertoire via a MyD88-dependent pathway (Bazzoni et al., 2009) that might be ultimately involved in regulating the expression of selected cytokines.”
BackgroundSelf-citationXiang, H., Tao, X.-F., Xia, S.-L., Qu, J.-L., Song, H.-Y., Liu, J.-J., & Shang, D. (2017) · Frontiers in Immunology · doi:10.3389/fimmu.2017.01488 · Cited by 52
“Bone marrow-derived mesenchymal stem cells deliver miR-9, which targets the NF-κB1/p50 gene, to the damaged pancreas or peripheral blood mononuclear cells, possibly attenuating severe acute pancreatitis (20).”
BackgroundGazzar, M. E., & McCall, C. E. (2011) · Immunology and Cell Biology · doi:10.1038/icb.2011.74 · Cited by 45
Dilda, F., Gioia, G., Pisani, L. F., Restelli, L., Lecchi, C., Albonico, F., Bronzo, V., Mortarino, M., & Ceciliani, F. (2011) · The Veterinary Journal · doi:10.1016/j.tvjl.2011.08.018 · Cited by 57
Wang, X.-H., Chen, Q., Yi, S., Liu, Q.-Y., Zhang, R., Wang, P., Qian, T.-M., & Li, S.-Y. (2019) · Journal of Biological Chemistry · doi:10.1074/jbc.ra119.007389 · Cited by 51
Muhuri, M., Zhan, W., Maeda, Y., Li, J., Lotun, A., Chen, J., Sylvia, K., Dasgupta, I., Arjomandnejad, M., Nixon, T., et al. (2021) · Frontiers in Immunology · doi:10.3389/fimmu.2021.674242 · Cited by 50
“miR-9-5p MF (TCATACAGCTAGATAACCAAAGA)2 (61, 62)”
Human microRNAs in host–parasite interaction: a review
Paul, S., Ruiz‐Manriquez, L. M., Serrano‐Cano, F. I., Estrada‐Meza, C., Solorio-Diaz, K. A., & Srivastava, A. (2020) · 3 Biotech · doi:10.1007/s13205-020-02498-6 · Cited by 57
Veremeyko, T., Kuznetsova, I. S., Dukhinova, M., W. Y. Yung, A., Kopeikina, E., Barteneva, N. S., & Ponomarev, E. D. (2019) · Journal of Neuroscience Research · doi:10.1002/jnr.24344 · Cited by 52
Ghibaudi, M., Boido, M., & Vercelli, A. (2017) · Progress in Neurobiology · doi:10.1016/j.pneurobio.2017.07.005 · Cited by 51
“On the other hand, Bazzoni et al. (2009) showed that miR-9 (human polymorphonuclear neutrophils and monocytes) acts on NF-kB with a feedback control loop in which NF-kB increases miR-9 that in turn tunes its levels (Bazzoni et al., 2009).”
MicroRNAs at the epicenter of intestinal homeostasis
Belcheva, A. (2017) · BioEssays · doi:10.1002/bies.201600200 · Cited by 56
“Summary of miRNAs, their biological effects and targets related with intestinal inflammation miRNA Effect Target Reference miR-146b NF-kB up-regulation Siah2 [106] miR-126 NF-kB up-regulation IkBa [107] miR-9 Regulates the anti-inflammatory response NFkB1/p105/p50 [108] miR-214 Regulates the activity of NF-kB PTEN, PD…”
Girardi, C., Pittà, C. D., Casara, S., Calura, E., Romualdi, C., Celotti, L., & Mognato, M. (2014) · BioMed Research International · doi:10.1155/2014/296747 · Cited by 53
“Recent evidences show that miR-9 is highly involved in immunity and inflammatory diseases [90–92] by enhancing IFN-γ production in activated human CD4(+) T-cells [91].”
MicroRNA‐99 family in cancer and immunity
Eniafe, J., & Jiang, S. (2020) · Wiley Interdisciplinary Reviews - RNA · doi:10.1002/wrna.1635 · Cited by 51
“Conversely, Bazzoni et al. (2009) identified the miR-99b/let-7e/miR125a cluster to be inducible by LPS stimulation in monocytes.”
BackgroundD’Amore, S., Härdfeldt, J., Cariello, M., Graziano, G., Copetti, M., Tullio, G. D., Piglionica, M., Scialpi, N., Sabbà, C., Palasciano, G., et al. (2018) · Cardiovascular Research · doi:10.1093/cvr/cvy077 · Cited by 55
MicroRNA regulation of nonmuscle myosin light chain kinase expression in human lung endothelium.
Adyshev, D., Moldobaeva, N., Mapes, B. L., Elangovan, V., & Garcia, J. G. N. (2013) · American Journal of Respiratory Cell and Molecular Biology · doi:10.1165/rcmb.2012-0397oc · Cited by 49
Zhao, J., Gong, A., Zhou, R., Liu, J., Eischeid, A. N., & Chen, X.-M. (2012) · Journal of Immunology · doi:10.4049/jimmunol.1101976 · Cited by 49
“Recent studies have demonstrated the targeting of several negative regulators by inflammatory miRNAs, such as miR146 targeting of IL-1R–associated kinase 1 and TNFR-associated factor 6 (26), miR-155 targeting of MyD88 and Fas-associated death domain protein (30), and miR-9 targeting of NFKB1 (31).”
BackgroundZhang, Y., Shen, K., Bai, Y., Lv, X., Huang, R., Zhang, W., Chao, J., Nguyen, L. K., Hua, J., Gan, G., et al. (2016) · Autophagy · doi:10.1080/15548627.2016.1191723 · Cited by 51
Toll-Like Receptor Tolerance as a Mechanism for Neuroprotection
Vartanian, K. B., & Stenzel‐Poore, M. P. (2010) · Translational Stroke Research · doi:10.1007/s12975-010-0033-5 · Cited by 48
“Upregulation of miR-9 targets NFKB1, a precursor to the NF-κB subunit p50, for degradation at the level of mRNA and protein translation [49].”
BackgroundSmall and Long Regulatory RNAs in the Immune System and Immune Diseases
Stachurska, A., Zorro, M. M., van der Sijde, M. R., & Withoff, S. (2014) · Frontiers in Immunology · doi:10.3389/fimmu.2014.00513 · Cited by 48
“It was interesting that out of the 365 miRNAs tested, miR-9 was the only one upregulated in both human macrophages and PMN after LPS activation (69).”
BackgroundMicroRNAs as Novel Regulators of Neuroinflammation
Ksiazek-Winiarek, D. J., Kacperska, M. J., & Glabinski, A. R. (2013) · Mediators of Inflammation · doi:10.1155/2013/172351 · Cited by 51
“This upregulation is mediated by proinflammatory signals conveyed in aMyD88- andNF-κB-dependentmanner [112].”
BackgroundEpigenetics in osteoarthritis and its implication for future therapeutics
Im, G., & Choi, Y.-J. (2013) · Expert Opinion on Biological Therapy · doi:10.1517/14712598.2013.764410 · Cited by 44
“(2013) 13(5) TLR7/8 agonists and by TNF-a and IL-1b [77]. miR-9 overexpression reduces IL-1b-mediated production of TNF-a, and basal and IL-1b-induced MMP-13 protein release, suggesting a possible protective role in OA [60].”
InfluentialMiRNAs at the Crossroads between Innate Immunity and Cancer: Focus on Macrophages
Curtale, G. (2018) · Cells · doi:10.3390/cells7020012 · Cited by 58
“[154] demonstrated the direct targeting of the NF-κB1 transcript by miR-9, with consequent reduction of pro-inflammatory cytokines.”
BackgroundTargeting MicroRNA Function in Acute Pancreatitis
Xiang, H., Tao, X., Xia, S., Qu, J., Song, H., Liu, J., & Shang, D. (2017) · Frontiers in Physiology · doi:10.3389/fphys.2017.00726 · Cited by 45
“MiR-9 is a key paracrine molecular of bone marrow-derived mesenchymal stem cells (BMSCs), and the up-regulation of it could inhibit the inflammatory response induced by lipopolysaccharide (LPS) in human polymorphonuclear neutrophils (PMN) and peripheral blood mononuclear cells (PBMC) (Bazzoni et al., 2009).”
BackgroundmicroRNA-17-5p Modulates Bacille Calmette-Guerin Growth in RAW264.7 Cells by Targeting ULK1
Duan, X., Zhang, T., Ding, S., Wei, J., Su, C., Liu, H., & Xu, G. (2015) · PLoS ONE · doi:10.1371/journal.pone.0138011 · Cited by 52
“An increasing number of studies have recently demonstrated that miRNAs play a regulatory role in immune responses of host cells against a pathogen invasion by targeting an immune-related signaling pathway, including the Toll-like receptor (TLR), mitogen-activated protein kinase (MAPK) and nuclear factor kappa B (NF-κB…”
BackgroundOtsuki, T., Ishikawa, M., HORI, Y., GOTO, G., & Sakamoto, A. (2015) · Biomedical Reports · doi:10.3892/br.2015.428 · Cited by 42
miR-9 Upregulation Integrates Post-ischemic Neuronal Survival and Regeneration In Vitro
Nampoothiri, S. S., & Rajanikant, G. K. (2018) · Cellular and Molecular Neurobiology · doi:10.1007/s10571-018-0642-1 · Cited by 46
Askou, A. L., Alsing, S., Holmgaard, A., Bek, T., & Corydon, T. J. (2017) · Acta Ophthalmologica · doi:10.1111/aos.13407 · Cited by 46
“MiR-9 has also been linked to the innate immune response in a report, where they found induction of miR-9 in human monocytes and neutrophils exposed to pro-inflammatory signals (Bazzoni et al. 2009) and more recently found to be induced in lipopolysaccharide-activated retinal microglia cells (MC), a widely used model…”
BackgroundInfluentialThe not-so-neutral role of microRNAs in neutrophil biology
Gantier, M. P. (2013) · Journal of Leukocyte Biology · doi:10.1189/jlb.1012539 · Cited by 40
Therapeutic modulation of miRNA for the treatment of proinflammatory lung diseases
Hassan, T. M., McKiernan, P. J., McElvaney, N. G., Cryan, S., & Greene, C. M. (2012) · Expert Review of Anti-infective Therapy · doi:10.1586/eri.11.175 · Cited by 38
Mukherjee, S., Chopra, A., Karmakar, S., & Bhat, G. S. (2024) · Critical Reviews in Microbiology · doi:10.1080/1040841x.2024.2339260 · Cited by 54
“…receptors present in gingival tissues in both healthy and chronic periodontitis patients was found to increase the release of neuropeptides (Bazzoni et al. 2009). vallinoid receptor activation in the sensory nerves of the stomach plays an important role in acute ethanol-mediated gastric…”
Hu, Y., Liu, J., Zhu, Y., & Lü, N. (2016) · Helicobacter · doi:10.1111/hel.12292 · Cited by 42
Li, D., Wang, X., Lan, X., Li, Y., Liu, L., Yi, J., Li, J., Sun, Q., Wang, Y., Li, H., et al. (2014) · Molecular and Cellular Endocrinology · doi:10.1016/j.mce.2014.12.007 · Cited by 41
“…of TLRs, such as TLR2 (Benakanakere et al., 2009; Philippe et al., 2012) and TLR4 (Androulidaki et al., 2009; Chen et al., 2007; Yang et al., 2011), and key signal molecules of the TLR pathways, such as MyD88 (Huang et al., 2010; Tang et al., 2010) and NFκB1 (Bazzoni et al., 2009; Qi et al., 2012).”
Anbalagan, D., Yap, G. L. R., Yuan, Y., Pandey, V., Lau, W. H., Arora, S., Bist, P., Wong, J. S. B., Sethi, G., Nissom, P. M., et al. (2014) · PLoS ONE · doi:10.1371/journal.pone.0114507 · Cited by 47
“Other miRs which have been experimentally shown to target NFkB subunits include miR146a and miR9 in inflammatory cells [28, 29].”
Modulation of tolerogenic dendritic cells and autoimmunity
Kim, S. J., & Diamond, B. (2014) · Seminars in Cell and Developmental Biology · doi:10.1016/j.semcdb.2014.04.020 · Cited by 43
Liu, G.-D., Zhang, H., Wang, L., Han, Q., Zhou, S.-F., & Liu, P. (2013) · International Journal of Ophthalmology · doi:10.3980/j.issn.2222-3959.2013.03.05 · Cited by 44
microRNA-mediated regulation of innate immune response in rheumatic diseases
Luo, X., Ranade, K., Talker, R., Jallal, B., Shen, N., & Yao, Y. (2013) · Arthritis Research & Therapy · doi:10.1186/ar4194 · Cited by 39
“miR-9 is induced by LPS in both monocytes and neutrophils and directly targets NFKB1 mRNA, representing another important feedback control of NF-κB-dependent responses [70].”
BackgroundThe role of microRNAs in newborn brain development and hypoxic ischaemic encephalopathy
Ponnusamy, V., & Yip, P. K. (2019) · Neuropharmacology · doi:10.1016/j.neuropharm.2018.11.041 · Cited by 47
miR-511-3p protects against cockroach allergen–induced lung inflammation by antagonizing CCL2
Do, D. C., Mu, J., Xia, K., Sachdeva, K., Qin, Z., Wan, M., Ishmael, F. T., & Gao, P. (2019) · JCI Insight · doi:10.1172/jci.insight.126832 · Cited by 42
“miRs can target genes that orchestrate T helper 2 responses (13, 14), phagocyte activation (10, 15), and shape macrophage polarization and plasticity (16, 17), all of which are important immunological processes in the pathogenesis of diseases (18).”
BackgroundRole of MicroRNAs in the development and function of innate immune cells
Kingsley, S. M. K., & Bhat, B. V. (2017) · International Reviews of Immunology · doi:10.1080/08830185.2017.1284212 · Cited by 43
“and thus may promote NF-κβ signaling and M1 activation [58].”
BackgroundSong, R., Fullerton, D. A., Ao, L., Zhao, K., Reece, T. B., Cleveland, J. C., & Meng, X. (2017) · Journal of the American Heart Association · doi:10.1161/jaha.116.005364 · Cited by 45
“For example, miR-9 expression is upregulated by lipopolysaccharide via the TLR4–MyD88–nuclear factor jB–dependent pathway in human monocytes and neutrophils.(21) Our previous study found that Toll-like receptor 4 or 2 mediates AVIC expression of TGF-b1 or BMP-2 in response to pro-inflammatory stimulation and promotes…”
BackgroundModulation of influenza A virus replication by microRNA‐9 through targeting MCPIP1
Dong, C., Sun, X., Guan, Z., Zhang, M., & Duan, M. (2016) · Journal of Medical Virology · doi:10.1002/jmv.24604 · Cited by 40
“However, several previous studies have shown that NF-kB1 also is a direct target of miR-9, which regulates downstream signals of NF-kB1 [Bazzoni et al., 2009; Lai et al., 2014].”
BackgroundPan, Z.-Y., Guo, Y.-P., Qi, H.-P., Fan, K., Wang, S., Zhao, H., Fan, Y., Xie, J., Guo, F., Hou, Y.-L., et al. (2012) · PLoS ONE · doi:10.1371/journal.pone.0032571 · Cited by 42
Sampath, P., Periyasamy, K. M., Ranganathan, U. D., & Bethunaickan, R. (2021) · Frontiers in Immunology · doi:10.3389/fimmu.2021.667206 · Cited by 46
Multi-Step Regulation of the TLR4 Pathway by the miR-125a~99b~let-7e Cluster
Curtale, G., Renzi, T. A., Mirolo, M., Drufuca, L., Albanese, M., Luca, M. D., Rossato, M., Bazzoni, F., & Locati, M. (2018) · Frontiers in Immunology · doi:10.3389/fimmu.2018.02037 · Cited by 40
“The LPS-dependent induction of the miR-125a∼99b∼let7e cluster occurred with a delayed kinetic as compared to other miRs directly induced by LPS, such as miR-155 (8, 25), suggesting the involvement of secondmediators (Figures 3A–C).”
Self-citationBergman, P., James, T., Kular, L., Ruhrmann, S., Kramarova, T. V., Kvist, A., Šupić, G., Gillett, A., Pivarcsi, A., & Jagodic, M. (2013) · The Journal of Immunology · doi:10.4049/jimmunol.1200728 · Cited by 47
Das, L. M., Torres-Castillo, M., Gill, T., & Levine, A. D. (2012) · Mucosal Immunology · doi:10.1038/mi.2012.60 · Cited by 42
Sinha, M., Mukhopadhyay, S., & Bhattacharyya, N. P. (2012) · NeuroMolecular Medicine · doi:10.1007/s12017-012-8183-0 · Cited by 47
Zernecke, A. (2012) · Thrombosis and Haemostasis · doi:10.1160/th11-08-0603 · Cited by 38
“miR-9 TLR2/4/7/9 activation, TNFα and IL-1β cytokines NFκB1 ↓ NF-κB-responses in monocytes, and neutrophils (64)”
BackgroundNew epigenetic players in stroke pathogenesis: From non-coding RNAs to exosomal non-coding RNAs
Mahjoubin‐Tehran, M., Rezaei, S., Jesmani, A., Birang, N., Morshedi, K., Khanbabaei, H., Khan, H. Z., Piranviseh, A., Nejati, M., Aschner, M., et al. (2021) · Biomedicine & Pharmacotherapy · doi:10.1016/j.biopha.2021.111753 · Cited by 48
Wang, L., Liu, T.-L., Liang, P.-H., Zhang, S., Li, T.-S., Li, Y., Liu, G., Mao, L., & Luo, X. (2020) · Parasites & Vectors · doi:10.1186/s13071-020-04186-z · Cited by 52
MicroRNA Profiling in Human Neutrophils during Bone Marrow Granulopoiesis and In Vivo Exudation
Larsen, M. T., Hother, C. E., Häger, M., Pedersen, C. C., Theilgaard‐Mönch, K., Borregaard, N., & Cowland, J. B. (2013) · PLoS ONE · doi:10.1371/journal.pone.0058454 · Cited by 40
“In addition, miR-132 has been shown to be upregulated in the monocyte/macrophage population from patients suffering from rheumatoid arthritis [48,48,49] and miR-297 has been found to be up-regulated in serum from patients that died from sepsis compared to survivors [49,50].”
BackgroundEigsti, R. L., Zhanbolat, B., Wilson, M. E., & Graff, J. W. (2014) · Journal of Biological Chemistry · doi:10.1074/jbc.m114.599316 · Cited by 36
Illustrating the interplay between the extracellular matrix and micro RNA s
Piccinini, A. M., & Midwood, K. S. (2014) · International Journal of Experimental Pathology · doi:10.1111/iep.12079 · Cited by 41
“Notably, among these miRNAs, miR-9 and miR-146a play a key role in the regulation of inflammation by directly targeting the p50 subunit of NF-kB and IL-1Rassociated kinase 1 (IRAK1) and TNFR-associated factor 6 (TRAF6) respectively (Taganov et al. 2006; Bazzoni et al. 2009).”
BackgroundHausen, H. Z., Bund, T., & de Villiers, E. (2018) · International Journal of Cancer · doi:10.1002/ijc.31882 · Cited by 42
Shafabakhsh, R., Aghadavod, E., Mobini, M., Heidari-Soureshjani, R., & Asemi, Z. (2018) · Journal of Cellular Physiology · doi:10.1002/jcp.27685 · Cited by 38
“Based on the evidence, miRNA‐9 (miR‐9) can influence primary monocytes and neutrophils by toll‐like receptor (TLR) agonists and proinflammatory cytokines (Bazzoni et al., 2009), moreover, miR‐9 is expressed in all cell lines of humans from three genomic loci, miR‐9‐1, miR‐9‐2, and miR‐9‐3 (36).”
BackgroundCorridoni, D., Chapman, T., Ambrose, T., & Simmons, A. (2018) · Frontiers in Medicine · doi:10.3389/fmed.2018.00032 · Cited by 45
MicroRNAs Implicated in the Immunopathogenesis of Lupus Nephritis
Chafin, C. B., & Reilly, C. M. (2013) · Clinical and Developmental Immunology · doi:10.1155/2013/430239 · Cited by 36
“LPS has been shown to induce the expression of several miRNAs including miR-9, miR-132, miR-146, miR-155, and miR-let-7a (let-7a) [30–33].”
Epigenetics and Childhood Asthma: Current Evidence and Future Research Directions
Salam, M. T., Zhang, Y., & Begum, K. (2012) · Epigenomics · doi:10.2217/epi.12.32 · Cited by 47
Molecular dynamics of inflammation resolution: therapeutic implications
Soliman, A. M., Soliman, M. M., Shah, S. S. H., Baig, H. A., Gouda, N. S., Alenezi, B. T., Alenezy, A. K., Hegazy, A. M. S., Jan, M., & Abdalla, E. H. E. (2025) · Frontiers in Cell and Developmental Biology · doi:10.3389/fcell.2025.1600149 · Cited by 39
Wang, B., Si-wei, Z., Tong, F., Wang, Y., & Wei, L. (2022) · Cancer Science · doi:10.1111/cas.15281 · Cited by 41
Epigenetics and Systemic Lupus Erythematosus: Unmet Needs
Meroni, P. L., & Penatti, A. E. (2015) · Clinical Reviews in Allergy & Immunology · doi:10.1007/s12016-015-8497-4 · Cited by 39
“[75], it is possible to speculate that an infectious stimulus may affect TF expression in monocytes through changes in their miRNA profiles.”
BackgroundInnate and adaptive immune response in stroke: Focus on epigenetic regulation
Picascia, A., Grimaldi, V., Iannone, C., Soricelli, A., & Claudio Napoli, A. (2015) · Journal of Neuroimmunology · doi:10.1016/j.jneuroim.2015.10.013 · Cited by 40
MicroRNA regulated macrophage activation in obesity
Li, C., Qu, L., Farragher, C., Vella, A. T., & Zhou, B. (2019) · Journal of Translational Internal Medicine · doi:10.2478/jtim-2019-0011 · Cited by 38
“For example, different studies have shown that microRNA-146, microRNA-125b, microRNA-155 and microRNA-9 are induced by LPS and subsequently inhibiting TLR4/IL-1R signaling pathway by posttranscriptional regulation of the pathway components’ levels [68-71].”
BackgroundMicroRNA-let-7a promotes E2F-mediated cell proliferation and NFκB activation in vitro
Chafin, C. B., Regna, N. L., Caudell, D., & Reilly, C. (2013) · Cellular & Molecular Immunology · doi:10.1038/cmi.2013.51 · Cited by 36
“27 28–33 MiRNAs can contribute to the proinflammatory environment by inducing the expression of proinflammatory cytokines, perpetuating the magnitude and duration of the immune response.”
Hersi, H., Raulf, N., Gaken, J., Folarin, N. I., & Tavassoli, M. (2018) · Molecular Oncology · doi:10.1002/1878-0261.12352 · Cited by 35
“Several target genes of miR-9 have been identified including E-cadherin (Ma et al., 2010), NFjB1 (Bazzoni et al., 2009) and CXCR4 (He et al., 2017).”
BackgroundEpigenetic Silencing of miR-9 Promotes Migration and Invasion by EZH2 in Glioblastoma Cells
Chien, Y., Chen, J., Chen, Y.-H., Chou, R., Lee, H.-C., & Yu, Y. (2020) · Cancers · doi:10.3390/cancers12071781 · Cited by 23
Khalafalla, F. G., & Khan, M. W. (2017) · Cancer Growth and Metastasis · doi:10.1177/1179064417709287 · Cited by 37
MicroRNA-1908-5p contributes to the oncogenic function of the splicing factor SRSF3
Kim, H. R., Shin, C.-H., Lee, H., Choi, K. H., Nam, D., Ohn, T., & Kim, H.-H. (2016) · OncoTarget · doi:10.18632/oncotarget.14184 · Cited by 34
“Abnormal activation of NF-κB is closely implicated in biogenesis of cancer-associated miRNAs such as miR-146a [31, 32], miR-125b [32], miR-155 [33], miR-21 [34], miR-301a [35], miR-9 [36], miR-199a [37], and miR-15/16 cluster [38].”
Chouvardas, P., Kollias, G. A., & Nikolaou, C. (2016) · BMC Bioinformatics · doi:10.1186/s12859-016-1040-7 · Cited by 26
“Both of these miR species have been shown to be implicated in the mediation of inflammatory signaling although their role appears to be contradictory [43, 44].”
BackgroundSIV replication is directly downregulated by four antiviral miRNAs
Sisk, J. M., Witwer, K. W., Tarwater, P. M., & Clements, J. E. (2013) · Retrovirology · doi:10.1186/1742-4690-10-95 · Cited by 30
“The promoters of miRs-29a, -29, -9 and -146a all contain one or more binding sites for NF-κB [58,70,71], a transcription factor induced by innate immune signaling.”
InfluentialHuman and herpesvirus microRNAs in periodontal disease
Naqvi, A. R., & Slots, J. (2021) · Periodontology 2000 · doi:10.1111/prd.12404 · Cited by 35
Macrophages: Biology and Role in the Pathology of Diseases
Biswas, S., & Mantovani, A. (2014) · Springer: New York · doi:10.1007/978-1-4939-1311-4 · Cited by 33
Self-citationNovotny, G. W., Lundh, M., Backe, M. B., Christensen, D. P., Hansen, J. B., Dahllöf, M. S., Pallesen, E. M. H., & Mandrup-Poulsen, T. R. (2012) · Archives of Biochemistry and Biophysics · doi:10.1016/j.abb.2012.09.014 · Cited by 37
Jianwen, S., Liu, P., Yang, Z., Li, L., Su, H., Lü, N., & Peng, Z. (2012) · Cellular Physiology and Biochemistry · doi:10.1159/000338488 · Cited by 31
Zhang, Y., Liao, Y., Wang, D., He, Y., Cao, D., Zhang, F., & Dou, K. (2011) · Journal of Cellular Biochemistry · doi:10.1002/jcb.23168 · Cited by 33
“Recently, miR-9 has been found take part in the activation of innate immune response though regulating the pro-inflammatory transcription factor nuclear factor NF-kB [Bazzoni et al., 2009; Tsitsiou and Lindsay, 2009].”
BackgroundInfluentialMicroRNAs in shaping the resolution phase of inflammation
Naqvi, R. A., Gupta, M., George, A., & Naqvi, A. R. (2021) · Seminars in Cell and Developmental Biology · doi:10.1016/j.semcdb.2021.03.019 · Cited by 35
Nie, X., Zhao, J., Ling, H., Deng, Y., Li, X., & He, Y. (2020) · British Journal of Pharmacology · doi:10.1111/bph.15139 · Cited by 33
“This indicates that the gene is a key transcription regulator of the inflammatory response (Bazzoni et al., 2009).”
BackgroundMicroRNAs in normal and malignant myelopoiesis
Pelosi, E., Labbaye, C., & Testa, U. (2009) · Leukemia Research · doi:10.1016/j.leukres.2009.04.039 · Cited by 30
Site-1 protease controls osteoclastogenesis by mediating LC3 transcription
Zheng, Z., Zhang, X., Huang, B. H., Liu, J., Wei, X., Shan, Z., Wu, H., Feng, Z., Chen, Y., Fan, S., et al. (2021) · Cell Death and Differentiation · doi:10.1038/s41418-020-00731-6 · Cited by 35
Khedr, L. H., Rahmo, R. M., Farag, D. B., Schaalan, M., & Magdoub, H. M. E. (2020) · Food and Chemical Toxicology · doi:10.1016/j.fct.2020.111307 · Cited by 31
The role of host miRNAs on Mycobacterium tuberculosis
Behrouzi, A., Alimohammadi, M., Nafari, A. H., Yousefi, M. H., Riazi‐Rad, F., Vaziri, F., & Siadat, S. D. (2019) · ExRNA · doi:10.1186/s41544-019-0040-y · Cited by 35
“MiRNAs are the main regulator of cell differentiation and cell functions, as well as modulators in most cellular functions, including innate and acquired immune systems [27, 28].”
BackgroundEffect of high fat diet on NF‐кB microRNA146a negative feedback loop in ovalbumin‐sensitized rats
Akhavanakbari, G., Babapour, B., Alipour, M., Keyhanmanesh, R., Ahmadi, M., & Aslani, M. R. (2018) · Biofactors · doi:10.1002/biof.1466 · Cited by 31
Micro RNA expression profiling of human blood monocyte subsets highlights functional differences
Dang, T., Wong, W., Ong, S., Li, P., Lum, J., Chen, J., Poidinger, M., Zolezzi, F., & Wong, S. C. (2015) · Immunology · doi:10.1111/imm.12456 · Cited by 31
Metadata
- Authors
- Bazzoni, F., Rossato, M., Fabbri, M., Gaudiosi, D., Mirolo, M., Mori, L., Tamassia, N., Mantovani, A., Cassatella, M. A., & Locati, M.
- Affiliations
- University of Verona (IT)
- Humanitas University (IT)
- ORCID
- Venue
- Proceedings of the National Academy of Sciences
- Publisher
- National Academy of Sciences
- Published
- 2009-03-31
- Volume
- 106
- Issue
- 13
- Pages
- 5282-5287
- ISSN
- 0027-8424 (ISSN-L)
- 1091-6490
- PMC
- PMC2664036
- OpenAlex
- W2020932061
- Cited by
- 548
- References
- 40
- Citations by year
- 2026: 7 · 2025: 6 · 2024: 17 · 2023: 14 · 2022: 18 · 2021: 25 · 2020: 33 · 2019: 33 · 2018: 38 · 2017: 38 · 2016: 35 · 2015: 36 · 2014: 46 · 2013: 65 · 2012: 50
- FWCI
- 19.41
- Type
- journal article
- Language
- en
- Open access
- green
- www.ncbi.nlm.nih.gov
- Locations
- Proceedings of the National Academy of Sciences (publishedVersion)
- PubMed Central (publishedVersion)
- PubMed (publishedVersion)
- Funders
- Fondazione Cariplo
- Associazione Italiana per la Ricerca sul Cancro
- Fondazione Cassa di Risparmio di Verona Vicenza Belluno e Ancona
- Università degli Studi di Verona
- Alleanza Contro il Cancro
- Topics
- Life Sciences › Immunology and Microbiology › Immunology › Immune Response and Inflammation
- Life Sciences › Biochemistry, Genetics and Molecular Biology › Cancer Research › MicroRNA in disease regulation
- Life Sciences › Biochemistry, Genetics and Molecular Biology › Cancer Research › NF-κB Signaling Pathways
- Keywords
- miR-9, microRNA, monocytes, neutrophils, lipopolysaccharide, TLR4, TLR2, TLR7/8, NF-κB, NFKB1, MyD88, post-transcriptional regulation, inflammation, TNF-α, IL-1β, feedback regulation
- MeSH terms
- Humans, Inflammation, Lipopolysaccharides, Monocytes, Neutrophils, Transcriptional Activation, Cytokines, NF-kappa B, Inflammation Mediators, Gene Expression Profiling, MicroRNAs, Toll-Like Receptors, Toll-Like Receptor 4
About these checks
Registry, retraction, Cites and statistics results are computed, not judged, with one exception: a printed reference that no index lists is read once by a model before it counts as a citation error. Claims are extracted by a model and kept only when their quote appears verbatim in the text; each cited source is then checked, with a model’s help, for whether it says what the claim relies on. Those verdicts can be wrong — read the claim’s quote and the cited source before relying on one.
Statistics and arithmetic are recomputed, not judged.
Confidence bands are shown only for fields calibrated on our annotated test set. None is calibrated yet, so no band is shown.
What counts as a claim ›How we measure confidence ›How we check this ›
Are you an author, or do you see a problem with this page? Request a review
