The DOI matches its Crossref record; 24 of the 24 references it cites were found in a registry or an index.
Identification of a novel lineage bat SARS-related coronaviruses that use bat ACE2 receptor
Open accessPublished version of a preprint
Abstract
Severe respiratory disease coronavirus-2 (SARS-CoV-2) has been the most devastating disease COVID-19 in the century. One of the unsolved scientific questions of SARS-CoV-2 is the animal origin of this virus. Bats and pangolins are recognized as the most probable reservoir hosts that harbour highly similar SARS-CoV-2 related viruses (SARSr-CoV-2). This study identified a novel lineage of SARSr-CoVs, including RaTG15 and seven other viruses, from bats at the same location where we found RaTG13 in 2015. Although RaTG15 and the related viruses share 97.2% amino acid sequence identities with SARS-CoV-2 in the conserved ORF1b region, it only shows less than 77.6% nucleotide identity to all known SARSr-CoVs at the genome level, thus forming a distinct lineage in the Sarbecovirus phylogenetic tree. We found that the RaTG15 receptor-binding domain (RBD) can bind to ACE2 from Rhinolophus affinis, Malayan pangolin, and use it as an entry receptor, except for ACE2 from humans. However, it contains a short deletion and has different key residues responsible for ACE2 binding. In addition, we showed that none of the known viruses in bat SARSr-CoV-2 lineage discovered uses human ACE2 as efficiently as the pangolin-derived SARSr-CoV-2 or some viruses in the SARSr-CoV-1 lineage. Therefore, further systematic and longitudinal studies in bats are needed to prevent future spillover events caused by SARSr-CoVs or to understand the origin of SARS-CoV-2 better.
Overview
The claims and statistics of this paper haven’t been checked yet.
Run the check — free, no account needed. It reads the open-access text and checks the sources it cites.
Integrity signals
Registry
Cites
Statistics
Verification
Claims the paper makes
The claims and statistics of this paper haven’t been checked yet.
Run the check — free, no account needed. It reads the open-access text and checks the sources it cites.
Claims other papers make about this one
Each is checked against this paper’s own text: does it say what the citing paper says it does?
Bats known to harbour these viruses are present across east Asia, including central China.
“Bats known to harbour these viruses are present across east Asia, including in central China.60”
From The Lancet Commission on lessons for the future from the COVID-19 pandemic (2022) · cites this paper as [60]
Self-check
Percentages, sums and reported differences re-computed from the paper’s own numbers.
The self-check needs the paper’s full text.
Citations
Cites
A pneumonia outbreak associated with a new coronavirus of probable bat origin
Zhou, P., Yang, X.-L., Wang, X.-G., Hu, B., Zhang, L., Zhang, W., Si, H.-R., Zhu, Y., Li, B., Huang, C.-L., et al. (2020) · Nature · doi:10.1038/s41586-020-2012-7 · Cited by 21,969
Self-citationOrigin and evolution of pathogenic coronaviruses
Cui, J., Li, F., & Shi, Z. (2018) · Nature Reviews Microbiology · doi:10.1038/s41579-018-0118-9 · Cited by 5,729 · cited 11×
“Expression Constructs, Protein Expression, and Purification Codon-optimized RBD genes from the following viruses were used (see above genome accession number): SARS-CoV-2 (spike aa 330-583), SARS-CoV-1 (spike aa 317-569), RaTG13 (spike aa 330-583), pangolin-CoV-GD (spike aa326-579), pangolin-CoV-GD (spike aa 330-583),…”
BackgroundInfluentialSelf-citationCharacteristics of SARS-CoV-2 and COVID-19
Hu, B., Guo, H., Zhou, P., & Shi, Z.-L. (2021) · Nature Reviews Microbiology · doi:10.1038/s41579-020-00459-7 · Cited by 5,291
Self-citationIdentification of a novel coronavirus in patients with severe acute respiratory syndrome
Drosten, C., Günther, S., Preiser, W., van der Werf, S., Brodt, H.-R., Becker, S., Rabenau, H., Panning, M., Kolesnikova, L., Fouchier, R. A. M., et al. (2003) · New England Journal of Medicine · doi:10.1056/nejmoa030747 · Cited by 4,574 · cited 1×
“should be conducted to prevent future outbreaks, as viruses from the other two lineages of SARSr-CoV caused SARS and COVID-19, respectively [1,21].”
BackgroundStructural basis of receptor recognition by SARS-CoV-2
Shang, J., Ye, G., Shi, K., Wan, Y., Luo, C., Aihara, H., Geng, Q., Auerbach, A., & Li, F. (2020) · Nature · doi:10.1038/s41586-020-2179-y · Cited by 3,661
Starr, T. N., Greaney, A. J., Hilton, S. K., Ellis, D., Crawford, K. H. D., Dingens, A. S., Navarro, M. J., Bowen, J. E., Tortorici, M. A., Walls, A. C., et al. (2020) · Cell · doi:10.1016/j.cell.2020.08.012 · Cited by 1,956
Identifying SARS-CoV-2-related coronaviruses in Malayan pangolins
Lam, T. T., Jia, N., Zhang, Y.-W., Shum, M. H.-H., Jiang, J.-F., Zhu, H., Tong, Y., Shi, Y., Ni, X.-B., Liao, Y., et al. (2020) · Nature · doi:10.1038/s41586-020-2169-0 · Cited by 1,877
The Impact of Mutations in SARS-CoV-2 Spike on Viral Infectivity and Antigenicity
Li, Q., Wu, J., Nie, J., Zhang, L., Hao, H., Liu, S., Zhao, C., Zhang, Q., Liu, H., Nie, L., et al. (2020) · Cell · doi:10.1016/j.cell.2020.07.012 · Cited by 1,420 · cited 1×
“Primers using for transcription in vitro were: VSV (P protein)-F1: 186 GTTCGTGAGTATCTCAAGTCCT, VSV (P protein)-R2-T7: 187 TAATACGACTCACTATAGGGAGAGCCTTGATTGTCTTCAATTTCTGG, 188 primers using for real-time PCR were described as previously [17].”
MethodHu, B., Zeng, L., Yang, X., Ge, X.-Y., Zhang, W., Li, B., Xie, J., Shen, X.-R., Zhang, Y.-Z., Wang, N., et al. (2017) · PLoS Pathogens · doi:10.1371/journal.ppat.1006698 · Cited by 956 · cited 11×
“Expression Constructs, Protein Expression, and Purification Codon-optimized RBD genes from the following viruses were used (see above genome accession number): SARS-CoV-2 (spike aa 330-583), SARS-CoV-1 (spike aa 317-569), RaTG13 (spike aa 330-583), pangolin-CoV-GD (spike aa326-579), pangolin-CoV-GD (spike aa 330-583),…”
BackgroundInfluentialSelf-citationA SARS-like cluster of circulating bat coronaviruses shows potential for human emergence
Menachery, V. D., Yount, B. L., Debbink, K. M., Agnihothram, S., Gralinski, L. E., Plante, J. A., Graham, R. L., Scobey, T., Ge, X., Donaldson, E., et al. (2015) · Nature Medicine · doi:10.1038/nm.3985 · Cited by 901
Self-citationIsolation of SARS-CoV-2-related coronavirus from Malayan pangolins
Xiao, K., Zhai, J., Feng, Y., Zhou, N., Zhang, X., Zou, J.-J., Li, N., Guo, Y., Li, X., Shen, X., et al. (2020) · Nature · doi:10.1038/s41586-020-2313-x · Cited by 728
Zhou, H., Chen, X., Hu, T., Li, J., Song, H., Liu, Y., Wang, P., Liu, D., Yang, J., Holmes, E. C., et al. (2020) · Current Biology · doi:10.1016/j.cub.2020.05.023 · Cited by 589
SARS-like WIV1-CoV poised for human emergence
Menachery, V. D., Yount, B. L., Sims, A. C., Debbink, K., Agnihothram, S. S., Gralinski, L. E., Graham, R. L., Scobey, T., Plante, J. A., Royal, S. R., et al. (2016) · Proceedings of the National Academy of Sciences · doi:10.1073/pnas.1517719113 · Cited by 418 · cited 1×
“Moreover, the ACE2 usage viruses in bat SARSr-CoV-1 lineage appear to be more dangerous in cross-species transmission, as demonstrated in animal studies [23,24].”
BackgroundEvidence for SARS-CoV-2 related coronaviruses circulating in bats and pangolins in Southeast Asia
Wacharapluesadee, S., Tan, C. W., Maneeorn, P., Duengkae, P., Zhu, F., Joyjinda, Y., Kaewpom, T., Chia, W. N., Ampoot, W., Lim, B. L., et al. (2021) · Nature Communications · doi:10.1038/s41467-021-21240-1 · Cited by 405 · cited 11×
“Consistent with the RBD-ACE2 protein binding assays, HuACE2 mediated entry of all SARSr-CoVs except the RaTG15, whereas the R.affmis ACE2 supported all SARSr-CoVs entry.”
BackgroundInfluentialGenomic characterization and infectivity of a novel SARS-like coronavirus in Chinese bats
Hu, D., Zhu, C.-Q., Ai, L.-L., He, T., Wang, Y., Ye, F., Yang, L., Ding, C., Zhu, X.-H., Lv, R., et al. (2018) · Emerging Microbes and Infections · doi:10.1038/s41426-018-0155-5 · Cited by 281
Yang, X., Hu, B., Wang, B., Wang, M., Zhang, Q., Zhang, W., Wu, L., Ge, X., Zhang, Y., Daszak, P., et al. (2015) · Journal of Virology · doi:10.1128/jvi.02582-15 · Cited by 250 · cited 2×
“human ACE2, which suggests that without further adaptation, there is a limited zoonotic potential for these bat-derived SARSr-CoV-2 to spill and infect humans directly [22].”
BackgroundResultSelf-citationA novel SARS-CoV-2 related coronavirus in bats from Cambodia
Delaune, D., Hul, V., Karlsson, E. A., Hassanin, A., Ou, T. P., Baidaliuk, A., Gámbaro, F., Prot, M., Tú, V. T., Chea, S., et al. (2021) · Nature Communications · doi:10.1038/s41467-021-26809-4 · Cited by 227
Ren, W., Qu, X., Li, W., Han, Z., Yu, M., Zhou, P., Zhang, S., Wang, L., Deng, H., & Shi, Z. (2007) · Journal of Virology · doi:10.1128/jvi.01085-07 · Cited by 162 · cited 1×
“11 RmYN02 and RacCS203, the RaTG15 RBD does not contain the deletion 243 corresponding to aa 473-486 (deletion 2) of the SARS-CoV-2 spike which determines 244 ACE2 usage based on previous reports [18].”
MethodSelf-citationDetection and Characterization of Bat Sarbecovirus Phylogenetically Related to SARS-CoV-2, Japan
Murakami, S., Kitamura, T., Suzuki, J., Sato, R., Aoi, T., Fujii, M., Matsugo, H., Kamiki, H., Ishida, H., Takenaka‐Uema, A., et al. (2020) · Emerging infectious diseases · doi:10.3201/eid2612.203386 · Cited by 144 · cited 11×
“Consistent with the RBD-ACE2 protein binding assays, HuACE2 mediated entry of all SARSr-CoVs except the RaTG15, whereas the R.affmis ACE2 supported all SARSr-CoVs entry.”
BackgroundInfluentialOptimized Pseudotyping Conditions for the SARS-COV-2 Spike Glycoprotein
Johnson, M. C., Lyddon, T. D., Suarez, R., Salcedo, B., LePique, M., Graham, M., Ricana, C. L., Robinson, C. A., & Ritter, D. G. (2020) · Journal of Virology · doi:10.1128/jvi.01062-20 · Cited by 143 · cited 1×
“270 271 To exclude the possibility that the ACE2 binding of RBD may not represent the 272 functionality of the full-length S protein, we also constructed a VSV-based 273 pseudovirus using previously published method [16].”
MethodZhou, P., & Shi, Z. (2021) · Science · doi:10.1126/science.abf6097 · Cited by 116 · cited 1×
“transmitted from an animal reservoir host to human society through an or multiple 55 intermediate hosts [2].”
BackgroundSelf-citationGuo, H., Hu, B., Yang, X., Zeng, L., Li, B., Ouyang, S., & Shi, Z. (2020) · Journal of Virology · doi:10.1128/jvi.00902-20 · Cited by 109 · cited 2×
“with an N-terminal signal peptide and an S-tag as described previously [15].”
MethodSelf-citationWrobel, A. G., Benton, D. J., Xu, P., Calder, L. J., Borg, A., Roustan, C., Martin, S. R., Rosenthal, P. B., Skehel, J. J., & Gamblin, S. J. (2021) · Nature Communications · doi:10.1038/s41467-021-21006-9 · Cited by 85
A novel SARS-CoV-2 related coronavirus in bats from CambodiaPreprint
Hul, V., Delaune, D., Karlsson, E. A., Hassanin, A., Ou, T. P., Baidaliuk, A., Gámbaro, F., Tú, V. T., Keatts, L., Mazet, J. A. K., et al. (2021) · bioRxiv (Cold Spring Harbor Laboratory) · doi:10.1101/2021.01.26.428212 · Cited by 73
Flagged first, then by citations
Cited by
Sorted by citations
Markov, P. V., Ghafari, M., Beer, M., Lythgoe, K., Simmonds, P., Stilianakis, N. I., & Katzourakis, A. (2023) · Nature Reviews Microbiology · doi:10.1038/s41579-023-00878-2 · Cited by 1,179
The Lancet Commission on lessons for the future from the COVID-19 pandemic
Sachs, J. D., Karim, S. S. A., Aknin, L., Allen, J., Brosbøl, K., Colombo, F., Barron, G. C., Espinosa, M. F., Gaspar, V., Gaviria, A., et al. (2022) · The Lancet · doi:10.1016/s0140-6736(22)01585-9 · Cited by 842
ACE2 binding is an ancestral and evolvable trait of sarbecoviruses
Starr, T. N., Zepeda, S. K., Walls, A. C., Greaney, A. J., Alkhovsky, S. V., Veesler, D., & Bloom, J. D. (2022) · Nature · doi:10.1038/s41586-022-04464-z · Cited by 207
The COVID lab-leak hypothesis: what scientists do and don’t know
Maxmen, A., & Mallapaty, S. (2021) · Nature · doi:10.1038/d41586-021-01529-3 · Cited by 132
Chen, J., Yang, X., Si, H.-R., Gong, Q.-C., Que, T., Li, J., Li, Y., Wu, C., Zhang, W., Chen, Y., et al. (2023) · Cell · doi:10.1016/j.cell.2023.01.019 · Cited by 102
Self-citationBat-infecting merbecovirus HKU5-CoV lineage 2 can use human ACE2 as a cell entry receptor
Chen, J., Zhang, W., Li, Y., Liu, C., Dong, T., Chen, H., Wu, C., Su, J., Li, B., Zhang, W., et al. (2025) · Cell · doi:10.1016/j.cell.2025.01.042 · Cited by 104
Self-citationHuman coronaviruses: Origin, host and receptor
Tang, G., Liu, Z., & Chen, D. (2022) · Journal of Clinical Virology · doi:10.1016/j.jcv.2022.105246 · Cited by 98
An ACE2-dependent Sarbecovirus in Russian bats is resistant to SARS-CoV-2 vaccines
Seifert, S. N., Bai, S., Fawcett, S., Norton, E. B., Zwezdaryk, K. J., Robinson, J. E., Gunn, B. M., & Letko, M. C. (2022) · PLoS Pathogens · doi:10.1371/journal.ppat.1010828 · Cited by 62
Wú, Z., Han, Y., Wang, Y., Liu, B., Zhao, L., Zhang, J., Su, H., Zhao, W., Liu, L., Bai, S., et al. (2022) · National Science Review · doi:10.1093/nsr/nwac213 · Cited by 64
Self-citationFrank, H. K., Enard, D., & Boyd, S. D. (2022) · Proceedings of the Royal Society B Biological Sciences · doi:10.1098/rspb.2022.0193 · Cited by 51
“…R. sinicus (electronic supplementary material, figure S2), and numerous SARS-related CoVs that use ACE2 have been isolated from this group [22,37], suggesting further investigations into the implications within species ACE2 variation in this group r o y a l s o c i e t y pub l i s h i ng . o…”
Molecular insights into the adaptive evolution of SARS-CoV-2 spike protein
Yao, Z., Zhang, L., Duan, Y., Tang, X., & Lü, J. (2024) · Journal of Infection · doi:10.1016/j.jinf.2024.106121 · Cited by 48
Lessons Learnt From the COVID-19 Pandemic
Stenseth, N. C., Dharmarajan, G., Li, R., Shi, Z., Yang, R., & Gao, G. F. (2021) · Frontiers in Public Health · doi:10.3389/fpubh.2021.694705 · Cited by 51
Self-citationExpanded ACE2 dependencies of diverse SARS-like coronavirus receptor binding domains
Roelle, S. M., Shukla, N., Pham, A. T., Bruchez, A. M., & Matreyek, K. A. (2022) · PLoS Biology · doi:10.1371/journal.pbio.3001738 · Cited by 40
ACE2-Independent Bat Sarbecovirus Entry and Replication in Human and Bat Cells
Guo, H., Li, A., Dong, T.-Y., Su, J., Yao, Y., Zhu, Y., Shi, Z., & Letko, M. C. (2022) · mBio · doi:10.1128/mbio.02566-22 · Cited by 36
Self-citationPeng, M., 中国科学院昆明动物研究所遗传资源与进化国家重点实验室, 云., Li, J., Cai, Z., Liu, H., Tang, X., Ying, R., Zhang, J., Tao, J.-J., Yin, T., et al. (2021) · 动物学研究 · doi:10.24272/j.issn.2095-8137.2021.334 · Cited by 32
“It should be noted that both pangolin-CoV-GXC and pangolin-CoV-GDC had entry efficiencies into cells expressing the human ACE2 receptor comparable to those of SARS-CoV-2 pseudoviruses (Dicken et al., 2021; Guo et al., 2021; Nie et al., 2021; Niu et al., 2021; Zhang et al., 2021).”
Self-citationSosnowski, P., Tidu, A., Eriani, G., Westhof, É., & Martin, F. (2022) · RNA · doi:10.1261/rna.078972.121 · Cited by 32
Sarbecovirus RBD indels and specific residues dictating multi-species ACE2 adaptiveness
Si, J.-Y., Chen, Y.-M., Sun, Y.-H., Gu, M.-X., Huang, M.-L., Shi, L.-L., Yu, X., Yang, X., Xiong, Q., Ma, C.-B., et al. (2024) · Nature Communications · doi:10.1038/s41467-024-53029-3 · Cited by 25
“Nevertheless, ACE2 usage has been demonstrated in most representative sarbecoviruses other than clade 2 sarbecoviruses 3,6,7,16,22,26 .”
Self-citationAdvances in SARS-CoV-2 receptor-binding domain-based COVID-19 vaccines
Guan, X., Yang, Y., & Du, L. (2023) · Expert Review of Vaccines · doi:10.1080/14760584.2023.2211153 · Cited by 29
“…other coronaviruses, such as SARS-related coronaviruses that use the same ACE2 receptor as SARS-CoV-2 and SARS-CoV, or MERS-CoV or MERS-related coronaviruses that use a different receptor such as DPP4 [1,22,149–152], means that universal vaccines need to be developed to prevent future pandemics.”
BackgroundLiu, M., Lin, H., Li, J., Chen, Y., Luo, Y., Zhang, W., Hu, B., Tian, F., Hu, Y., Liu, Y., et al. (2023) · Journal of Virology · doi:10.1128/jvi.01719-22 · Cited by 24
Self-citationSARS-CoV-2's origin should be investigated worldwide for pandemic prevention
Wu, Z., Jin, Q., Wu, G., Lu, J., Li, M., Guo, D., Lan, K., Feng, L., Qian, Z., Ren, L., et al. (2021) · The Lancet · doi:10.1016/s0140-6736(21)02020-1 · Cited by 23
First Description of Serological Evidence for SARS-CoV-2 in Lactating Cows
Fiorito, F., Iovane, V., Pagnini, U., Cerracchio, C., Brandi, S., Levante, M., Marati, L., Ferrara, G., Tammaro, V., Carlo, E. D., et al. (2022) · Animals · doi:10.3390/ani12111459 · Cited by 21
Isolation of ACE2-dependent and -independent sarbecoviruses from Chinese horseshoe bats
Guo, H., Li, A., Dong, T.-Y., Si, H.-R., Hu, B., Li, B., Zhu, Y., Shi, Z., & Letko, M. C. (2023) · Journal of Virology · doi:10.1128/jvi.00395-23 · Cited by 21
“4 RBDs contain single deletion, but are capable of binding ACE2 more specifically from their host 88 species (4-12).”
BackgroundMethodResultSelf-citationHu, Y., Liu, K., Han, P., Xu, Z., Zheng, A., Pan, X., Jia, Y., Su, C., Tang, L., Wu, L., et al. (2022) · The EMBO Journal · doi:10.15252/embj.2022111737 · Cited by 18
Hassanin, A., Tú, V. T., Görföl, T., LAM, N. Q., Pham, P. V., Hang, C. T., Tuấn, T. A., Prot, M., Simon‐Lorière, E., Kemenesi, G., et al. (2024) · Molecular Ecology · doi:10.1111/mec.17486 · Cited by 19
“…(Hassanin, 2022 ), were previously detected in Asian horseshoe bats: the first was mainly found in Rhinolophus stheno from Yunnan (lineage named YunSar ) (Guo et al., 2021; Hassanin et al., 2022; Zhou et al., 2021) and the second in Rhinolophus cornutus from Japan (Murakami et al., 2022).”
Disulfide stabilization reveals conserved dynamic features between SARS-CoV-1 and SARS-CoV-2 spikes
Zhang, X., Li, Z., Zhang, Y., Liu, Y., Wang, J., Liu, B., Chen, Q., Wang, Q., Fu, L., Wang, P., et al. (2023) · Life Science Alliance · doi:10.26508/lsa.202201796 · Cited by 16
“AmongSarbecoviruses,thestructures of SARS-CoV-1 S protein were fi rst determined and conformational dynamics was fi rst observed for a CoV S-trimer.”
BackgroundInfluentialStructural basis of SARS-CoV-2 and its variants binding to intermediate horseshoe bat ACE2
Tang, L., Zhang, D., Han, P., Kang, X., Zheng, A., Xu, Z., Zhao, X., Wang, V. Y., Qi, J., Wang, Q., et al. (2022) · International Journal of Biological Sciences · doi:10.7150/ijbs.73640 · Cited by 16
Natural infections of SARS‐CoV‐2 increased in animals: How should humans interact with animals?
Zhai, S., Li, C., Sun, M., Zhang, J., Zheng, C., & Liao, M. (2022) · Journal of Medical Virology · doi:10.1002/jmv.27772 · Cited by 15
Evolutionary dynamics of the severe acute respiratory syndrome coronavirus 2 genomes
Qian, Z., Li, P., Tang, X., & Lü, J. (2022) · Medical Review · doi:10.1515/mr-2021-0035 · Cited by 14
“Experimental results reveal that these differences, possibly combined with the effect of deletion 1, might be responsible for the loss of binding affinity to hACE2 [44].”
BackgroundInfluentialPeña-Hernández, M. A., Alfajaro, M. M., Filler, R. B., Moriyama, M., Keeler, E. L., Ranglin, Z. E., Kong, Y., Mao, T., Menasché, B. L., Mankowski, M. C., et al. (2024) · Nature Microbiology · doi:10.1038/s41564-024-01765-z · Cited by 15
Wang, J., Ma, Y., Li, Z., Yuan, H., Liu, B., Li, Z., Su, M., Habib, G., Liu, Y., Fu, L., et al. (2025) · Science Advances · doi:10.1126/sciadv.adr8772 · Cited by 14
“Both the RBD LL and SL have been identified to play important roles in ACE2 mediated pseudovirus cell entry assays ( 100 , 101 ).”
Self-citationThe furin cleavage site is required for pathogenesis, but not transmission, of SARS-CoV-2
Morgan, A. L., Vu, M. N., Zhou, Y., Lokugamage, K. G., Meyers, W. M., Alvarado, R. E., Ahearn, Y. P., Estes, L. K., Plante, J. A., Johnson, B. A., et al. (2025) · Journal of Virology · doi:10.1128/jvi.00467-25 · Cited by 13
“Over the past decade, numerous CoVs have been identified in animal populations with this capacity (23–27).”
Guo, H., Li, A., Lin, H., Liu, M., Chen, J., Jiang, T., Li, B., Wang, Y., Letko, M. C., Peng, W., et al. (2022) · Journal of Virology · doi:10.1128/jvi.00958-22 · Cited by 10
Self-citationYao, Y., Yun, L., Wang, Q. M., Geng, R., Chen, Y., Liu, M., Li, B., Chen, J., Wu, C., Jia, J.-K., et al. (2023) · Emerging Microbes & Infections · doi:10.1080/22221751.2023.2249120 · Cited by 11
“Recent studies have suggested that NSP9 binds to the NiRAN domain and affects RNA capping structure synthesis by affecting the enzymatic activity of the NSP12 NiRAN [50,51].”
BackgroundSelf-citationTowards a Safer Future: Enhancing Vaccine Development to Combat Animal Coronaviruses
Si, F., Yu, R., Dong, S., Chen, B., Li, C., & Song, S. (2024) · Vaccines · doi:10.3390/vaccines12030330 · Cited by 11
Emergence of SARS and COVID-19 and preparedness for the next emerging disease X
Hu, B., Guo, H., Si, H.-R., & Shi, Z. (2024) · Frontiers of Medicine · doi:10.1007/s11684-024-1066-6 · Cited by 12
Self-citationLiu, B., Niu, X., Deng, Y., Zhang, Z., Wang, Y., Gao, X., Liang, H., Li, Z., Wang, Q., Cheng, Y., et al. (2024) · Cell Reports · doi:10.1016/j.celrep.2024.114265 · Cited by 10
Su, C., He, J., Wang, L., Hu, Y., Cao, J., Bai, B., Qi, J., Gao, G. F., Yang, M., & Wang, Q. (2024) · mBio · doi:10.1128/mbio.01404-24 · Cited by 10
“Interestingly, some short-deletion sarbecoviruses, like BM48-31, have shown limited binding ability to ACE2 receptors (34, 35), while others such as BtKY72 and RaTG15 exhibit ACE2-bind ing capability, such as to intermediate horseshoe bat ACE2, but not to hACE2 (2, 34).”
BackgroundGenomic Bootstrap Barcodes and Their Application to Study the Evolution of Sarbecoviruses
Hassanin, A., Rambaud, O., & Klein, D. (2022) · Viruses · doi:10.3390/v14020440 · Cited by 12
Yang, Y., Shen, X.-R., Zhang, Y., Jiang, R.-D., Wang, X., Guan, Z., Li, Q., Yao, Y., Gong, Q.-C., Geng, R., et al. (2023) · mBio · doi:10.1128/mbio.03285-22 · Cited by 9
Self-citationLiu, M., Jiang, R.-D., Guo, J. H., Chen, Y., Yang, D., Wang, X., Lin, H., Li, A., Li, B., Hu, B., et al. (2022) · Journal of Virology · doi:10.1128/jvi.00169-22 · Cited by 9
Self-citationFIRST DESCRIPTION OF SEROLOGICAL EVIDENCE FOR SARS-CoV-2 IN CATTLEPreprint
Fiorito, F., Iovane, V., Pagnini, U., Cerracchio, C., Brandi, S., Levante, M., Marati, L., Ferrara, G., Tammaro, V., Carlo, E. D., et al. (2022) · doi:10.22541/au.164927303.35296083/v1 · Cited by 9
“Sequence analyses suggest that SARS-CoV-2 could have originated from bat CoVs, highlighting interspecies transmission of CoVs (Boni et al., 2020; Guo et al., 2020; Guo et al., 2021), although the intermediate host is currently unknown.”
BackgroundA comprehensive dataset of animal-associated sarbecoviruses
Liu, B., Zhao, P., Xu, P., Han, Y., Wang, Y., Chen, L., Wú, Z., & Yang, J. (2023) · Scientific Data · doi:10.1038/s41597-023-02558-5 · Cited by 9
Zhao, R., 安徽大学物理科学与信息技术研究院, 安. 合. 2., Niu, S., Han, P., Gao, Y., Liu, D., Luo, C., Liu, H., Liu, B., Xu, Y., et al. (2023) · 动物学研究 · doi:10.24272/j.issn.2095-8137.2023.187 · Cited by 8
Katoh, K., & Standley, D. M. (2021) · Communications Biology · doi:10.1038/s42003-021-02663-4 · Cited by 8
Jia, Y., Niu, S., Hu, Y., Chai, Y., Zheng, A., Su, C., Wu, L., Han, P., Han, P., Lu, D., et al. (2022) · Cell Reports · doi:10.1016/j.celrep.2022.111831 · Cited by 8
“…bat coronaviruses (CoVs) have been reported worldwide, including those identified in southern China (RaTG13, RaTG15, RmY N02, and RmYN04) 6–10 ; Cambodia (RshSTT182 and RshST T200) 11 ; Japan (Rc-o139) 12 ; Thailand (RacCS203) 13 ; Bulgaria (BM48-31) 14 ; Kenya (BtKY72) 15 ; and Laos…”
Hassanin, A. (2021) · Gene · doi:10.1016/j.gene.2022.146641 · Cited by 6
Isolation of ACE2-dependent and -independent sarbecoviruses from Chinese horseshoe batsPreprint
Guo, H., Li, A., Dong, T.-Y., Si, H.-R., Hu, B., Li, B., Zhu, Y., Shi, Z., & Letko, M. C. (2023) · bioRxiv (Cold Spring Harbor Laboratory) · doi:10.1101/2023.03.02.530738 · Cited by 6
Self-citationCirculation of SARS-CoV–Related Coronaviruses and Alphacoronaviruses in Bats from Croatia
Brnić, D., Lojkić, I., Krešić, N., Zrnčić, V., Ružanović, L., Mikuletič, T., Bosilj, M., Steyer, A., Keros, T., Habrun, B., et al. (2023) · Microorganisms · doi:10.3390/microorganisms11040959 · Cited by 5
Lin, H., Liu, M., Jiang, R.-D., Gong, Q.-C., Su, J., Guo, Z.-S., Chen, Y., Jia, J.-K., Dong, T.-Y., Zhu, Y., et al. (2023) · Journal of Virology · doi:10.1128/jvi.00790-23 · Cited by 4
“The following primers were used for transcrip tion in vitro: VSV (P protein)-F1: GTTCGTGAGTATCTCAAGTCCT, VSV (P protein)-R2-T7: TAATACGACTCACTATAGGGAGAGCCTTGATTGTCTTCAATTTCTGG; primers used for qPCR have been described previously (69).”
MethodSelf-citationLu, T., Zhang, C., Li, Z., Wei, Y. Z., Sadewasser, A., Yan, Y., Sun, L., Li, J., Wen, Y., Lai, S., et al. (2024) · Journal of Allergy and Clinical Immunology · doi:10.1016/j.jaci.2024.06.007 · Cited by 3
Rahalkar, M. C., & Bahulikar, R. A. (2022) · Current Science · doi:10.18520/cs/v122/i3/247-250 · Cited by 3
Thakur, N., Newman, J., Ni, D., Seow, J., Hay, A. L., Lee, Y., Upadhyay, A., Ekundayo, B., Hammond, J. A., Peacock, T. P., et al. (2025) · bioRxiv (Cold Spring Harbor Laboratory) · doi:10.12688/verixiv.2534.1 · Cited by 3
Wang, J., Li, Z., Jiang, Y. L., Li, Z., Yuan, H., Niu, C., Teng, Y., Liu, B., Li, M., Zhou, M., et al. (2026) · PLoS Pathogens · doi:10.1371/journal.ppat.1014245 · Cited by 2
Temmam, S., Tu, T. C., Regnault, B., Bonomi, M., Chrétien, D., Vendramini, L., Dương, T. N., Phong, T. V., Yen, N. T., Anh, H. N., et al. (2023) · Viruses · doi:10.3390/v15091897 · Cited by 2
COVID-19 vaccination induces cross-neutralisation of sarbecoviruses related to SARS-CoV-2
West, G. E., Morse, R. B., Sievers, B. L., Abdullahi, A., Kamelian, K., Cheng, M. T. K., Bradley, J. R., Baker, S., Graves, B., Stark, H., et al. (2026) · npj Vaccines · doi:10.1038/s41541-026-01469-x · Cited by 2
Oliver, J. L. T., Bernaola‐Galván, P., Perfectti, F., Gómez‐Martín, C., Castiglione, S., Raia, P., Verdú, M., & Moya, A. (2021) · bioRxiv (Cold Spring Harbor Laboratory) · doi:10.1101/2021.11.06.467547 · Cited by 2
Forensic Genomic Analysis Determines That RaTG13 Was Likely Generated from a Bat Mating Plug
Massey, S. E. (2024) · Microbiology Research · doi:10.3390/microbiolres15030119 · Cited by 1
A SARS‐CoV and SARS‐CoV‐2 RBD Heterodimer Vaccine Candidate
Zhang, R., Li, D., Gao, P., Ruan, W., Qiao, S., Xu, S., Dai, L., Luo, T., Zhao, X., & Gao, G. F. (2025) · Journal of Medical Virology · doi:10.1002/jmv.70367 · Cited by 1
“Phylogenetic analyses have further classified sarbecoviruses into SARS ‐ CoV ‐ related lineages, SARS ‐ CoV ‐ 2 ‐ related lineages, and novel lineages [7].”
Chidoti, V., Loisier, A., Zinyakasa, T., Bourgarel, M., Pinarello, V., Matope, G., Chiweshe, N., Missé, D., Mwandiringana, E., Nys, H. M. D., et al. (2025) · BMC Genomics · doi:10.1186/s12864-025-12015-9 · Cited by 1
Thakur, N., Newman, J., Ni, D., Seow, J., Hay, A. L., Lee, Y., Upadhyay, A., Ekundayo, B., Hammond, J. A., Peacock, T. P., et al. (2026) · PLoS Biology · doi:10.1371/journal.pbio.3003944 · Cited by 1
“The RaTG15 RBD bound to Rh. affinis and Malayan pangolin ACE2, and full-length Spike pseudoviruses were able to use these receptors for entry, however, no obvious binding or entry with hACE2 was detected [36].”
Human-transmissible sarbecovirus ‘Khosta-2’ similar to SARS-CoV-2: potential global threat?
Mohapatra, R. K., Mishra, S., Rabaan, A. A., Mohanty, A., & Sah, R. (2023) · Annals of Medicine and Surgery · doi:10.1097/ms9.0000000000000486 · Cited by 1
Characterization and evolutionary history of novel SARS-CoV-2-related viruses in bats from Cambodia
Ou, T. P., Guillebaud, J., Baidaliuk, A., Tum, S., Cheang, D., Delaune, D., Prot, M., Bruder, E., Machado, R. R. G., Pum, L., et al. (2026) · Nature Communications · doi:10.1038/s41467-026-75954-1 · Cited by 1
COVID-19 is a natural infectious disease
Li, Z., Jiang, J.-F., Tong, Y., Ruan, X., & Xu, J. (2021) · Journal of Biosafety and Biosecurity · doi:10.1016/j.jobb.2021.11.001 · Cited by 1
Phylogenetic Tests of Models of Viral Transmission
Zink, R. M., Holck, K., & Morgan, G. L. (2022) · Frontiers in Virology · doi:10.3389/fviro.2022.832466 · Cited by 1
Isolation of bat sarbecoviruses of SARS-CoV-2 clade, JapanPreprint
Murakami, S., Kitamura, T., Matsugo, H., Kamiki, H., Oyabu, K., Sekine, W., Takenaka‐Uema, A., Sakai‐Tagawa, Y., Kawaoka, Y., & Horimoto, T. (2022) · bioRxiv (Cold Spring Harbor Laboratory) · doi:10.1101/2022.05.16.492045 · Cited by 1
Mulemena, J. A., Sichamba, P., Muleya, W., Mubemba, B., Chitanga, S., Simulundu, E., & Changula, K. (2025) · bioRxiv (Cold Spring Harbor Laboratory) · doi:10.1101/2025.03.01.640975 · Cited by 1
“These primers were designed to be either species-specific, genus-specific, or broad-range [31, 46, 47, 118, 168].”
Massey, S. E. (2021) · arXiv (Cornell University) · doi:10.48550/arxiv.2111.09469
Schmidt, S. D., Subramanian, R., Basappa, M., Carroll, R., Rexhepaj, M., Posavad, C. M., Liao, J. A., Bohl, J. A., Chowdhury, A., Spaulding, A. B., et al. (2026) · Nature Communications · doi:10.1038/s41467-026-71662-y
Experimental evolution of Rc-o319 sarbecovirus spike protein reveals limited ACE2 adaptability
Moreno‐García, J., Dufloo, J., & Sanjuán, R. (2026) · Virus Evolution · doi:10.1093/ve/veag035
“…isolation, of new viruses genetically related to SARS-CoV and SARS-CoV-2 ( Lau et al. 2005, Drexler et al. 2010, Menachery et al. 2015, Hu et al. 2017, Tao and Tong 2019, Crook et al. 2021, Guo et al. 2021, Wacharaplue-sadee et al. 2021, Zhou et al. 2021, Alkhovsky et al. 2022, Temmam et al. 2022).”
Zou, J., Su, L., Lu, J., Jing, H., Liu, J., Zeng, X., Ma, M., Zhao, D., Zhang, J., Zhang, Z., et al. (2026) · Antiviral Research · doi:10.1016/j.antiviral.2026.106516
Li, A., Si, H.-R., Wu, K., Zhang, Q., Luo, Y., Chen, J., Jia, J., Yue, Z., Cheng, L., Zhou, P., et al. (2026) · Journal of Virology · doi:10.1128/jvi.01343-26
“Although numerous SARSr-CoVs have been identified, their zoonotic risk remains incompletely understood (3–5).”
Self-citation
Metadata
- Authors
- Guo, H., Hu, B., Si, H.-R., Zhu, Y., Zhang, W., Li, B., Li, A., Geng, R., Lin, H.-F., Yang, X.-L., Zhou, P., & Shi, Z.-L.
- Affiliations
- Chinese Academy of Sciences (CN)
- Center for Biosafety Mega-Science, Chinese Academy of Sciences, Wuhan Institute of Virology
- Corresponding author
- Zhou, Peng
- Shi, Zheng-Li
- Venue
- Emerging Microbes & Infections
- Publisher
- Informa UK Limited
- Published
- 2021-01-01
- Volume
- 10
- Issue
- 1
- Pages
- 1507-1514
- ISSN
- 2222-1751 (ISSN-L)
- PMC
- PMC8344244
- OpenAlex
- W3182681012
- Cited by
- 71
- References
- 24
- Citations by year
- 2026: 8 · 2025: 7 · 2024: 10 · 2023: 15 · 2022: 22 · 2021: 9
- FWCI
- 4.43
- Type
- journal article
- Language
- en
- Open access
- gold
- doi.org
- Licence
- Locations
- Emerging Microbes & Infections (publishedVersion, cc-by-nc)
- bioRxiv (Cold Spring Harbor Laboratory) (acceptedVersion)
- PubMed Central (publishedVersion, cc-by-nc)
- PubMed (publishedVersion)
- DOAJ (DOAJ: Directory of Open Access Journals) (submittedVersion, cc-by-sa)
- Funders
- Strategic Priority Research Program of the Chinese Academy of Sciences
- China National Science Foundation for Excellent Scholars
- Topics
- Health Sciences › Medicine › Infectious Diseases › SARS-CoV-2 and COVID-19 Research
- Life Sciences › Agricultural and Biological Sciences › Animal Science and Zoology › Animal Virus Infections Studies
- Health Sciences › Medicine › Public Health, Environmental and Occupational Health › Zoonotic diseases and public health
- Keywords
- SARS-related coronaviruses, RaTG13, bat coronaviruses, ACE2 receptor, receptor binding domain, Rhinolophus affinis, Malayan pangolin, SARS-CoV-2 origin, reservoir hosts, viral lineages, ORF1b, receptor specificity, spillover effects
- MeSH terms
- Angiotensin-Converting Enzyme 2, SARS-CoV-2, Animals, Chiroptera, Phylogeny, Cell Lineage, Severe acute respiratory syndrome-related coronavirus, Host Specificity
About these checks
Registry, retraction, Cites and statistics results are computed, not judged, with one exception: a printed reference that no index lists is read once by a model before it counts as a citation error. Claims are extracted by a model and kept only when their quote appears verbatim in the text; each cited source is then checked, with a model’s help, for whether it says what the claim relies on. Those verdicts can be wrong — read the claim’s quote and the cited source before relying on one.
Statistics and arithmetic are recomputed, not judged.
Confidence bands are shown only for fields calibrated on our annotated test set. None is calibrated yet, so no band is shown.
What counts as a claim ›How we measure confidence ›How we check this ›
Are you an author, or do you see a problem with this page? Request a review
