The Impact of Mutations in SARS-CoV-2 Spike on Viral Infectivity and Antigenicity
Open accessAbstract
The spike protein of SARS-CoV-2 has been undergoing mutations and is highly glycosylated. It is critically important to investigate the biological significance of these mutations. Here, we investigated 80 variants and 26 glycosylation site modifications for the infectivity and reactivity to a panel of neutralizing antibodies and sera from convalescent patients. D614G, along with several variants containing both D614G and another amino acid change, were significantly more infectious. Most variants with amino acid change at receptor binding domain were less infectious, but variants including A475V, L452R, V483A, and F490L became resistant to some neutralizing antibodies. Moreover, the majority of glycosylation deletions were less infectious, whereas deletion of both N331 and N343 glycosylation drastically reduced infectivity, revealing the importance of glycosylation for viral infectivity. Interestingly, N234Q was markedly resistant to neutralizing antibodies, whereas N165Q became more sensitive. These findings could be of value in the development of vaccine and therapeutic antibodies.
The claims and statistics of this paper haven’t been checked yet.
Run the check — free, no account needed. It reads the open-access text and checks the sources it cites.
Integrity signals
Registry
Cites
Statistics
Claims the paper makes
The claims and statistics of this paper haven’t been checked yet.
Run the check — free, no account needed. It reads the open-access text and checks the sources it cites.
Claims other papers make about this one
Each is checked against this paper’s own text: does it say what the citing paper says it does?
Mutations and site-specific glycans on the glycosylated spike protein play a vital role in infection and immune response and in anticipating the future of COVID-19.
“Being a glycosylated protein, the mutations and the site-specific glycans on infection and immune response play a vital role in anticipating the future of the COVID-19 disease [20].”
From Waves and variants of SARS-CoV-2: understanding the causes and effect of the COVID-19 catastrophe (2022) · cites this paper as [20]
Other groups have reported comparable findings with vaccinee and convalescent plasma across various pseudotype and authentic virus assays.
“In addition, similar results have been reported by others using vaccinee and convalescent plasmas and a variety of different pseudotype and authentic virus assays15,31,45–49.”
From mRNA vaccine-elicited antibodies to SARS-CoV-2 and circulating variants (2021) · cites this paper as [48]
Mutations found in emergent S variants decrease sensitivity to neutralization by mAbs, convalescent plasma, and sera from vaccinated individuals.
“Mutations found in emergent S variants decrease sensitivity to neutralization by mAbs, convalescent plasma, and sera from vaccinated individuals (27, 37, 58, 61–70).”
From mRNA vaccination boosts cross-variant neutralizing antibodies elicited by SARS-CoV-2 infection (2021) · cites this paper as [63]
Several of the delta variant's spike mutations may affect immune responses directed toward key antigenic regions of the receptor-binding protein (positions 452 and 478) and the deletion of part of the N-terminal domain.
“Several of these mutations may affect immune responses directed toward the key antigenic regions of receptor-binding protein (452 and 478) and deletion of part of the N-terminal domain.23”
From Effectiveness of Covid-19 Vaccines against the B.1.617.2 (Delta) Variant (2021) · cites this paper as [23]
Self-check
Percentages, sums and reported differences re-computed from the paper’s own numbers.
The self-check needs the paper’s full text.
Cites
Yang, X., Yu, Y., Xu, J., Shu, H., Xia, J., Liu, H., Wu, Y., Zhang, L., Yu, Z., Fang, M., et al. (2020) · The Lancet Respiratory Medicine · doi:10.1016/s2213-2600(20)30079-5 · Cited by 10,066 · see citing works
Self-citationCryo-EM structure of the 2019-nCoV spike in the prefusion conformation
Wrapp, D., Wang, N., Corbett, K. S., Goldsmith, J. A., Hsieh, C.-L., Abiona, O., Graham, B. S., & McLellan, J. S. (2020) · Science · doi:10.1126/science.abb2507 · Cited by 8,897 · see citing works
Structure, function and antigenicity of the SARS-CoV-2 spike glycoprotein
Walls, A. C., Park, Y.-J., Tortorici, M. A., Wall, A., McGuire, A. T., & Veesler, D. (2020) · doi:10.1101/2020.02.19.956581 · Cited by 8,586 · see citing works
Korber, B., Fischer, W. M., Gnanakaran, S., Yoon, H., Theiler, J., Abfalterer, W., Hengartner, N., Giorgi, E. E., Bhattacharya, T., Foley, B., et al. (2020) · Cell · doi:10.1016/j.cell.2020.06.043 · Cited by 4,281 · see citing works
Letko, M., Marzi, A., & Munster, V. (2020) · Nature Microbiology · doi:10.1038/s41564-020-0688-y · Cited by 3,109 · see citing works
Chan, J. F., Kok, K., Zhu, Z., Chu, H., To, K. K., Yuan, S., & Yuen, K. (2020) · Emerging Microbes & Infections · doi:10.1080/22221751.2020.1719902 · Cited by 3,063 · see citing works
Structural and Functional Basis of SARS-CoV-2 Entry by Using Human ACE2
Wang, Q., Zhang, Y., Wu, L., Niu, S., Song, C., Zhang, Z., Lu, G., Qiao, C., Hu, Y., Yuen, K.-Y., et al. (2020) · Cell · doi:10.1016/j.cell.2020.03.045 · Cited by 2,892 · cited 1× · see citing works
“It is possible that antibodies in convalescent sera are able to neutralize these critical epitopes targeted by these mAbs that are known to disrupt the binding of the S protein to hACE2 receptor (Ju et al., 2020; Shi et al., 2020; Walls et al., 2020; Wang et al., 2020).”
Structure, Function, and Evolution of Coronavirus Spike Proteins
Li, F. (2016) · Annual Review of Virology · doi:10.1146/annurev-virology-110615-042301 · Cited by 2,740 · see citing works
Human neutralizing antibodies elicited by SARS-CoV-2 infection
Ju, B., Zhang, Q., Ge, J., Wang, R., Sun, J., Ge, X., Yu, J., Shan, S., Zhou, B., Song, S., et al. (2020) · Nature · doi:10.1038/s41586-020-2380-z · Cited by 1,667 · cited 5× · see citing works
“Specifically, P2B-2F6 and P2C-1F11 were obtained using RBD as a bait to isolate RBD-specific B cells in peripheral blood mononuclear cells (PBMCs) of SARS-CoV-2 patients (Ju et al., 2020).”
InfluentialSelf-citationAirborne Transmission of Influenza A/H5N1 Virus Between Ferrets
Herfst, S., Schrauwen, E. J. A., Linster, M., Chutinimitkul, S., de Wit, E., Munster, V. J., Sorrell, E. M., Bestebroer, T. M., Burke, D. F., Smith, D. J., et al. (2012) · Science · doi:10.1126/science.1213362 · Cited by 1,662 · see citing works
The spike protein of SARS-CoV — a target for vaccine and therapeutic development
Du, L., He, Y., Zhou, Y., Liu, S., Zheng, B.-J., & Jiang, S. (2009) · Nature Reviews Microbiology · doi:10.1038/nrmicro2090 · Cited by 1,649 · see citing works
Self-citationA Single Mutation in Chikungunya Virus Affects Vector Specificity and Epidemic Potential
Tsetsarkin, K. A., Vanlandingham, D. L., McGee, C. E., & Higgs, S. (2007) · PLoS Pathogens · doi:10.1371/journal.ppat.0030201 · Cited by 1,626 · see citing works
Site-specific glycan analysis of the SARS-CoV-2 spike
Watanabe, Y., Allen, J. D., Wrapp, D., McLellan, J. S., & Crispin, M. (2020) · Science · doi:10.1126/science.abb9983 · Cited by 1,507 · see citing works
A human neutralizing antibody targets the receptor-binding site of SARS-CoV-2
Shi, R., Shan, C., Duan, X., Chen, Z., Liu, P., Song, J., Song, T., Bi, X., Han, C., Wu, L., et al. (2020) · Nature · doi:10.1038/s41586-020-2381-y · Cited by 1,286 · see citing works
Self-citationCao, Y., Su, B., Guo, X., Sun, W., Deng, Y., Bao, L., Zhu, Q., Zhang, X., Zheng, Y., Geng, C., et al. (2020) · Cell · doi:10.1016/j.cell.2020.05.025 · Cited by 1,188 · see citing works
Self-citationHemI: A Toolkit for Illustrating Heatmaps
Deng, W., Wang, Y., Liu, Z., Cheng, H., & Xue, Y. (2014) · PLoS ONE · doi:10.1371/journal.pone.0111988 · Cited by 993 · see citing works
Self-citationWu, Y., Wang, F., Shen, C., Peng, W., Li, D., Zhao, C., Li, Z., Li, S., Bi, Y., Yang, Y., et al. (2020) · Science · doi:10.1126/science.abc2241 · Cited by 955 · see citing works
Self-citationQuasispecies Theory and the Behavior of RNA Viruses
Lauring, A. S., & Andino, R. (2010) · PLoS Pathogens · doi:10.1371/journal.ppat.1001005 · Cited by 840 · see citing works
Emergence of genomic diversity and recurrent mutations in SARS-CoV-2
van Dorp, L., Acman, M., Richard, D., Shaw, L. P., Ford, C. E., Ormond, L., Owen, C. J., Pang, J., Tan, C. C. S., Boshier, F. A. T., et al. (2020) · Infection Genetics and Evolution · doi:10.1016/j.meegid.2020.104351 · Cited by 775 · see citing works
Why are RNA virus mutation rates so damn high?
Duffy, S. (2018) · PLoS Biology · doi:10.1371/journal.pbio.3000003 · Cited by 750 · see citing works
Establishment and validation of a pseudovirus neutralization assay for SARS-CoV-2
Nie, J., Li, Q., Wu, J., Zhao, C., Hao, H., Liu, H., Zhang, L., Nie, L., Qin, H., Wang, M., et al. (2020) · Emerging Microbes & Infections · doi:10.1080/22221751.2020.1743767 · Cited by 711 · see citing works
Self-citationVankadari, N., & Wilce, M. C. J. (2020) · Emerging Microbes & Infections · doi:10.1080/22221751.2020.1739565 · Cited by 588 · see citing works
Coronavirus Spike Protein and Tropism Changes
Hulswit, R. J. G., de Haan, C. A. M., & Bosch, B. (2016) · Advances in virus research · doi:10.1016/bs.aivir.2016.08.004 · Cited by 466 · see citing works
Structural basis for neutralization of SARS-CoV-2 and SARS-CoV by a potent therapeutic antibody
Lv, Z., Deng, Y., Ye, Q., Cao, L., Sun, C.-Y., Fan, C., Huang, W., Sun, S., Sun, Y., Zhu, L., et al. (2020) · Science · doi:10.1126/science.abc5881 · Cited by 362 · see citing works
Self-citationSARS‐CoV‐2 viral spike G614 mutation exhibits higher case fatality rate
Becerra‐Flores, M., & Cardozo, T. J. (2020) · International Journal of Clinical Practice · doi:10.1111/ijcp.13525 · Cited by 291 · see citing works
Kumar, S., Maurya, V. K., Prasad, A. K., Bhatt, M. L. B., & Saxena, S. K. (2020) · VirusDisease · doi:10.1007/s13337-020-00571-5 · Cited by 228 · see citing works
Human Adaptation of Ebola Virus during the West African Outbreak
Urbanowicz, R. A., McClure, C. P., Sakuntabhai, A., Sall, A. A., Kobinger, G., Müller, M. A., Holmes, E. C., Rey, F. A., Simon‐Lorière, E., & Ball, J. K. (2016) · Cell · doi:10.1016/j.cell.2016.10.013 · Cited by 219 · see citing works
Ebola Virus Glycoprotein with Increased Infectivity Dominated the 2013–2016 Epidemic
Diehl, W. E., Lin, A. E., Grubaugh, N. D., Carvalho, L. M., Kim, K., Kyawe, P. P., McCauley, S. M., Donnard, E. R., Küçükural, A., McDonel, P. E., et al. (2016) · Cell · doi:10.1016/j.cell.2016.10.014 · Cited by 192 · see citing works
Characterization of a filovirus (Měnglà virus) from Rousettus bats in China
Yang, X., Tan, C. W., Anderson, D. E., Jiang, R.-D., Li, B., Zhang, W., Zhu, Y., Lim, X. F., Zhou, P., Liu, X., et al. (2018) · Nature Microbiology · doi:10.1038/s41564-018-0328-y · Cited by 165 · see citing works
Self-citationLi, Y., Cleveland, B., Klots, I. N., Travis, B. M., Richardson, B. A., Anderson, D., Montefiori, D. C., Polacino, P. S., & Hu, S.-L. (2007) · Journal of Virology · doi:10.1128/jvi.01691-07 · Cited by 164 · see citing works
Mutated COVID-19 may foretell a great risk for mankind in the future
Dawood, A. A. (2020) · New Microbes and New Infections · doi:10.1016/j.nmni.2020.100673 · Cited by 160 · see citing works
He, Y., Zhou, Y., Wu, H., Luo, B., Chen, J., Li, W., & Jiang, S. (2004) · The Journal of Immunology · doi:10.4049/jimmunol.173.6.4050 · Cited by 142 · see citing works
The HIV glycan shield as a target for broadly neutralizing antibodies
Doores, K. J. (2015) · FEBS Journal · doi:10.1111/febs.13530 · Cited by 131 · see citing works
Coronavirus disease (COVID-19): a scoping review
Lv, M., Luo, X., Estill, J., Liu, Y., Ren, M., Wang, J., Wang, Q., Zhao, S., Wang, X., Yang, S., et al. (2020) · Eurosurveillance · doi:10.2807/1560-7917.es.2020.25.15.2000125 · Cited by 122 · see citing works
Wang, W., Nie, J., Prochnow, C., Truong, C., Jia, Z., Wang, S., Chen, X. S., & Wang, Y. (2013) · Retrovirology · doi:10.1186/1742-4690-10-14 · Cited by 114 · see citing works
Self-citationSaha, P., Banerjee, A. K., Tripathi, P. P., Srivastava, A. K., & Ray, U. (2020) · Bioscience Reports · doi:10.1042/bsr20201312 · Cited by 90 · see citing works
Emerging genetic diversity among clinical isolates of SARS-CoV-2: Lessons for today
Sheikh, J. A., Singh, J., Singh, H., Jamal, S., Khubaib, M., Kohli, S., Dobrindt, U., Rahman, S. A., Ehtesham, N. Z., & Hasnain, S. E. (2020) · Infection Genetics and Evolution · doi:10.1016/j.meegid.2020.104330 · Cited by 59 · see citing works
Kong, L., Wilson, I. A., & Kwong, P. D. (2014) · Proteins Structure Function and Bioinformatics · doi:10.1002/prot.24747 · Cited by 43 · see citing works
Structural basis for neutralization of SARS-CoV-2 and SARS-CoV by a potent therapeutic antibodyPreprint
Lv, Z., Deng, Y., Ye, Q., et al. (2020) · bioRxiv (Cold Spring Harbor Laboratory) · doi:10.1101/2020.06.02.129098 · Cited by 41 · see citing works
Utachee, P., Nakamura, S., Isarangkura-na-ayuthaya, P., Tokunaga, K., Sawanpanyalert, P., Ikuta, K., Auwanit, W., & Kameoka, M. (2010) · Journal of Virology · doi:10.1128/jvi.02619-09 · Cited by 40 · see citing works
Antigenic Drift of Influenza A(H7N9) Virus Hemagglutinin
Ning, T., Nie, J., Huang, W., et al. (2018) · The Journal of Infectious Diseases · doi:10.1093/infdis/jiy408 · Cited by 39 · see citing works
Self-citationThe Highly Conserved Glycan at Asparagine 260 of HIV-1 gp120 Is Indispensable for Viral Entry
François, K. O., & Balzarini, J. M. (2011) · Journal of Biological Chemistry · doi:10.1074/jbc.m111.274456 · Cited by 30 · see citing works
Zhang, X., Chen, S., Yang, D., Wang, X., Zhu, J., Peng, D., & Liu, X. (2015) · Journal of General Virology · doi:10.1099/vir.0.000082 · Cited by 27 · see citing works
Huang, Y., Owino, S. O., Crevar, C. J., et al. (2019) · Journal of Virology · doi:10.1128/jvi.01432-19 · Cited by 23 · see citing works
Wang, W., Zirkle, B., Nie, J., Ma, J., Gao, K., Chen, X. S., Huang, W., Kong, W., & Wang, Y. (2015) · JAIDS Journal of Acquired Immune Deficiency Syndromes · doi:10.1097/qai.0000000000000595 · Cited by 16 · see citing works
Self-citationInfluenza A(H7N9) Virus Evolution: Which Genetic Mutations Are Antigenically Important?
Petrie, J. G., & Lauring, A. S. (2018) · The Journal of Infectious Diseases · doi:10.1093/infdis/jiy409 · Cited by 7 · see citing works
Flagged first, then by citations
Cited by
Sorted by citations
SARS-CoV-2 variants, spike mutations and immune escape
Harvey, W. T., Carabelli, A. M., Jackson, B., Gupta, R. K., Thomson, E. C., Harrison, E. M., Ludden, C., Reeve, R., Rambaut, A., COVID-19 Genomics UK (COG-UK) Consortium, et al. (2021) · Nature Reviews Microbiology · doi:10.1038/s41579-021-00573-0 · Cited by 3,528 · see citing works
Effectiveness of Covid-19 Vaccines against the B.1.617.2 (Delta) Variant
Lopez Bernal, J., Andrews, N., Gower, C., Gallagher, E., Simmons, R., Thelwall, S., Stowe, J., Tessier, E., Groves, N., Dabrera, G., et al. (2021) · New England Journal of Medicine · doi:10.1056/nejmoa2108891 · Cited by 2,889 · see citing works
Adaptive immunity to SARS-CoV-2 and COVID-19
Sette, A., & Crotty, S. (2021) · Cell · doi:10.1016/j.cell.2021.01.007 · Cited by 1,860 · see citing works
Evolution of antibody immunity to SARS-CoV-2
Gaebler, C., Wang, Z., Lorenzi, J. C. C., Muecksch, F., Finkin, S., Tokuyama, M., Cho, A., Jankovic, M., Schaefer-Babajew, D., Oliveira, T. Y., et al. (2021) · Nature · doi:10.1038/s41586-021-03207-w · Cited by 1,674 · see citing works
SARS-CoV-2 neutralizing antibody structures inform therapeutic strategies
Barnes, C. O., Jette, C. A., Abernathy, M. E., Dam, K.-M. A., Esswein, S. R., Gristick, H. B., Malyutin, A. G., Sharaf, N. G., Huey-Tubman, K. E., Lee, Y. E., et al. (2020) · Nature · doi:10.1038/s41586-020-2852-1 · Cited by 1,599 · see citing works
mRNA vaccine-elicited antibodies to SARS-CoV-2 and circulating variants
Wang, Z., Schmidt, F., Weisblum, Y., Muecksch, F., Barnes, C. O., Finkin, S., Schaefer-Babajew, D., Cipolla, M., Gaebler, C., Lieberman, J. A., et al. (2021) · Nature · doi:10.1038/s41586-021-03324-6 · Cited by 1,343 · see citing works
Greaney, A. J., Loes, A. N., Crawford, K. H. D., Starr, T. N., Malone, K. D., Chu, H. Y., & Bloom, J. D. (2021) · Cell Host & Microbe · doi:10.1016/j.chom.2021.02.003 · Cited by 1,178 · see citing works
Greaney, A. J., Starr, T. N., Gilchuk, P., Zost, S. J., Binshtein, E., Loes, A. N., Hilton, S. K., Huddleston, J., Eguia, R., Crawford, K. H. D., et al. (2021) · Cell Host & Microbe · doi:10.1016/j.chom.2020.11.007 · Cited by 1,016 · see citing works
N-terminal domain antigenic mapping reveals a site of vulnerability for SARS-CoV-2
McCallum, M., De Marco, A., Lempp, F. A., Tortorici, M. A., Pinto, D., Walls, A. C., Beltramello, M., Chen, A., Liu, Z., Zatta, F., et al. (2021) · Cell · doi:10.1016/j.cell.2021.03.028 · Cited by 901 · see citing works
“As several examples of single amino acid mutations reducing or completely abrogating neutralization by immune sera have been reported (Li et al., 2020; Liu et al., 2020b; Weisblum et al., 2020), we propose that combinations ofmAbs targeting distinct domains might reduce the likelihood of emergence of”
The biological and clinical significance of emerging SARS-CoV-2 variants
Tao, K., Tzou, P. L., Nouhin, J., Gupta, R. K., de Oliveira, T., Kosakovsky Pond, S. L., Fera, D., & Shafer, R. W. (2021) · Nature Reviews Genetics · doi:10.1038/s41576-021-00408-x · Cited by 1,009 · see citing works
SARS-CoV-2 D614G variant exhibits efficient replication ex vivo and transmission in vivo
Hou, Y. J., Chiba, S., Halfmann, P., Ehre, C., Kuroda, M., Dinnon, K. H., Leist, S. R., Schäfer, A., Nakajima, N., Takahashi, K., et al. (2020) · Science · doi:10.1126/science.abe8499 · Cited by 900 · see citing works
Liu, Z., VanBlargan, L. A., Bloyet, L.-M., Rothlauf, P. W., Chen, R. E., Stumpf, S., Zhao, H., Errico, J. M., Theel, E. S., Liebeskind, M. J., et al. (2021) · Cell Host & Microbe · doi:10.1016/j.chom.2021.01.014 · Cited by 725 · see citing works
“The relatively low genetic barrier to resistance combined with knowledge of the presence of relevant substitutions in clinical isolates suggests that effective mAb therapy will likely require a combination of at least two neutralizing antibodies (ACTIV-3/ TICO LY-CoV555 Study Group, 2020; Baum et al., 2020; Du et al.,…”
BackgroundTo, K. K.-W., Hung, I. F.-N., Ip, J. D., Chu, A. W.-H., Chan, W.-M., Tam, A. R., Fong, C. H.-Y., Yuan, S., Tsoi, H.-W., Ng, A. C.-K., et al. (2021) · Clinical Infectious Diseases · doi:10.1093/cid/ciaa1275 · Cited by 746 · see citing works
COVID-19 and the human innate immune system
Schultze, J. L., & Aschenbrenner, A. C. (2021) · Cell · doi:10.1016/j.cell.2021.02.029 · Cited by 714 · see citing works
Thomson, E. C., Rosen, L. E., Shepherd, J. G., Spreafico, R., da Silva Filipe, A., Wojcechowskyj, J. A., Davis, C., Piccoli, L., Pascall, D. J., Dillen, J., et al. (2021) · Cell · doi:10.1016/j.cell.2021.01.037 · Cited by 606 · see citing works
Ultrapotent human antibodies protect against SARS-CoV-2 challenge via multiple mechanisms
Tortorici, M. A., Beltramello, M., Lempp, F. A., Pinto, D., Dang, H. V., Rosen, L. E., McCallum, M., Bowen, J., Minola, A., Jaconi, S., et al. (2020) · Science · doi:10.1126/science.abe3354 · Cited by 510 · see citing works
mRNA vaccination boosts cross-variant neutralizing antibodies elicited by SARS-CoV-2 infection
Stamatatos, L., Czartoski, J., Wan, Y.-H., Homad, L. J., Rubin, V., Glantz, H., Neradilek, M., Seydoux, E., Jennewein, M. F., MacCamy, A. J., et al. (2021) · Science · doi:10.1126/science.abg9175 · Cited by 557 · see citing works
Walls, A. C., Fiala, B., Schäfer, A., Wrenn, S., Pham, M. N., Murphy, M., Tse, L. V., Shehata, L., O’Connor, M. A., Chen, C., et al. (2020) · Cell · doi:10.1016/j.cell.2020.10.043 · Cited by 532 · see citing works
SARS-CoV-2 spike L452R variant evades cellular immunity and increases infectivity
Motozono, C., Toyoda, M., Zahradnik, J., Saito, A., Nasser, H., Tan, T. S., Ngare, I., Kimura, I., Uriu, K., Kosugi, Y., et al. (2021) · Cell Host & Microbe · doi:10.1016/j.chom.2021.06.006 · Cited by 586 · see citing works
SARS-CoV-2 spike D614G change enhances replication and transmission
Zhou, B., Thao, T. T. N., Hoffmann, D., Taddeo, A., Ebert, N., Labroussaa, F., Pohlmann, A., King, J., Steiner, S., Kelly, J. N., et al. (2021) · Nature · doi:10.1038/s41586-021-03361-1 · Cited by 538 · see citing works
SARS-CoV-2 immune evasion by the B.1.427/B.1.429 variant of concern
McCallum, M., Bassi, J., De Marco, A., Chen, A., Walls, A. C., Di Iulio, J., Tortorici, M. A., Navarro, M.-J., Silacci-Fregni, C., Saliba, C., et al. (2021) · Science · doi:10.1126/science.abi7994 · Cited by 412 · see citing works
Shen, X., Tang, H., McDanal, C., Wagh, K., Fischer, W., Theiler, J., Yoon, H., Li, D., Haynes, B. F., Sanders, K. O., et al. (2021) · Cell Host & Microbe · doi:10.1016/j.chom.2021.03.002 · Cited by 378 · see citing works
Emergence of a Novel SARS-CoV-2 Variant in Southern California
Zhang, W., Davis, B. D., Chen, S. S., Sincuir Martinez, J. M., Plummer, J. T., & Vail, E. (2021) · JAMA · doi:10.1001/jama.2021.1612 · Cited by 371 · see citing works
Anosmia in COVID-19: Underlying Mechanisms and Assessment of an Olfactory Route to Brain Infection
Butowt, R., & von Bartheld, C. S. (2021) · The Neuroscientist · doi:10.1177/1073858420956905 · Cited by 345 · see citing works
Genetic and structural basis for SARS-CoV-2 variant neutralization by a two-antibody cocktail
Dong, J., Zost, S. J., Greaney, A. J., Starr, T. N., Dingens, A. S., Chen, E. C., Chen, R. E., Case, J. B., Sutton, R. E., Gilchuk, P., et al. (2021) · Nature Microbiology · doi:10.1038/s41564-021-00972-2 · Cited by 285 · see citing works
Effectiveness of COVID-19 vaccines against the B.1.617.2 variant
Bernal, J. L., Andrews, N., Gower, C., Gallagher, E., Simmons, R., Thelwall, S., Stowe, J., Tessier, E., Groves, N., Dabrera, G., et al. (2021) · doi:10.1101/2021.05.22.21257658 · Cited by 2,888 · see citing works
“Several of these mutations may impact on immune responses directed towards the key antigenic regions of receptor binding protein (452 and 478) and deletion of part of the N terminal domain (22).”
BackgroundHoffmann, M., Hofmann-Winkler, H., Krüger, N., Kempf, A., Nehlmeier, I., Graichen, L., Arora, P., Sidarovich, A., Moldenhauer, A.-S., Winkler, M. S., et al. (2021) · Cell Reports · doi:10.1016/j.celrep.2021.109415 · Cited by 258 · see citing works
Waves and variants of SARS-CoV-2: understanding the causes and effect of the COVID-19 catastrophe
Thakur, V., Bhola, S., Thakur, P., Patel, S. K. S., Kulshrestha, S., Ratho, R. K., & Kumar, P. (2022) · Infection · doi:10.1007/s15010-021-01734-2 · Cited by 210 · see citing works
“Being a glycosylated protein, the mutations and the site-specific glycans on infection and immune response play a vital role in anticipating the future of the COVID-19 disease [20].”
BackgroundGreaney, A. J., Loes, A. N., Crawford, K. H. D., Starr, T. N., Malone, K. D., Chu, H. Y., & Bloom, J. D. (2021) · doi:10.1101/2020.12.31.425021 · Cited by 1,178 · see citing works
Walls, A. C., Miranda, M. C., Schäfer, A., Pham, M. N., Greaney, A., Arunachalam, P. S., Navarro, M.-J., Tortorici, M. A., Rogers, K., O’Connor, M. A., et al. (2021) · Cell · doi:10.1016/j.cell.2021.09.015 · Cited by 185 · see citing works
“Conversely, some mutations found in circulating SARS-CoV-2 isolates were shown to promote escape from mAbs and to reduce neutralization by immune sera (Baum et al., 2020b; Collier et al., 2021; Li et al., 2020; McCallum et al., 2021a, 2021b; Wang et al., 2021a; Weisblum et al., 2020; Wibmer et al., 2021).”
Prolonged evolution of the human B cell response to SARS-CoV-2 infection
Sakharkar, M., Rappazzo, C. G., Wieland-Alter, W. F., Hsieh, C.-L., Wrapp, D., Esterman, E. S., Kaku, C. I., Wec, A. Z., Geoghegan, J. C., McLellan, J. S., et al. (2021) · Science Immunology · doi:10.1126/sciimmunol.abg6916 · Cited by 174 · see citing works
N-terminal domain antigenic mapping reveals a site of vulnerability for SARS-CoV-2
McCallum, M., Marco, A. D., Lempp, F., Tortorici, M. A., Pinto, D., Walls, A. C., Beltramello, M., Chen, A., Liu, Z., Zatta, F., et al. (2021) · doi:10.1101/2021.01.14.426475 · Cited by 901 · see citing works
Measuring immunity to SARS-CoV-2 infection: comparing assays and animal models
Khoury, D. S., Wheatley, A. K., Ramuta, M. D., Reynaldi, A., Cromer, D., Subbarao, K., O’Connor, D. H., Kent, S. J., & Davenport, M. P. (2020) · Nature Reviews Immunology · doi:10.1038/s41577-020-00471-1 · Cited by 115 · see citing works
Chen, X., Chen, Z., Azman, A. S., Sun, R., Lu, W., Zheng, N., Zhou, J., Wu, Q., Deng, X., Zhao, Z., et al. (2022) · Clinical Infectious Diseases · doi:10.1093/cid/ciab646 · Cited by 113 · see citing works
Liu, Z., VanBlargan, L. A., Bloyet, L.-M., Rothlauf, P. W., Chen, R. E., Stumpf, S., Zhao, H., Errico, J. M., Theel, E. S., Liebeskind, M. J., et al. (2020) · doi:10.1101/2020.11.06.372037 · Cited by 135 · see citing works
Chumakov, K., Avidan, M. S., Benn, C. S., Bertozzi, S. M., Blatt, L., Chang, A. Y., Jamison, D. T., Khader, S. A., Kottilil, S., Netea, M. G., et al. (2021) · Proceedings of the National Academy of Sciences · doi:10.1073/pnas.2101718118 · Cited by 96 · see citing works
Stamatatos, L., Czartoski, J., Wan, Y.-H., Homad, L. J., Rubin, V., Glantz, H., Neradilek, M., Seydoux, E., Jennewein, M. F., MacCamy, A. J., et al. (2021) · doi:10.1101/2021.02.05.21251182 · Cited by 559 · see citing works
Sequence signatures of two public antibody clonotypes that bind SARS-CoV-2 receptor binding domain
Tan, T. J. C., Yuan, M., Kuzelka, K., Padron, G. C., Beal, J. R., Chen, X., Wang, Y., Rivera-Cardona, J., Zhu, X., Stadtmueller, B. M., et al. (2021) · Nature Communications · doi:10.1038/s41467-021-24123-7 · Cited by 75 · see citing works
Self-citationInfectivity and immune escape of the new SARS-CoV-2 variant of interest Lambda
Acevedo, M. L., Alonso-Palomares, L., Bustamante, A., Gaggero, A., Paredes, F., Cortés, C. P., Valiente-Echeverría, F., & Soto-Rifo, R. (2021) · doi:10.1101/2021.06.28.21259673 · Cited by 99 · see citing works
Tackling COVID-19 with neutralizing monoclonal antibodies
Corti, D., Purcell, L. A., Snell, G., & Veesler, D. (2021) · Cell · doi:10.1016/j.cell.2021.07.027 · Cited by 78 · see citing works
“The removal of this glycosylation site by mutagenesis resulted in impaired RBD folding, decreased expression, and reduced infectivity (Li et al., 2020; Starr et al., 2020, 2021a), most likely explaining its strict conservation.”
Identification of a novel lineage bat SARS-related coronaviruses that use bat ACE2 receptor
Guo, H., Hu, B., Si, H.-R., Zhu, Y., Zhang, W., Li, B., Li, A., Geng, R., Lin, H.-F., Yang, X.-L., et al. (2021) · Emerging Microbes & Infections · doi:10.1080/22221751.2021.1956373 · Cited by 71 · see citing works
“Primers using for transcription in vitro were: VSV (P protein)-F1: 186 GTTCGTGAGTATCTCAAGTCCT, VSV (P protein)-R2-T7: 187 TAATACGACTCACTATAGGGAGAGCCTTGATTGTCTTCAATTTCTGG, 188 primers using for real-time PCR were described as previously [17].”
MethodGenetic and structural basis for recognition of SARS-CoV-2 spike protein by a two-antibody cocktail
Dong, J., Zost, S. J., Greaney, A. J., Starr, T. N., Dingens, A. S., Chen, E. C., Chen, R. E., Case, J. B., Sutton, R. E., Gilchuk, P., et al. (2021) · doi:10.1101/2021.01.27.428529 · Cited by 55 · see citing works
Coincident rapid expansion of two SARS-CoV-2 lineages with enhanced infectivity in Nigeria
Ozer, E. A., Simons, L. M., Adewumi, O. M., Fowotade, A. A., Omoruyi, E. C., Adeniji, J. A., Dean, T. J., Zayas, J., Bhimalli, P. P., Ash, M. K., et al. (2021) · doi:10.1101/2021.04.09.21255206 · Cited by 34 · see citing works
Graham, C., Seow, J., Huettner, I., Khan, H., Kouphou, N., Acors, S., Winstone, H., Pickering, S., Galao, R. P., Lista, M. J., et al. (2021) · doi:10.1101/2021.02.03.429355 · Cited by 27 · see citing works
de Mattos Barbosa, M. G., Liu, H., Huynh, D., Shelley, G., Keller, E. T., Emmer, B. T., Sherman, E., Ginsburg, D., Kennedy, A. A., Tai, A. W., et al. (2021) · JCI Insight · doi:10.1172/jci.insight.147386 · Cited by 14 · see citing works
Self-citationWang, Q., Nair, M. S., Anang, S., Zhang, S., Nguyen, H., Huang, Y., Liu, L., Ho, D. D., & Sodroski, J. G. (2021) · iScience · doi:10.1016/j.isci.2021.103393 · Cited by 15 · see citing works
Zhang, L., Cui, Z., Li, Q., Yu, Y., Wu, J., Nie, J., Ding, R., Wang, H., Zhang, Y., Liu, S., et al. (2021) · doi:10.21203/rs.3.rs-492659/v1 · Cited by 5 · see citing works
Self-citationPiccoli, L., Park, Y.-J., Tortorici, M. A., Czudnochowski, N., Walls, A. C., Beltramello, M., Silacci-Fregni, C., Pinto, D., Rosen, L. E., Bowen, J. E., et al. (2020) · Cell · doi:10.1016/j.cell.2020.09.037 · Cited by 1,395 · see citing works
- Authors
- Li, Q., Wu, J., Nie, J., Zhang, L., Hao, H., Liu, S., Zhao, C., Zhang, Q., Liu, H., Nie, L., Qin, H., Wang, M., Lu, Q., Li, X., Sun, Q., Liu, J., Zhang, L., Li, X., Huang, W., & Wang, Y.
- Affiliations
- Chinese Academy of Medical Sciences & Peking Union Medical College (CN)
- National Institutes for Food and Drug Control (CN)
- Tsinghua University (CN)
- Health Canada (CA)
- Corresponding author
- Huang, Weijin
- Wang, Youchun
- ORCID
- Venue
- Cell
- Publisher
- Elsevier BV
- Published
- 2020-09
- Volume
- 182
- Issue
- 5
- Pages
- 1284-1294.e9
- ISSN
- 0092-8674 (ISSN-L)
- PMC
- PMC7366990
- OpenAlex
- W3043431476
- Cited by
- 1,420
- References
- 46
- Citations by year
- 2026: 21 · 2025: 47 · 2024: 102 · 2023: 169 · 2022: 367 · 2021: 608 · 2020: 104
- FWCI
- 41.10
- Type
- journal article
- Language
- en
- Open access
- bronze
- doi.org
- Licence
- Locations
- Cell (publishedVersion)
- PubMed Central (publishedVersion)
- PubMed (publishedVersion)
- Funders
- National Major Science and Technology Projects of China
- Topics
- Health Sciences › Medicine › Infectious Diseases › SARS-CoV-2 and COVID-19 Research
- Life Sciences › Agricultural and Biological Sciences › Animal Science and Zoology › Animal Virus Infections Studies
- Life Sciences › Biochemistry, Genetics and Molecular Biology › Molecular Biology › vaccines and immunoinformatics approaches
- Keywords
- SARS-CoV-2, spike protein, spike protein mutations, viral infectivity, neutralizing antibodies, antibody resistance, glycosylation, N-glycosylation sites, receptor binding domain, D614G mutation, convalescent sera
- MeSH terms
- RAW 264.7 Cells, A549 Cells, Betacoronavirus, SARS-CoV-2, Animals, Antigens, Viral, Binding Sites, Cattle, Chlorocebus aethiops, Dogs, Glycosylation, Cricetinae, HeLa Cells, Humans, Macaca mulatta, Mutation, Swine, Vero Cells, Virulence, Mice, HEK293 Cells, Madin Darby Canine Kidney Cells, Spike Glycoprotein, Coronavirus
About these checks
Registry, retraction, Cites and statistics results are computed, not judged, with one exception: a printed reference that no index lists is read once by a model before it counts as a citation error. Claims are extracted by a model and kept only when their quote appears verbatim in the text; each cited source is then checked, with a model’s help, for whether it says what the claim relies on. Those verdicts can be wrong — read the claim’s quote and the cited source before relying on one.
Statistics and arithmetic are recomputed, not judged.
Confidence bands are shown only for fields calibrated on our annotated test set. None is calibrated yet, so no band is shown.
What counts as a claim ›How we measure confidence ›How we check this ›
Are you an author, or do you see a problem with this page? Request a review
