Mechanisms of Increased Resistance to Chlorhexidine and Cross-Resistance to Colistin following Exposure of Klebsiella pneumoniae Clinical Isolates to Chlorhexidine

Wand, Matthew E.; Bock, Lucy J.; Bonney, Laura C.; Sutton, J. Mark

doi:10.1128/aac.01162-16

Cited by 313Antibiotic Resistance in BacteriaBacterial Genetics and BiotechnologyAntimicrobial agents and applications

Mechanisms of Increased Resistance to Chlorhexidine and Cross-Resistance to Colistin following Exposure of Klebsiella pneumoniae Clinical Isolates to Chlorhexidine

Open access

Wand, Matthew E., Bock, Lucy J., Bonney, Laura C., Sutton, J. Mark·2017·Antimicrobial Agents and Chemotherapy

DOI 10.1128/aac.01162-16PMC PMC5192135

Open this paper in CoChat — free account Open PDF

Abstract

Klebsiella pneumoniae is an opportunistic pathogen that is often difficult to treat due to its multidrug resistance (MDR). We have previously shown that K. pneumoniae strains are able to “adapt” (become more resistant) to the widely used bisbiguanide antiseptic chlorhexidine. Here, we investigated the mechanisms responsible for and the phenotypic consequences of chlorhexidine adaptation, with particular reference to antibiotic cross-resistance. In five of six strains, adaptation to chlorhexidine also led to resistance to the last-resort antibiotic colistin. Here, we show that chlorhexidine adaptation is associated with mutations in the two-component regulator phoPQ and a putative Tet repressor gene ( smvR ) adjacent to the major facilitator superfamily (MFS) efflux pump gene, smvA . Upregulation of smvA (10- to 27-fold) was confirmed in smvR mutant strains, and this effect and the associated phenotype were suppressed when a wild-type copy of smvR was introduced on plasmid pACYC. Upregulation of phoPQ (5- to 15-fold) and phoPQ -regulated genes, pmrD (6- to 19-fold) and pmrK (18- to 64-fold), was confirmed in phoPQ mutant strains. In contrast, adaptation of K. pneumoniae to colistin did not result in increased chlorhexidine resistance despite the presence of mutations in phoQ and elevated phoPQ , pmrD , and pmrK transcript levels. Insertion of a plasmid containing phoPQ from chlorhexidine-adapted strains into wild-type K. pneumoniae resulted in elevated expression levels of phoPQ , pmrD , and pmrK and increased resistance to colistin, but not chlorhexidine. The potential risk of colistin resistance emerging in K. pneumoniae as a consequence of exposure to chlorhexidine has important clinical implications for infection prevention procedures.

The claims and statistics of this paper haven’t been checked yet.

Run the check — free, no account needed. It reads the open-access text and checks the sources it cites.

Integrity signals

Registry

Crossref · 10.1128/aac.01162-16

Cites

54 of 54 references verified0 citation errors · 0 not checkable

Statistics

Claims the paper makes

The claims and statistics of this paper haven’t been checked yet.

Run the check — free, no account needed. It reads the open-access text and checks the sources it cites.

Claims other papers make about this one

Each is checked against this paper’s own text: does it say what the citing paper says it does?

AMR has become one of the major threats to human health, emerging and spreading particularly in hospital environments as a result of selective pressures exerted by the widespread use of disinfectants and antibiotics.
“Indeed, AMR has become one of the major threats to human health, emerging and spreading, particularly in hospital environments, as a result of the selective pressures exerted by the widespread use of disinfectants and antibiotics in these settings [16].”
From Profiling the resistome and virulome of Bacillus strains used for probiotic-based sanitation: a multicenter WGS analysis (2025) · cites this paper as [16]
The introduction (page unavailable) describes multidrug-resistant pathogens as a significant health-care challenge and says disinfectants are commonly used in clinical practice. The Discussion (page unavailable) reports that chlorhexidine exposure can produce colistin cross-resistance in clinical K. pneumoniae isolates and notes their increasing prevalence in hospitals. It does not establish the broader claim that widespread disinfectant and antibiotic use drives the emergence and spread of AMR in hospitals generally. (LLM, conf=0.85)
Experimental — accuracy not yet measured

Self-check

Percentages, sums and reported differences re-computed from the paper’s own numbers.

The self-check needs the paper’s full text.

Trimmomatic: a flexible trimmer for Illumina sequence data
Bolger, A. M., Lohse, M., & Usadel, B. (2014) · Bioinformatics · doi:10.1093/bioinformatics/btu170 · Cited by 65,548 · see citing works
The Sequence Alignment/Map format and SAMtools
Li, H., Handsaker, B., Wysoker, A., Fennell, T., Ruan, J., Homer, N., Marth, G., Abecasis, G., Durbin, R., & 1000 Genome Project Data Processing Subgroup (2009) · Bioinformatics · doi:10.1093/bioinformatics/btp352 · Cited by 62,041 · see citing works
Fast and accurate short read alignment with Burrows-Wheeler transform
Li, H., & Durbin, R. (2009) · Bioinformatics · doi:10.1093/bioinformatics/btp324 · Cited by 58,607 · see citing works
The Genome Analysis Toolkit: A MapReduce framework for analyzing next-generation DNA sequencing data
McKenna, A., Hanna, M., Banks, E., Sivachenko, A., Cibulskis, K., Kernytsky, A., Garimella, K., Altshuler, D., Gabriel, S., Daly, M., et al. (2010) · Genome Research · doi:10.1101/gr.107524.110 · Cited by 27,895 · see citing works
SPAdes: A New Genome Assembly Algorithm and Its Applications to Single-Cell Sequencing
Bankevich, A., Nurk, S., Antipov, D., Gurevich, A. A., Dvorkin, M. V., Kulikov, A. S., Lesin, V. M., Nikolenko, S., Pham, S., Prjibelski, A. D., et al. (2012) · Journal of Computational Biology · doi:10.1089/cmb.2012.0021 · Cited by 25,691 · see citing works
Antiseptics and Disinfectants: Activity, Action, and Resistance
McDonnell, G. E., & Russell, A. D. (1999) · Clinical Microbiology Reviews · doi:10.1128/cmr.12.1.147 · Cited by 4,795 · see citing works
The Galaxy platform for accessible, reproducible and collaborative biomedical analyses: 2016 update
Afgan, E., Baker, D., van den Beek, M., Blankenberg, D. J., Bouvier, D., Čech, M., Chilton, J. M., Clements, D., Coraor, N., Eberhard, C., et al. (2016) · Nucleic Acids Research · doi:10.1093/nar/gkw343 · Cited by 2,150 · see citing works
Novel Carbapenem-Hydrolyzing β-Lactamase, KPC-1, from a Carbapenem-Resistant Strain of <i>Klebsiella pneumoniae</i>
Yigit, H., Queenan, A. M., Anderson, G. J., Domenech-Sanchez, A., Biddle, J. W., Steward, C. D., Alberti, S., Bush, K., & Tenover, F. C. (2001) · Antimicrobial Agents and Chemotherapy · doi:10.1128/aac.45.4.1151-1161.2001 · Cited by 1,639 · see citing works
Mechanisms of polymyxin resistance: acquired and intrinsic resistance in bacteria
Olaitan, A. O., Morand, S., & Rolain, J. (2014) · Frontiers in Microbiology · doi:10.3389/fmicb.2014.00643 · Cited by 1,403 · see citing works
Lipid A Modification Systems in Gram-Negative Bacteria
Raetz, C. R. H., Reynolds, C. M., Trent, M. S., & Bishop, R. E. (2007) · Annual Review of Biochemistry · doi:10.1146/annurev.biochem.76.010307.145803 · Cited by 1,336 · see citing works
Cationic antiseptics: diversity of action under a common epithet
Gilbert, P., & Moore, L. E. (2005) · Journal of Applied Microbiology · doi:10.1111/j.1365-2672.2005.02664.x · Cited by 1,168 · see citing works
Compensatory Mutations, Antibiotic Resistance and the Population Genetics of Adaptive Evolution in Bacteria
Levin, B. R., Perrot, V., & Walker, N. (2000) · Genetics · doi:10.1093/genetics/154.3.985 · Cited by 636 · see citing works
Macrolide Resistance Conferred by Base Substitutions in 23S rRNA
Vester, B., & Douthwaite, S. R. (2001) · Antimicrobial Agents and Chemotherapy · doi:10.1128/aac.45.1.1-12.2001 · Cited by 562 · see citing works
PhoP-PhoQ activates transcription of pmrAB, encoding a two-component regulatory system involved in Salmonella typhimurium antimicrobial peptide resistance
Gunn, J. S., & Miller, S. I. (1996) · Journal of Bacteriology · doi:10.1128/jb.178.23.6857-6864.1996 · Cited by 401 · see citing works
Antibiotic Treatment of Infections Due to Carbapenem-Resistant Enterobacteriaceae: Systematic Evaluation of the Available Evidence
Falagas, M. E., Lourida, P., Poulikakos, P., et al. (2013) · Antimicrobial Agents and Chemotherapy · doi:10.1128/aac.01222-13 · Cited by 351 · see citing works
A novel DNA-binding motif in MarA: The first structure for an AraC family transcriptional activator
Rhee, S., Martin, R. G., Rosner, J. L., & Davies, D. R. (1998) · Proceedings of the National Academy of Sciences · doi:10.1073/pnas.95.18.10413 · Cited by 299 · see citing works
Worldwide emergence of colistin resistance in Klebsiella pneumoniae from healthy humans and patients in Lao PDR, Thailand, Israel, Nigeria and France owing to inactivation of the PhoP/PhoQ regulator mgrB: an epidemiological and molecular study
Olaitan, A. O., Diene, S. M., Kempf, M., Berrazeg, M., Bakour, S., Gupta, S. K., Thongmalayvong, B., Akkhavong, K., Somphavong, S., Paboriboune, P., et al. (2014) · International Journal of Antimicrobial Agents · doi:10.1016/j.ijantimicag.2014.07.020 · Cited by 292 · see citing works
Regulation of polymyxin resistance and adaptation to low-Mg2+ environments
Groisman, E. A., Kayser, J., & Soncini, F. C. (1997) · Journal of Bacteriology · doi:10.1128/jb.179.22.7040-7045.1997 · Cited by 283 · see citing works
Carbapenemase-producing Enterobacteriaceae: Overview of a major public health challenge
Nordmann, P. (2013) · Médecine et Maladies Infectieuses · doi:10.1016/j.medmal.2013.11.007 · Cited by 280 · see citing works
Carbapenemase-Producing Enterobacteriaceae
Paterson, D. L., & Doi, Y. (2015) · Seminars in Respiratory and Critical Care Medicine · doi:10.1055/s-0035-1544208 · Cited by 257 · see citing works
Modeling Klebsiella pneumoniae Pathogenesis by Infection of the Wax Moth Galleria mellonella
Insua, J. L., Llobet, E., Moranta, D., et al. (2013) · Infection and Immunity · doi:10.1128/iai.00391-13 · Cited by 234 · see citing works
Genomic and Transcriptomic Analyses of Colistin-Resistant Clinical Isolates of Klebsiella pneumoniae Reveal Multiple Pathways of Resistance
Wright, M. S., Suzuki, Y., Jones, M. B., Marshall, S. H., Rudin, S. D., van Duin, D., Kaye, K. S., Jacobs, M. R., Bonomo, R. A., & Adams, M. D. (2014) · Antimicrobial Agents and Chemotherapy · doi:10.1128/aac.04037-14 · Cited by 217 · see citing works
Heteroresistance to Colistin in Klebsiella pneumoniae Associated with Alterations in the PhoPQ Regulatory System
Jayol, A., Nordmann, P., Brink, A. J., & Poirel, L. (2015) · Antimicrobial Agents and Chemotherapy · doi:10.1128/aac.05055-14 · Cited by 202 · see citing works
QacR Is a Repressor Protein That Regulates Expression of theStaphylococcus aureus Multidrug Efflux Pump QacA
Grkovic, S., Brown, M. H., Roberts, N., Paulsen, I. T., & Skurray, R. A. (1998) · Journal of Biological Chemistry · doi:10.1074/jbc.273.29.18665 · Cited by 187 · see citing works
Prevention of Colonization and Infection by Klebsiella pneumoniae Carbapenemase-Producing Enterobacteriaceae in Long-term Acute-Care Hospitals
Hayden, M. K., Lin, M. Y., Lolans, K., Weiner, S., Blom, D. W., Moore, N. M., Fogg, L., Henry, D., Lyles, R. D., Thurlow, C., et al. (2014) · Clinical Infectious Diseases · doi:10.1093/cid/ciu1173 · Cited by 184 · see citing works
The effect of chlorhexidine on the electrophoretic mobility, cytoplasmic constituents, dehydrogenase activity and cell walls of Escherichia coli and Staphylococcus aureus
Hugo, W. B., & Longworth, A. R. (1966) · Journal of Pharmacy and Pharmacology · doi:10.1111/j.2042-7158.1966.tb07935.x · Cited by 183 · see citing works
Molecular characterization of the PhoPQ-PmrD-PmrAB mediated pathway regulating polymyxin B resistance in Klebsiella pneumoniae CG43
Cheng, H.-Y., Chen, Y., & Peng, H. (2010) · Journal of Biomedical Science · doi:10.1186/1423-0127-17-60 · Cited by 166 · see citing works
The mode of action of chlorhexidine
Davies, A. (1973) · Journal of Periodontal Research · doi:10.1111/j.1600-0765.1973.tb02167.x · Cited by 166 · see citing works
PhoPQ regulates acidic glycerophospholipid content of the Salmonella Typhimurium outer membrane
Dalebroux, Z. D., Matamouros, S., Whittington, D., Bishop, R. E., & Miller, S. I. (2014) · Proceedings of the National Academy of Sciences · doi:10.1073/pnas.1316901111 · Cited by 162 · see citing works
The application of Tet repressor in prokaryotic gene regulation and expression
Bertram, R., & Hillen, W. (2008) · Microbial Biotechnology · doi:10.1111/j.1751-7915.2007.00001.x · Cited by 160 · see citing works
Parallel evolutionary pathways to antibiotic resistance selected by biocide exposure
Webber, M. A., Whitehead, R. N., Mount, M., Loman, N. J., Pallen, M. J., & Piddock, L. J. V. (2015) · Journal of Antimicrobial Chemotherapy · doi:10.1093/jac/dkv109 · Cited by 155 · see citing works
Macrophage and Galleria mellonella infection models reflect the virulence of naturally occurring isolates of B. pseudomallei, B. thailandensis and B. oklahomensis
Wand, M. E., Müller, C., Titball, R. W., et al. (2011) · BMC Microbiology · doi:10.1186/1471-2180-11-11 · Cited by 133 · see citing works
Self-citation
[Antiseptics and disinfectants].
Garzón Martínez, P. (1987) · PubMed · Cited by 133 · see citing works
Effects of Efflux Pump Inhibitors on Colistin Resistance in Multidrug-Resistant Gram-Negative Bacteria
Ni, W., Li, Y., Guan, J., et al. (2016) · Antimicrobial Agents and Chemotherapy · doi:10.1128/aac.00248-16 · Cited by 129 · see citing works
NemR Is a Bleach-sensing Transcription Factor
Gray, M. J., Wholey, W.-Y., Parker, B. W., Kim, M., & Jakob, U. (2013) · Journal of Biological Chemistry · doi:10.1074/jbc.m113.454421 · Cited by 114 · see citing works
Loss of Hypermucoviscosity and Increased Fitness Cost in Colistin-Resistant Klebsiella pneumoniae Sequence Type 23 Strains
Choi, M., & Ko, K. S. (2015) · Antimicrobial Agents and Chemotherapy · doi:10.1128/aac.00952-15 · Cited by 113 · see citing works
PmrD Is Required for Modifications to Escherichia coli Endotoxin That Promote Antimicrobial Resistance
Rubin, E. J., Herrera, C. M., Crofts, A. A., & Trent, M. S. (2015) · Antimicrobial Agents and Chemotherapy · doi:10.1128/aac.05052-14 · Cited by 112 · see citing works
Deciphering tissue-induced Klebsiella pneumoniae lipid A structure
Llobet, E., Martínez-Moliner, V., Moranta, D., Dahlström, K. M., Regueiro, V., Tomás, A., Cano, V., Pérez-Gutiérrez, C., Frank, C. G., Fernández‐Carrasco, H., et al. (2015) · Proceedings of the National Academy of Sciences · doi:10.1073/pnas.1508820112 · Cited by 107 · see citing works
Outbreak of Klebsiella pneumoniae carbapenemase–producing K pneumoniae: A systematic review
Campos, A. C., Albiero, J., Ecker, A. B. D. S., Kuroda, C. M., Meirelles, L. E. D. F., Polato, A., Tognim, M. C. B., Wingeter, M. A., & Teixeira, J. J. V. (2016) · American Journal of Infection Control · doi:10.1016/j.ajic.2016.03.022 · Cited by 96 · see citing works
Molecular analysis and nucleotide sequence of the envCD operon of Escherichia coli
Klein, J. R., Henrich, B., & Plapp, R. (1991) · Molecular and General Genetics MGG · doi:10.1007/bf00290673 · Cited by 85 · see citing works
The Salmonella enterica sv. Typhimurium smvA, yddG and ompD (porin) genes are required for the efficient efflux of methyl viologen
Santiviago, C. A., Fuentes, J. A., Bueno, S. M., Trombert, A. N., Hildago, A. A., Socias, L. T., Youderian, P. A., & Mora, G. C. (2002) · Molecular Microbiology · doi:10.1046/j.1365-2958.2002.03204.x · Cited by 80 · see citing works
Characterization of Pre-Antibiotic Era Klebsiella pneumoniae Isolates with Respect to Antibiotic/Disinfectant Susceptibility and Virulence in Galleria mellonella
Wand, M. E., Baker, K. S., Benthall, G., et al. (2015) · Antimicrobial Agents and Chemotherapy · doi:10.1128/aac.05009-14 · Cited by 74 · see citing works
Self-citation
The metabolically active subpopulation inPseudomonas aeruginosabiofilms survives exposure to membrane-targeting antimicrobials via distinct molecular mechanisms
Chiang, W., Pamp, S. J., Nilsson, M., et al. (2012) · FEMS Immunology & Medical Microbiology · doi:10.1111/j.1574-695x.2012.00929.x · Cited by 71 · see citing works
The Pseudomonas aeruginosa PhoP-PhoQ Two-Component Regulatory System Is Induced upon Interaction with Epithelial Cells and Controls Cytotoxicity and Inflammation
Gellatly, S. L., Needham, B. D., Madera, L., Trent, M. S., & Hancock, R. E. W. (2012) · Infection and Immunity · doi:10.1128/iai.00382-12 · Cited by 70 · see citing works
Varying activity of chlorhexidine-based disinfectants against Klebsiella pneumoniae clinical isolates and adapted strains
Bock, L. J., Wand, M. E., & Sutton, J. M. (2016) · Journal of Hospital Infection · doi:10.1016/j.jhin.2015.12.019 · Cited by 70 · see citing works
Self-citation
Evaluation of antibiotic efficacy against infections caused by planktonic or biofilm cultures of Pseudomonas aeruginosa and Klebsiella pneumoniae in Galleria mellonella
Benthall, G., Touzel, R. E., Hind, C. K., et al. (2015) · International Journal of Antimicrobial Agents · doi:10.1016/j.ijantimicag.2015.07.014 · Cited by 66 · see citing works
Self-citation
Effect of carbonyl cyanide 3-chlorophenylhydrazone (CCCP) on killing Acinetobacter baumannii by colistin
Park, Y. K., & Ko, K. S. (2015) · The Journal of Microbiology · doi:10.1007/s12275-015-4498-5 · Cited by 64 · see citing works
Elucidating the Regulon of Multidrug Resistance Regulator RarA in Klebsiella pneumoniae
Majumdar, S. D., Veleba, M., Finn, S., et al. (2013) · Antimicrobial Agents and Chemotherapy · doi:10.1128/aac.01998-12 · Cited by 63 · see citing works
Polymorphic Variation in Susceptibility and Metabolism of Triclosan-Resistant Mutants of Escherichia coli and Klebsiella pneumoniae Clinical Strains Obtained after Exposure to Biocides and Antibiotics
Curião, T., Marchi, E., Viti, C., Oggioni, M. R., Baquero, F., Martínez, J. L., & Coque, T. M. (2015) · Antimicrobial Agents and Chemotherapy · doi:10.1128/aac.00187-15 · Cited by 59 · see citing works
Insusceptibility to disinfectants in bacteria from animals, food and humans—is there a link to antimicrobial resistance?
Schwaiger, K., Harms, K., Bischoff, M., Preikschat, P., Mölle, G., Bauer-Unkauf, I., Lindorfer, S., Thalhammer, S., Bauer, J., & Hölzel, C. S. (2014) · Frontiers in Microbiology · doi:10.3389/fmicb.2014.00088 · Cited by 59 · see citing works
Triclosan Can Select for an AdeIJK-Overexpressing Mutant of Acinetobacter baumannii ATCC 17978 That Displays Reduced Susceptibility to Multiple Antibiotics
Fernando, D. M., Xu, W. W., Loewen, P. C., Zhanel, G. G., & Kumar, A. (2014) · Antimicrobial Agents and Chemotherapy · doi:10.1128/aac.03074-14 · Cited by 54 · see citing works
SmvA, and not AcrB, is the major efflux pump for acriflavine and related compounds in Salmonella enterica serovar Typhimurium
Villagra, N. A., Hidalgo, A. A., Santiviago, C. A., et al. (2008) · Journal of Antimicrobial Chemotherapy · doi:10.1093/jac/dkn407 · Cited by 47 · see citing works
Differential Expression of Two-Component Systems, pmrAB and phoPQ, with Different Growth phases of Klebsiella pneumoniae in the Presence or Absence of Colistin
Kim, S. Y., Choi, H. J., & Ko, K. S. (2014) · Current Microbiology · doi:10.1007/s00284-014-0549-0 · Cited by 26 · see citing works
A novel peptidoglycan D , L ‐endopeptidase induced by S almonella inside eukaryotic cells contributes to virulence
Rico‐Pérez, G., Pezza, A., Pucciarelli, M. G., de Pedro, M. A., Soncini, F. C., & del Portillo, F. G. (2015) · Molecular Microbiology · doi:10.1111/mmi.13248 · Cited by 26 · see citing works

Flagged first, then by citations

Sorted by citations

Antibiotics and common antibacterial biocides stimulate horizontal transfer of resistance at low concentrations
Jutkina, J., Marathe, N. P., Flach, C.-F., & Larsson, D. G. J. (2018) · Science of The Total Environment · doi:10.1016/j.scitotenv.2017.10.312 · Cited by 355 · see citing works
Resistance Toward Chlorhexidine in Oral Bacteria – Is There Cause for Concern?
Cieplik, F., Jakubovics, N. S., Buchalla, W., Maisch, T., Hellwig, E., & Al-Ahmad, A. (2019) · Frontiers in Microbiology · doi:10.3389/fmicb.2019.00587 · Cited by 424 · see citing works
Co-selection for antibiotic resistance by environmental contaminants
Murray, L. M., Hayes, A., Snape, J., Kasprzyk‐Hordern, B., Gaze, W. H., & Murray, A. K. (2024) · npj Antimicrobials and Resistance · doi:10.1038/s44259-024-00026-7 · Cited by 334 · see citing works
Accelerated spread of antibiotic resistance genes (ARGs) induced by non-antibiotic conditions: Roles and mechanisms
Shi, X., Xia, Y., Wei, W., & Ni, B. (2022) · Water Research · doi:10.1016/j.watres.2022.119060 · Cited by 292 · see citing works
Disinfectants and antiseptics: mechanisms of action and resistance
Maillard, J., & Pascoe, M. (2023) · Nature Reviews Microbiology · doi:10.1038/s41579-023-00958-3 · Cited by 287 · see citing works
“These include analysing the effects of biocides on membrane integrity of live cells or vesicles and liposomes through the use of microscopy, the uptake of substrates (for example, fluorescent dyes or particles) and the leakage of cellular components (for example,”
Background
The Potential of Human Peptide LL-37 as an Antimicrobial and Anti-Biofilm Agent
Ridyard, K. E., & Overhage, J. (2021) · Antibiotics · doi:10.3390/antibiotics10060650 · Cited by 273 · see citing works
“To kill bacteria, chlorhexidine targets membrane fluidity, which results in the loss of structural integrity of the membrane [96].”
Background
Biocidal Agents Used for Disinfection Can Enhance Antibiotic Resistance in Gram-Negative Species
Kampf, G. (2018) · Antibiotics · doi:10.3390/antibiotics7040110 · Cited by 230 · see citing works
Povidone Iodine: Properties, Mechanisms of Action, and Role in Infection Control and Staphylococcus aureus Decolonization
Lepelletier, D., Maillard, J., Pozzetto, B., & Simon, A. (2020) · Antimicrobial Agents and Chemotherapy · doi:10.1128/aac.00682-20 · Cited by 219 · see citing works
“59% when introduced into decolonization protocol in orthopedic surgery (93) ● One study found that in mupirocin-resistant MRSA, the rate of qacA/B gene was 65% and smr gene was 71% (83) ● Reports of cross-resistance to antibiotics (92) ● No significant difference in incidence of SSI between topical 2% CHG (36 [0.”
Background
Disinfection spreads antimicrobial resistance
Lu, J., & Guo, J. (2021) · Science · doi:10.1126/science.abg4380 · Cited by 195 · see citing works
Infectious Disease Management and Control with Povidone Iodine
Eggers, M. (2019) · Infectious Diseases and Therapy · doi:10.1007/s40121-019-00260-x · Cited by 170 · see citing works
Relationships Between Oral Microecosystem and Respiratory Diseases
Dong, J., Li, W., Wang, Q., Chen, J., Zu, Y., Zhou, X., & Guo, Q. (2022) · Frontiers in Molecular Biosciences · doi:10.3389/fmolb.2021.718222 · Cited by 151 · see citing works
Reduced Susceptibility and Increased Resistance of Bacteria against Disinfectants: A Systematic Review
Rozman, U., Pušnik, M., Kmetec, S., Duh, D., & Turk, S. Š. (2021) · Microorganisms · doi:10.3390/microorganisms9122550 · Cited by 150 · see citing works
Food processing as a risk factor for antimicrobial resistance spread along the food chain
Alexa, E. A., Likotrafiti, E., Álvarez-Molina, A., et al. (2018) · Current Opinion in Food Science · doi:10.1016/j.cofs.2018.09.002 · Cited by 136 · see citing works
“[38] Klebsiella pneumoniae Chlorhexidine Colistin Serial inoculation (up to 6 passages) in the presence of the biocide.”
Background
Antimicrobial resistance in healthcare, agriculture and the environment: the biochemistry behind the headlines
Venter, H., Henningsen, M. L., & Neville, S. L. (2017) · Essays in Biochemistry · doi:10.1042/ebc20160053 · Cited by 129 · see citing works
Reduced Chlorhexidine and Daptomycin Susceptibility in Vancomycin-Resistant Enterococcus faecium after Serial Chlorhexidine Exposure
Bhardwaj, P., Hans, A., Ruikar, K., Guan, Z., & Palmer, K. L. (2017) · Antimicrobial Agents and Chemotherapy · doi:10.1128/aac.01235-17 · Cited by 118 · see citing works
“It was recently reported that 69 colistin resistance emerged in the Gram-negative pathogen Klebsiella pneumoniae after 70 exposure to CHX (23).”
Background
Biocide-Induced Emergence of Antibiotic Resistance in Escherichia coli
Pereira, B. M. P., Wang, X., & Tagkopoulos, I. (2021) · Frontiers in Microbiology · doi:10.3389/fmicb.2021.640923 · Cited by 120 · see citing works
Better together– Salmonella biofilm-associated antibiotic resistance
Aleksandrowicz, A., Carolak, E., Dutkiewicz, A., Błachut, A., Waszczuk, W., & Grzymajło, K. (2023) · Gut Microbes · doi:10.1080/19490976.2023.2229937 · Cited by 116 · see citing works
“Salmonella, it was demonstrated that chlorhexidine resulted in significantly higher transcript levels of narU (5-fold).(108) During nutritional deprivation or extremely slow growth, NarU, which is abundant in the stationary phase, confers a selection advantage.”
Background
Addressing the challenges in antisepsis: focus on povidone iodine
Barreto, R. T., Barrois, B., Lambert, J. R., et al. (2020) · International Journal of Antimicrobial Agents · doi:10.1016/j.ijantimicag.2020.106064 · Cited by 110 · see citing works
Efflux Pump-Driven Antibiotic and Biocide Cross-Resistance in Pseudomonas aeruginosa Isolated from Different Ecological Niches: A Case Study in the Development of Multidrug Resistance in Environmental Hotspots
Amsalu, A., Sapula, S. A., Lopes, M. D. B., Hart, B. J., Nguyen, A. H., Drigo, B., Turnidge, J. D., Leong, L. E. X., & Venter, H. (2020) · Microorganisms · doi:10.3390/microorganisms8111647 · Cited by 112 · see citing works
“Biocides are also frequently used in mass-marketed household products, which could lead to the development of resistance and have severe consequences for their clinical usefulness [75,76]”
Background
Reducing healthcare-associated infections incidence by a probiotic-based sanitation system: A multicentre, prospective, intervention study
Caselli, E., Brusaferro, S., Coccagna, M., Arnoldo, L., Berloco, F., Antonioli, P., Tarricone, R., Pelissero, G., Nola, S., La Fauci, V., et al. (2018) · PLOS ONE · doi:10.1371/journal.pone.0199616 · Cited by 101 · see citing works
“Control of surface contamination has been so far approached by conventional chemical-based sanitation, which has limitations, as it cannot prevent recontamination phenomena [16–19], has an high environmental impact, and can contribute to selection of disinfectant-resistant and even antibiotic-resistant pathogens [20,…”
Background
MCR: modern colistin resistance
Caniaux, I., van Belkum, A., Zambardi, G., et al. (2016) · European Journal of Clinical Microbiology & Infectious Diseases · doi:10.1007/s10096-016-2846-y · Cited by 98 · see citing works
The Activity of Isoquinoline Alkaloids and Extracts from Chelidonium majus against Pathogenic Bacteria and Candida sp.
Zielińska, S., Wójciak, M., Dziągwa-Becker, M., et al. (2019) · Toxins · doi:10.3390/toxins11070406 · Cited by 93 · see citing works
“An increased resistance to chlorhexidine antiseptic and cross-resistance to colistin antibiotic following exposure to chlorhexidine in Klebsiella pneumoniae is one of the most studied examples of such a phenomenon [32].”
Background
Antibiotic Heteroresistance in Klebsiella pneumoniae
Stojowska‐Swędrzyńska, K., Łupkowska, A., Kuczyńska‐Wiśnik, D., & Laskowska, E. (2021) · International Journal of Molecular Sciences · doi:10.3390/ijms23010449 · Cited by 82 · see citing works
Fighting AMR in the Healthcare Environment: Microbiome-Based Sanitation Approaches and Monitoring Tools
D’Accolti, M., Soffritti, I., Mazzacane, S., & Caselli, E. (2019) · International Journal of Molecular Sciences · doi:10.3390/ijms20071535 · Cited by 82 · see citing works
“Selected strains can become resistant not only toward the disinfectant itself but also, more importantly, against antimicrobial drugs, as recently reported for the disinfectant chlorhexidine, capable of inducing resistance against the antibiotic colistin [25].”
Background
Development of antiseptic adaptation and cross-adapatation in selected oral pathogens in vitro
Verspecht, T., Herrero, E. R., Khodaparast, L., Khodaparast, L., Boon, N., Bernaerts, K., Quirynen, M., & Teughels, W. (2019) · Scientific Reports · doi:10.1038/s41598-019-44822-y · Cited by 81 · see citing works
Colistin resistance in Parisian inpatient faecal Escherichia coli as the result of two distinct evolutionary pathways
Bourrel, A. S., Poirel, L., Royer, G., Mercier-Darty, M., Vuillemin, X., Kieffer, N., Clermont, O., Denamur, É., Nordmann, P., Decousser, J., et al. (2019) · Journal of Antimicrobial Chemotherapy · doi:10.1093/jac/dkz090 · Cited by 78 · see citing works
Mouthwash Effects on the Oral Microbiome: Are They Good, Bad, or Balanced?
Brookes, Z. L. S., Teoh, L., Cieplik, F., & Kumar, P. (2023) · International Dental Journal · doi:10.1016/j.identj.2023.08.010 · Cited by 90 · see citing works
“> Wand et al 89 showed that isolates of the opportunistic pathogen Klebsiella pneumoniae can develop resistance to chlorhexidine through sharing mechanisms that correlate with colistin resistance, the last-resort antibiotic, as well as vancomycin.”
Background
Bacteriophages as a Potential 360-Degree Pathogen Control Strategy
D’Accolti, M., Soffritti, I., Mazzacane, S., & Caselli, E. (2021) · Microorganisms · doi:10.3390/microorganisms9020261 · Cited by 75 · see citing works
“Importantly, phages could also target MDR bacteria, which are also often resistant to disinfectants [49,100].”
Background
Antimicrobials and Food-Related Stresses as Selective Factors for Antibiotic Resistance along the Farm to Fork Continuum
Giacometti, F., Shirzad‐Aski, H., & Ferreira, S. M. P. (2021) · Antibiotics · doi:10.3390/antibiotics10060671 · Cited by 77 · see citing works
“In contrast, LPS-related changes in phageresistant mutants may reduce the expression of OmpF, tetracycline’ uptake porin, and lead to negative consequences in pathogenic bacterial populations by increasing tetracycline resistance [131,144].”
BackgroundInfluential
Augmented dissemination of antibiotic resistance elicited by non-antibiotic factors
Zhu, S., Yang, B., Wang, Z., & Liu, Y. (2023) · Ecotoxicology and Environmental Safety · doi:10.1016/j.ecoenv.2023.115124 · Cited by 76 · see citing works
Biocide-Tolerant Listeria monocytogenes Isolates from German Food Production Plants Do Not Show Cross-Resistance to Clinically Relevant Antibiotics
Roedel, A., Dieckmann, R., Brendebach, H., et al. (2019) · Applied and Environmental Microbiology · doi:10.1128/aem.01253-19 · Cited by 75 · see citing works
Chlorhexidine Resistance or Cross-Resistance, That Is the Question
Abbood, H. M., Hijazi, K., & Gould, I. M. (2023) · Antibiotics · doi:10.3390/antibiotics12050798 · Cited by 72 · see citing works
“pneumoniae, there have been reports of cross-resistance between CHX and colistin used for the treatment of carbapenem-resistant infections [89,92].”
Background
Biocide Selective TolC-Independent Efflux Pumps in Enterobacteriaceae
Slipski, C. J., Zhanel, G. G., & Bay, D. C. (2017) · The Journal of Membrane Biology · doi:10.1007/s00232-017-9992-8 · Cited by 72 · see citing works
“…Enterobacteriaceae is particularly concerning, since biocide resistance has demonstrated cross-resistance to a variety of antimicrobials (Chapman 2003b; Braoudaki and Hilton 2004; Gnanadhas et al. 2013), including polymyxins (Wand et al. 2017), which may represent a last line of defense.”
Background
Hygiene: microbial strategies to reduce pathogens and drug resistance in clinical settings
Caselli, E. (2017) · Microbial Biotechnology · doi:10.1111/1751-7915.12755 · Cited by 71 · see citing works
“tance against Colistin (Wand et al., 2017), an antibiotic considered till 2016 as a last-resort drug for treatment of infections sustained by multidrug-resistant (MDR) Gram-”
BackgroundInfluential
Distribution of biocide resistant genes and biocides susceptibility in multidrug-resistant Klebsiella pneumoniae, Pseudomonas aeruginosa and Acinetobacter baumannii — A first report from the Kingdom of Saudi Arabia
Vijayakumar, R., Sandle, T., Al-Aboody, M. S., AlFonaisan, M. K., Alturaiki, W., Mickymaray, S., Premanathan, M., & Alsagaby, S. A. (2018) · Journal of Infection and Public Health · doi:10.1016/j.jiph.2018.05.011 · Cited by 71 · see citing works
Temperature Stability and Effectiveness of Plasma-Activated Liquids over an 18 Months Period
Tsoukou, E., Bourke, P., & Boehm, D. (2020) · Water · doi:10.3390/w12113021 · Cited by 68 · see citing works
Colistin Resistance and Management of Drug Resistant Infections
Sharma, J., Sharma, D., Singh, A., & Kumari, S. (2022) · Canadian Journal of Infectious Diseases and Medical Microbiology · doi:10.1155/2022/4315030 · Cited by 68 · see citing works
“, colistin/polymyxins due to the emergence and rapid spread of particular strains of carbapenemase-producing bacteria [2].”
Background
Biocides as drivers of antibiotic resistance: A critical review of environmental implications and public health risks
Sousa, M., Machado, I., Simões, L. C., & Simões, M. V. (2025) · Environmental Science and Ecotechnology · doi:10.1016/j.ese.2025.100557 · Cited by 69 · see citing works
“A study by Wand et al. [101] demonstrated that, when exposed to chlorhexidine, Klebsiella pneumoniae acquired cross-resistance to the antibiotic colistin.”
Multihospital Occurrence of Pan-Resistant Klebsiella pneumoniae Sequence Type 147 with an IS Ecp1 -Directed bla OXA-181 Insertion in the mgrB Gene in the United Arab Emirates
Sonnevend, Á., Ghazawi, A., Hashmey, R., et al. (2017) · Antimicrobial Agents and Chemotherapy · doi:10.1128/aac.00418-17 · Cited by 63 · see citing works
“pneumoniae isolates, and the level of chlorhexidine nonsusceptibility did not reach the levels noted in that study (21).”
Background
Topical Antiseptic Formulations for Skin and Soft Tissue Infections
Hoang, T. P. N., Ghori, M. U., & Conway, B. R. (2021) · Pharmaceutics · doi:10.3390/pharmaceutics13040558 · Cited by 60 · see citing works
Antibiofilm effect of chlorhexidine-carrier nanosystem based on iron oxide magnetic nanoparticles and chitosan
Vieira, A. P. M., Arias, L. S., Neto, F. N. D. S., et al. (2018) · Colloids and Surfaces B Biointerfaces · doi:10.1016/j.colsurfb.2018.11.023 · Cited by 58 · see citing works
Cluster-Randomized Trial of Devices to Prevent Catheter-Related Bloodstream Infection
Brunelli, S. M., Wyck, D. B. V., Njord, L., et al. (2018) · Journal of the American Society of Nephrology · doi:10.1681/asn.2017080870 · Cited by 57 · see citing works
“34 per 1000 CVC-days in ClearGuard versus Liu meta-analysis, respectively), but with several advantages: (1) ClearGuard antimicrobial is confined proximally to the CVC clamp, thus being prevented from entering the bloodstream as occurs with antimicrobial lock solutions18,19; (2) ClearGuard dose is fixed, thus eliminat…”
BackgroundResultInfluential
Proteomic Analysis of Resistance of Gram-Negative Bacteria to Chlorhexidine and Impacts on Susceptibility to Colistin, Antimicrobial Peptides, and Ceragenins
Hashemi, M., Holden, B., Coburn, J., Taylor, M., Weber, S., Hilton, B., Zaugg, A. L., McEwan, C. M., Carson, R. H., Andersen, J. L., et al. (2019) · Frontiers in Microbiology · doi:10.3389/fmicb.2019.00210 · Cited by 57 · see citing works
“Additionally, recent studies found that various clinical isolates of Klebsiella pneumoniae, from before and after the widespread use of chlorhexidine, show a significant difference in susceptibility to the antimicrobial (Bock et al., 2016; Wand et al., 2017).”
Background
High prevalence of mgrB-mediated colistin resistance among carbapenem-resistant Klebsiella pneumoniae is associated with biofilm formation, and can be overcome by colistin-EDTA combination therapy
Shein, A. M. S., Wannigama, D. L., Higgins, P. G., Hurst, C. P., Abe, S., Hongsing, P., Chantaravisoot, N., Saethang, T., Luk-in, S., Liao, T., et al. (2022) · Scientific Reports · doi:10.1038/s41598-022-17083-5 · Cited by 57 · see citing works
Exploring the Hospital Microbiome by High-Resolution 16S rRNA Profiling
Rampelotto, P. H., Sereia, A. F. R., de Oliveira, L. F. V., & Margis, R. (2019) · International Journal of Molecular Sciences · doi:10.3390/ijms20123099 · Cited by 56 · see citing works
“In addition, disinfectants can select resistant bacterial strains against themselves and also against antibiotics [42], which has been recently reported for chlorhexidine induction of resistance against Colistin [43], an antibiotic considered, until 2016, as a last-resort drug for treatment of infections sustained by…”
Background
In Vitro Efficacy of Bacterial Cellulose Dressings Chemisorbed with Antiseptics against Biofilm Formed by Pathogens Isolated from Chronic Wounds
Dydak, K., Junka, A., Dydak, A., et al. (2021) · International Journal of Molecular Sciences · doi:10.3390/ijms22083996 · Cited by 56 · see citing works
Comparative analysis of surface sanitization protocols on the bacterial community structures in the hospital environment
Klassert, T. E., Zubiría-Barrera, C., Neubert, R., Stock, M., Schneegans, A., López, M., Driesch, D., Zakonsky, G., Gastmeier, P., Slevogt, H., et al. (2022) · Clinical Microbiology and Infection · doi:10.1016/j.cmi.2022.02.032 · Cited by 52 · see citing works
Spread of mcr-1–Driven Colistin Resistance on Hospital Surfaces, Italy
Caselli, E., D’Accolti, M., Soffritti, I., Piffanelli, M., & Mazzacane, S. (2018) · Emerging infectious diseases · doi:10.3201/eid2409.171386 · Cited by 51 · see citing works
Efficient removal of hospital pathogens from hard surfaces by a combined use of bacteriophages and probiotics: potential as sanitizing agents
D’Accolti, M., Soffritti, I., Piffanelli, M., Bisi, M., Mazzacane, S., & Caselli, E. (2018) · Infection and Drug Resistance · doi:10.2147/idr.s170071 · Cited by 49 · see citing works
“20,21 This last aspect, in particular, represents a highly undesirable side effect of chemical cleaning, as MDR pathogens have been constantly and rapidly growing in the recent decades and a high proportion of HAIs is currently sustained by them.”
Background
Growth media and assay plate material can impact on the effectiveness of cationic biocides and antibiotics against different bacterial species
Bock, L. J., Hind, C. K., Sutton, J. M., & Wand, M. E. (2018) · Letters in Applied Microbiology · doi:10.1111/lam.12863 · Cited by 50 · see citing works
“2016) and that this adaptation may lead to increased resistance to antibiotics (Bhardwaj et al. 2016; Buffet-Bataillon et al. 2016; Vijayakumar et al. 2016b; Wand et al. 2017).”
BackgroundSelf-citation
SmvA is an important efflux pump for cationic biocides in Klebsiella pneumoniae and other Enterobacteriaceae
Wand, M. E., Jamshidi, S., Bock, L. J., et al. (2019) · Scientific Reports · doi:10.1038/s41598-018-37730-0 · Cited by 50 · see citing works
Self-citation
Increasing usage of chlorhexidine in health care settings: blessing or curse? A narrative review of the risk of chlorhexidine resistance and the implications for infection prevention and control
den Poel, B. V., Saegeman, V., & Schuermans, A. (2022) · European Journal of Clinical Microbiology & Infectious Diseases · doi:10.1007/s10096-022-04403-w · Cited by 48 · see citing works
“pneumoniae isolates to CHG exposure led to an increase of MIC values for colistin from 2 to 4 mg/L to > 64 mg/L [27].”
Background
Biofilms as protective cocoons against biocides: from bacterial adaptation to One Health issues
Charron, R., Boulanger, M., Briandet, R., & Bridier, A. (2023) · Microbiology · doi:10.1099/mic.0.001340 · Cited by 48 · see citing works
Heritable nanosilver resistance in priority pathogen: a unique genetic adaptation and comparison with ionic silver and antibiotics
Valentin, E., Bottomley, A. L., Chilambi, G. S., Harry, E. J., Amal, R., Sotiriou, G. A., Rice, S. A., & Gunawan, C. (2019) · Nanoscale · doi:10.1039/c9nr08424j · Cited by 48 · see citing works
Has resistance to chlorhexidine increased among clinically-relevant bacteria? A systematic review of time course and subpopulation data
Buxser, S. E. (2021) · PLoS ONE · doi:10.1371/journal.pone.0256336 · Cited by 48 · see citing works
“pneumoniae isolated in the 1940s and 1950s prior to the widespread use of antibiotics [32, 33], were compared to more recently isolated strains [34].”
Result
Extensively Drug-Resistant Klebsiella pneumoniae Counteracts Fitness and Virulence Costs That Accompanied Ceftazidime-Avibactam Resistance Acquisition
Eger, E., Schwabe, M., Schulig, L., Hübner, N., Bohnert, J. A., Bornscheuer, U. T., Heiden, S. E., Müller, J. U., Adnan, F., Becker, K., et al. (2022) · Microbiology Spectrum · doi:10.1128/spectrum.00148-22 · Cited by 48 · see citing works
“It is well known that cross-resistance (48) and collateral sensitivity (49) may accompany”
Background
Ecological Effects of Daily Antiseptic Treatment on Microbial Composition of Saliva-Grown Microcosm Biofilms and Selection of Resistant Phenotypes
Mao, X., Hiergeist, A., Auer, D. L., Scholz, K. J., Muehler, D., Hiller, K., Maisch, T., Buchalla, W., Hellwig, E., Gessner, A., et al. (2022) · Frontiers in Microbiology · doi:10.3389/fmicb.2022.934525 · Cited by 47 · see citing works
“Furthermore, selection pressure due to antiseptic treatment may lead to selection of antibiotic-resistant strains (Wand et al., 2017; Verspecht et al., 2019).”
Background
Anforderungen an die Hygiene bei der Reinigung und Desinfektion von Flächen
KRINKO (2022) · Bundesgesundheitsblatt - Gesundheitsforschung - Gesundheitsschutz · doi:10.1007/s00103-022-03576-1 · Cited by 48 · see citing works
How long do bacteria, fungi, protozoa, and viruses retain their replication capacity on inanimate surfaces? A systematic review examining environmental resilience versus healthcare-associated infection risk by “fomite-borne risk assessment”
Krämer, A., Lexow, F., Bludau, A., Köster, A. M., Misailovski, M., Seifert, U., Eggers, M., Rutala, W. A., Dancer, S. J., & Scheithauer, S. (2024) · Clinical Microbiology Reviews · doi:10.1128/cmr.00186-23 · Cited by 47 · see citing works
Risk Factors for Colistin Resistance among Gram-Negative Rods and Klebsiella pneumoniae Isolates
Richter, S. E., Miller, L. G., Uslan, D. Z., et al. (2018) · Journal of Clinical Microbiology · doi:10.1128/jcm.00149-18 · Cited by 46 · see citing works
“13–15, 21, 23), prior treatment with colistin (18, 21, 23, 24), exposure to chlorhexidine (25), the presence of multiple comorbidities in the patients (21, 22), and increasing age, male sex, length of hospitalization, and the presence of indwelling urinary catheters (22).”
Background
Is Chlorhexidine in Dentistry an Ally or a Foe? A Narrative Review
Pałka, Ł., Nowakowska-Toporowska, A., & Dalewski, B. (2022) · Healthcare · doi:10.3390/healthcare10050764 · Cited by 46 · see citing works
“The reason for the recent increase in papers regarding this topic has been connected with the reported emergence of Gram-negative bacteria resistant to colistin, which is a last resort antibiotic after exposure to CHX [5,6].”
Background
The oral microbiome, nitric oxide and exercise performance
Bryan, N. S., Burleigh, M. C., & Easton, C. (2022) · Nitric Oxide · doi:10.1016/j.niox.2022.05.004 · Cited by 46 · see citing works
Limited antimicrobial efficacy of oral care antiseptics in microcosm biofilms and phenotypic adaptation of bacteria upon repeated exposure
Schwarz, S. R., Hirsch, S., Hiergeist, A., Kirschneck, C., Muehler, D., Hiller, K., Maisch, T., Al‐Ahmad, A., Gessner, A., Buchalla, W., et al. (2020) · Clinical Oral Investigations · doi:10.1007/s00784-020-03613-w · Cited by 45 · see citing works
Challenges of quaternary ammonium antimicrobial agents: Mechanisms, resistance, persistence and impacts on the microecology
Zhang, J., Cheng, L., Li, H., Chen, X., Zhang, L., Shan, T., Wang, J., Chen, D., Shen, J., Zhou, X., et al. (2024) · The Science of The Total Environment · doi:10.1016/j.scitotenv.2024.178020 · Cited by 44 · see citing works
Acquired Resistance to Colistin via Chromosomal And Plasmid-Mediated Mechanisms in Klebsiella pneumoniae
Berglund, B. (2019) · Infectious Microbes & Diseases · doi:10.1097/im9.0000000000000002 · Cited by 43 · see citing works
Chlorhexidine leads to the evolution of antibiotic-resistant Pseudomonas aeruginosa
TagElDein, M. A., Yassin, A. S., El‐Tayeb, O. M., & Kashef, M. T. (2021) · European Journal of Clinical Microbiology & Infectious Diseases · doi:10.1007/s10096-021-04292-5 · Cited by 43 · see citing works
Adaptive bacterial response to low level chlorhexidine exposure and its implications for hand hygiene
Kampf, G. (2019) · Microbial Cell · doi:10.15698/mic2019.07.683 · Cited by 41 · see citing works
“pneumoniae 6 clinical strains with a variety of antibiotic resistance markers 6 passages of 2 days at various concentrations 4fold – 16fold 512 Stable for 10 d Cross-resistance*** to colistin (6 strains); no cross-adaptation to BAC, octenidine, hexadecylpyridinium chloride monohydrate and ethanol [16]”
Background
The antiseptic Miramistin: a review of its comparative in vitro and clinical activity
Osmanov, A., Farooq, Z., Richardson, M. D., & Denning, D. W. (2020) · FEMS Microbiology Reviews · doi:10.1093/femsre/fuaa012 · Cited by 42 · see citing works
“Another example is chlorhexidine cross-resistance with sulfamethoxazole, ceftazidime, tetracycline, cefotaxime, and imipenem (Braoudaki and Hilton 2004; Pumbwe, Skilbeck and Wexler 2007; Knapp et al. 2013; Wand et al. 2017).”
Background
Pathogen Control in the Built Environment: A Probiotic-Based System as a Remedy for the Spread of Antibiotic Resistance
D’Accolti, M., Soffritti, I., Bini, F., Mazziga, E., Mazzacane, S., & Caselli, E. (2022) · Microorganisms · doi:10.3390/microorganisms10020225 · Cited by 39 · see citing works
“Cross-resistance to antibiotics was also found with triclosan, octenidine, sodium hypochlorite, and didecyldimethylammonium chloride [3,7].”
BackgroundInfluential
Pulsed UV as a potential surface sanitizer in food production processes to ensure consumer safety
Garvey, M., & Rowan, N. J. (2019) · Current Opinion in Food Science · doi:10.1016/j.cofs.2019.03.003 · Cited by 38 · see citing works
Challenges and opportunities for antimicrobial stewardship in resource-rich and resource-limited countries
Hijazi, K., Joshi, C., & Gould, I. M. (2019) · Expert Review of Anti-infective Therapy · doi:10.1080/14787210.2019.1640602 · Cited by 45 · see citing works
“the effect of biocides on the emergence and spread of AMR [44,45].”
Background
Six Extensively Drug-Resistant Bacteria in an Injured Soldier, Ukraine
McGann, P., Lebreton, F., Jones, B. T., et al. (2023) · Emerging infectious diseases · doi:10.3201/eid2908.230567 · Cited by 37 · see citing works
“Colistin resistance likely resulted from a previously characterized E82K mutation in the 2-component transcriptional regulator PhoP (4).”
Background
Systematic analyses identify modes of action of ten clinically relevant biocides and antibiotic antagonism in Acinetobacter baumannii
Li, L., Short, F. L., Hassan, K. A., Naidu, V., Pokhrel, A., Nagy, S. S., Prity, F. T., Shah, B. S., Afrin, N., Baker, S. G., et al. (2023) · Nature Microbiology · doi:10.1038/s41564-023-01474-z · Cited by 37 · see citing works
Antisépticos y desinfectantes: apuntando al uso racional. Recomendaciones del Comité Consultivo de Infecciones Asociadas a la Atención de Salud, Sociedad Chilena de Infectología
Alexis Diomedi, P., Chacón, E., Delpiano, L., Hervé, B., Jemenao, M. I., Medel, M., Quintanilla, M., Gisela Riedel, M., Tinoco, J., & Cifuentes, M. (2017) · Revista chilena de infectología · doi:10.4067/s0716-10182017000200010 · Cited by 37 · see citing works
Spread of Klebsiella pneumoniae ST395 non-susceptible to carbapenems and resistant to fluoroquinolones in North-Eastern France
Muggeo, A., Guillard, T., Klein, F., et al. (2017) · Journal of Global Antimicrobial Resistance · doi:10.1016/j.jgar.2017.10.023 · Cited by 37 · see citing works
Effective elimination of Staphylococcal contamination from hospital surfaces by a bacteriophage–probiotic sanitation strategy: a monocentric study
D’Accolti, M., Soffritti, I., Lanzoni, L., Bisi, M., Volta, A., Mazzacane, S., & Caselli, E. (2019) · Microbial Biotechnology · doi:10.1111/1751-7915.13415 · Cited by 36 · see citing works
“Other important limitations include the high environmental impact and their potential contribution to the selection of antimicrobial resistant (AMR) strains, thus worsening the AMR concern (Bock et al., 2016; Wand et al., 2017; Fahimipour et al., 2018).”
Background
Disinfectant, Soap or Probiotic Cleaning? Surface Microbiome Diversity and Biofilm Competitive Exclusion
Stone, W., Tolmay, J., Tucker, K., & Wolfaardt, G. M. (2020) · Microorganisms · doi:10.3390/microorganisms8111726 · Cited by 37 · see citing works
“Excessive and inefficient use of disinfectants, similar to excessive and inefficient use of antibiotics, may increase a hospital’s risk of becoming an incubator for resistant pathogens [6,11].”
Background
Microbial Contamination in Hospital Environment Has the Potential to Colonize Preterm Newborns’ Nasal Cavities
Cason, C., D’Accolti, M., Campisciano, G., Soffritti, I., Ponis, G., Mazzacane, S., Maggiore, A., Risso, F. M., Comar, M., & Caselli, E. (2021) · Pathogens · doi:10.3390/pathogens10050615 · Cited by 36 · see citing works
Bacteriophages in Infectious Diseases and Beyond—A Narrative Review
Ιωάννου, Π., Baliou, S., & Samonis, G. (2023) · Antibiotics · doi:10.3390/antibiotics12061012 · Cited by 37 · see citing works
“In vitro tests have shown that if PCHS are combined with phages, they retain their stability and activity, allowing them to target bacteria with significant antimicrobial resistance that are often also resistant to disinfectants, thus leading to an additive or synergistic effect [104,109,116].”
Background
Genetic but No Phenotypic Associations between Biocide Tolerance and Antibiotic Resistance in Escherichia coli from German Broiler Fattening Farms
Roedel, A., Vincze, S., Projahn, M., Roesler, U. H., Robé, C., Hammerl, J. A., Noll, M., Dahouk, S. A., & Dieckmann, R. (2021) · Microorganisms · doi:10.3390/microorganisms9030651 · Cited by 34 · see citing works
“In vitro studies showed that antibiotic cross-resistance can occur during bacterial exposure to subinhibitory concentrations of biocides like QACs [92], biguanides [93], and phenolic compounds [94].”
Background
Contribution of the efflux pump AcrAB-TolC to the tolerance of chlorhexidine and other biocides in Klebsiella spp.
Wand, M. E., Darby, E. M., Blair, J. M. A., et al. (2022) · Journal of Medical Microbiology · doi:10.1099/jmm.0.001496 · Cited by 34 · see citing works
“Primers used have already been described [17] except for acrA primers (KPacrA665R3 TCATTGCTCGACTGGGTGAC; KPacrA586F3 CAGAATGGTCAAACGACCGC) and ramA primers (KPramA332R3 CGACTGTGGTTCTCTTTGCG; KP ramA 260F3 AGACCTTTACCCGCGTCTTC).”
BackgroundMethodInfluentialSelf-citation
Antibiotic stewardship and horizontal infection control are more effective than screening, isolation and eradication
Lemmen, S., & Lewalter, K. (2018) · Infection · doi:10.1007/s15010-018-1137-1 · Cited by 33 · see citing works
“Antiseptic washing Significant reduction of transmission of MRSA and VRE in ICU and BMT Significant reduction of BSI in ICU As an horizontal approach effective for sensitive pathogen, as well Time saving in comparison to washing with water and soap [40] [40, 41] [41] Concern of emergence of resistance against CHG Redu…”
Guidelines for the management of hidradenitis suppurativa: recommendations supported by the Centre of Evidence of the French Society of Dermatology
Bertolotti, A., Sbidian, É., Join‐Lambert, O., et al. (2020) · British Journal of Dermatology · doi:10.1111/bjd.19710 · Cited by 33 · see citing works
Efflux-mediated tolerance to cationic biocides, a cause for concern?
Wand, M. E., & Sutton, J. M. (2022) · Microbiology · doi:10.1099/mic.0.001263 · Cited by 35 · see citing works
Self-citation
Switching on the activity of 1,5-diaryl-pyrrole derivatives against drug-resistant ESKAPE bacteria: Structure-activity relationships and mode of action studies
Masci, D., Hind, C. K., Islam, M. K., et al. (2019) · European Journal of Medicinal Chemistry · doi:10.1016/j.ejmech.2019.05.087 · Cited by 33 · see citing works
Self-citation
New perspective to improve dentin–adhesive interface stability by using dimethyl sulfoxide wet-bonding and epigallocatechin-3-gallate
Zhang, Z., Yu, J. L., Yao, C., et al. (2020) · Dental Materials · doi:10.1016/j.dental.2020.08.009 · Cited by 32 · see citing works
Introduction of Probiotic-Based Sanitation in the Emergency Ward of a Children’s Hospital During the COVID-19 Pandemic
Soffritti, I., D'Accolti, M., Cason, C., Lanzoni, L., Bisi, M., Volta, A., Campisciano, G., Mazzacane, S., Bini, F., Mazziga, E., et al. (2022) · Infection and Drug Resistance · doi:10.2147/idr.s356740 · Cited by 30 · see citing works
Mechanisms of Tolerance and Resistance to Chlorhexidine in Clinical Strains of Klebsiella pneumoniae Producers of Carbapenemase: Role of New Type II Toxin-Antitoxin System, PemIK
Bleriot, I., Blasco, L., Delgado-Valverde, M., Gual-de-Torrella, A., Ambroa, A., Fernández-García, L., López, M. C., Oteo, J., Wood, T. K., Pascual, Á., et al. (2020) · Toxins · doi:10.3390/toxins12090566 · Cited by 28 · see citing works
“pneumoniae adapted to CHLX also presented resistance to colistin, increasing their MIC values from 2–4 mg/L to 64 mg/L [9].”
BackgroundInfluential
Heterogeneity and Diversity of mcr-8 Genetic Context in Chicken-Associated Klebsiella pneumoniae
Wu, B., Wang, Y., Ling, Z., et al. (2020) · Antimicrobial Agents and Chemotherapy · doi:10.1128/aac.01872-20 · Cited by 30 · see citing works
“concern because of their resistance to multiple antimicrobial agents (1).”
Background
Disinfectant and antimicrobial susceptibility studies of the foodborne pathogen Campylobacter jejuni isolated from the litter of broiler chicken houses
Beier, R. C., Byrd, J. A., Andrews, K., et al. (2020) · Poultry Science · doi:10.1016/j.psj.2020.10.045 · Cited by 30 · see citing works
“, 2016), and the use of biocides has been demonstrated to result in antimicrobial crossresistance (Maris, 1991; Sidhu et al., 2002a; Braoudaki and Hilton, 2004; Beier et al., 2005; Davin-Regli and Pag es, 2012; Al-Jailawi et al., 2013; Gnanadhas et al., 2013; Wales and Davies, 2015; Romaro et al., 2017; Wand et al., 2…”
Background
Potential of an Eco-Sustainable Probiotic-Cleaning Formulation in Reducing Infectivity of Enveloped Viruses
D’Accolti, M., Soffritti, I., Bonfante, F., Ricciardi, W., Mazzacane, S., & Caselli, E. (2021) · Viruses · doi:10.3390/v13112227 · Cited by 29 · see citing works
Priming with biocides: A pathway to antibiotic resistance?
Adkin, P., Hitchcock, A., Smith, L. J., & Walsh, S. (2022) · Journal of Applied Microbiology · doi:10.1111/jam.15564 · Cited by 23 · see citing works
Bacterial cross-resistance to anti-infective compounds. Is it a real problem?
Cândido, E. D. S., de Barros, E., Cardoso, M. H. E. S., et al. (2019) · Current Opinion in Pharmacology · doi:10.1016/j.coph.2019.05.004 · Cited by 28 · see citing works
An Innovative Strategy for the Effective Reduction of MDR Pathogens from the Nosocomial Environment
Caselli, E., D’Accolti, M., Soffritti, I., Lanzoni, L., Bisi, M., Volta, A., Berloco, F., & Mazzacane, S. (2019) · Advances in experimental medicine and biology · doi:10.1007/5584_2019_399 · Cited by 28 · see citing works
Long-Term Exposure to Octenidine in a Simulated Sink Trap Environment Results in Selection of Pseudomonas aeruginosa, Citrobacter , and Enterobacter Isolates with Mutations in Efflux Pump Regulators
Garratt, I., Aranega-Bou, P., Sutton, J. M., et al. (2021) · Applied and Environmental Microbiology · doi:10.1128/aem.00210-21 · Cited by 28 · see citing works
“pneumoniae (40), and smvR mutations were first observed before secondary highlevel tolerance to octenidine in P.”
BackgroundMethodInfluentialSelf-citation
Phenotypic Adaptation to Antiseptics and Effects on Biofilm Formation Capacity and Antibiotic Resistance in Clinical Isolates of Early Colonizers in Dental Plaque
Auer, D. L., Mao, X., Anderson, A. C., Muehler, D., Wittmer, A., OHLE, C. V., Wolff, D., Frese, C., Hiller, K., Maisch, T., et al. (2022) · Antibiotics · doi:10.3390/antibiotics11050688 · Cited by 28 · see citing works
“, Klebsiella pneumoniae [9,10,58], and similar observations could be made with respect to CPC [7], phenotypic antibiotic resistance was evaluated.”
Background
Spontaneously Arising Streptococcus mutans Variants with Reduced Susceptibility to Chlorhexidine Display Genetic Defects and Diminished Fitness
Kaspar, J. R., Godwin, M. J., Velsko, I. M., Richards, V. P., & Burne, R. A. (2019) · Antimicrobial Agents and Chemotherapy · doi:10.1128/aac.00161-19 · Cited by 28 · see citing works
“Adaptations to 96 CHX may also lead to cross-resistance to other antimicrobials, as was noted recently with 97 clinical strains of Klebsiella pneumoniae that could acquire resistance to the last-resort antibiotic 98 colistin after exposure to CHX (21).”
Background
Pseudomonas Phage ZCPS1 Endolysin as a Potential Therapeutic Agent
Abdelrahman, F. I., Gangakhedkar, R., Nair, G. A., El–Didamony, G., Askora, A., Jain, V. P., & El‐Shibiny, A. (2023) · Viruses · doi:10.3390/v15020520 · Cited by 27 · see citing works
“coli is resistant to triclosan [45], Klebsiella pneumoniae is resistant to colistin [46], Salmonella spp.”
Background
Mechanisms of emerging resistance associated with non-antibiotic antimicrobial agents: a state-of-the-art review
Baig, M. I. R., Kadu, P. K., Bawane, P. P., Nakhate, K. T., Yele, S., Ojha, S. K., & Goyal, S. N. (2023) · The Journal of Antibiotics · doi:10.1038/s41429-023-00649-4 · Cited by 27 · see citing works
Genetic, virulence, and antimicrobial resistance characteristics associated with distinct morphotypes in ST11 carbapenem-resistant Klebsiella pneumoniae
Chen, T., Wang, Y., Chi, X., et al. (2024) · Virulence · doi:10.1080/21505594.2024.2349768 · Cited by 27 · see citing works
“Moreover, some authors report K. pneumoniae showing cross-resistance to polymyxin and chlorhexidine [46,47].”
Background

Chlorhexidine exposure of clinical Klebsiella pneumoniae strains leads to acquired resistance to this disinfectant and to colistin
Zhang, Y., Zhao, Y., Xu, C., et al. (2019) · International Journal of Antimicrobial Agents · doi:10.1016/j.ijantimicag.2019.02.012 · Cited by 55 · see citing works
Reduced chlorhexidine susceptibility in multidrug-resistant Klebsiella pneumoniae; genomic and functional analysis of invasive isolates
Roch, M., Panis, G., Sierra, R., et al. (2026) · Archive ouverte UNIGE (University of Geneva)
Düşük Düzeyde Klorhekzidin ile Karşılaştırılmış Klebsiella pneumoniae İzolatlarının Karakterizasyonu
Duman, G. G., Çuhadar, T., Yamak, A. S., et al. (2019) · Mikrobiyoloji Bulteni · doi:10.5578/mb.67793 · Cited by 2 · see citing works
Chlorhexidine Promotes Psl Expression in Pseudomonas aeruginosa That Enhances Cell Aggregation with Preserved Pathogenicity Demonstrates an Adaptation against Antiseptic
Singkham-in, U., Phuengmaung, P., Makjaroen, J., et al. (2022) · International Journal of Molecular Sciences · doi:10.3390/ijms23158308 · Cited by 19 · see citing works
SmvA is an important efflux pump for cationic biocides in Klebsiella pneumoniae and other Enterobacteriaceae
Wand, M. E., Jamshidi, S., Bock, L. J., et al. (2019) · Scientific Reports · doi:10.1038/s41598-018-37730-0 · Cited by 50 · see citing works
Self-citation

Authors: Wand, M. E., Bock, L. J., Bonney, L. C., & Sutton, J. M.
Affiliations: Public Health England (GB)
ORCID: Wand, Matthew E.
Bock, Lucy J.
Bonney, Laura C.
Sutton, J. Mark
Venue: Antimicrobial Agents and Chemotherapy
Publisher: American Society for Microbiology
Published: 2017-01
Volume: 61
Issue: 1
ISSN: 0066-4804 (ISSN-L)
1098-6596
DOI: 10.1128/aac.01162-16
PMC: PMC5192135
OpenAlex: W2540856562
Cited by: 313
References: 54
Citations by year: 2026: 19 · 2025: 25 · 2024: 23 · 2023: 34 · 2022: 46 · 2021: 43 · 2020: 36 · 2019: 47 · 2018: 19 · 2017: 18 · 2016: 3
FWCI: 13.87
Type: journal article
Language: en
Open access: bronze
doi.org
Licence: journals.asm.org/non-commercial-tdm-license (tdm)
Locations: Antimicrobial Agents and Chemotherapy (publishedVersion)
Europe PMC (PubMed Central) (publishedVersion)
PubMed Central (publishedVersion)
PubMed (publishedVersion)
Funders: Public Health England (GIA 109506)
Topics: Life Sciences › Biochemistry, Genetics and Molecular Biology › Molecular Medicine › Antibiotic Resistance in Bacteria
Life Sciences › Biochemistry, Genetics and Molecular Biology › Genetics › Bacterial Genetics and Biotechnology
Physical Sciences › Chemistry › Organic Chemistry › Antimicrobial agents and applications
Keywords: Klebsiella pneumoniae, chlorhexidine, colistin, cross-resistance, PhoPQ two-component system, major facilitator superfamily, multidrug resistance, infection control
MeSH terms: Anti-Bacterial Agents, Bacterial Proteins, Chlorhexidine, Colistin, Klebsiella pneumoniae, Microbial Sensitivity Tests, Mutation, Plasmids, Drug Resistance, Bacterial

About these checks

Registry, retraction, Cites and statistics results are computed, not judged, with one exception: a printed reference that no index lists is read once by a model before it counts as a citation error. Claims are extracted by a model and kept only when their quote appears verbatim in the text; each cited source is then checked, with a model’s help, for whether it says what the claim relies on. Those verdicts can be wrong — read the claim’s quote and the cited source before relying on one.

Statistics and arithmetic are recomputed, not judged.

Confidence bands are shown only for fields calibrated on our annotated test set. None is calibrated yet, so no band is shown.

What counts as a claim ›How we measure confidence ›How we check this ›

Are you an author, or do you see a problem with this page? Request a review

Mechanisms of Increased Resistance to Chlorhexidine and Cross-Resistance to Colistin following Exposure of Klebsiella pneumoniae Clinical Isolates to Chlorhexidine

Abstract

Integrity signals

Claims the paper makes

Claims other papers make about this one

Self-check

Cites

Cited by

Related

Record

About these checks