ABCA7 frameshift deletion associated with Alzheimer disease in African Americans
Open accessAbstract
OBJECTIVE: To identify a causative variant(s) that may contribute to Alzheimer disease (AD) in African Americans (AA) in the ATP-binding cassette, subfamily A (ABC1), member 7 (ABCA7) gene, a known risk factor for late-onset AD. METHODS: Custom capture sequencing was performed on ∼150 kb encompassing ABCA7 in 40 AA cases and 37 AA controls carrying the AA risk allele (rs115550680). Association testing was performed for an ABCA7 deletion identified in large AA data sets (discovery n = 1,068; replication n = 1,749) and whole exome sequencing of Caribbean Hispanic (CH) AD families. RESULTS: A 44-base pair deletion (rs142076058) was identified in all 77 risk genotype carriers, which shows that the deletion is in high linkage disequilibrium with the risk allele. The deletion was assessed in a large data set (531 cases and 527 controls) and, after adjustments for age, sex, and APOE status, was significantly associated with disease (p = 0.0002, odds ratio [OR] = 2.13 [95% confidence interval (CI): 1.42-3.20]). An independent data set replicated the association (447 cases and 880 controls, p = 0.0117, OR = 1.65 [95% CI: 1.12-2.44]), and joint analysis increased the significance (p = 1.414 × 10(-5), OR = 1.81 [95% CI: 1.38-2.37]). The deletion is common in AA cases (15.2%) and AA controls (9.74%), but in only 0.12% of our non-Hispanic white cohort. Whole exome sequencing of multiplex, CH families identified the deletion cosegregating with disease in a large sibship. The deleted allele produces a stable, detectable RNA strand and is predicted to result in a frameshift mutation (p.Arg578Alafs) that could interfere with protein function. CONCLUSIONS: This common ABCA7 deletion could represent an ethnic-specific pathogenic alteration in AD.
The claims and statistics of this paper haven’t been checked yet.
Run the check — free, no account needed. It reads the open-access text and checks the sources it cites.
Integrity signals
Registry
Cites
Statistics
Claims the paper makes
The claims and statistics of this paper haven’t been checked yet.
Run the check — free, no account needed. It reads the open-access text and checks the sources it cites.
Claims other papers make about this one
Each is checked against this paper’s own text: does it say what the citing paper says it does?
Approaches applied to the ABCA7 locus identified a deleterious frameshift deletion in ABCA7 present in African Americans with Alzheimer's disease at a higher frequency than either control African Americans or Caucasians.
“these approaches when applied to the ABCA7 locus identified a deleterious frameshift deletion in ABCA7 present in African Americans with AD at a higher frequency than either control African Americans or Caucasians [103].”
From Genetic architecture of Alzheimer's disease (2020) · cites this paper as [103]
Self-check
Percentages, sums and reported differences re-computed from the paper’s own numbers.
The self-check needs the paper’s full text.
Cites
Folstein, M. F., Folstein, S. E., & McHugh, P. R. (1975) · Journal of Psychiatric Research · doi:10.1016/0022-3956(75)90026-6 · Cited by 88,282 · see citing works
Fast and accurate short read alignment with Burrows-Wheeler transform
Li, H., & Durbin, R. (2009) · Bioinformatics · doi:10.1093/bioinformatics/btp324 · Cited by 58,607 · see citing works
Fast gapped-read alignment with Bowtie 2
Langmead, B., & Salzberg, S. L. (2012) · Nature Methods · doi:10.1038/nmeth.1923 · Cited by 56,400 · see citing works
PLINK: a tool set for whole-genome association and population-based linkage analyses.
Purcell, S., Neale, B., Todd-Brown, K., Thomas, L., Ferreira, M. A. R., Bender, D., Maller, J., Sklar, P., de Bakker, P. I. W., Daly, M. J., et al. (2007) · The American Journal of Human Genetics · doi:10.1086/519795 · Cited by 34,089 · see citing works
McKhann, G., Drachman, D., Folstein, M., Katzman, R., Price, D., & Stadlan, E. M. (1984) · Neurology · doi:10.1212/wnl.34.7.939 · Cited by 27,915 · see citing works
The Genome Analysis Toolkit: A MapReduce framework for analyzing next-generation DNA sequencing data
McKenna, A., Hanna, M., Banks, E., Sivachenko, A., Cibulskis, K., Kernytsky, A., Garimella, K., Altshuler, D., Gabriel, S., Daly, M., et al. (2010) · Genome Research · doi:10.1101/gr.107524.110 · Cited by 27,895 · see citing works
Hirono, N., Mori, E., Ikejiri, Y., Imamura, T., Shimomura, T., Hashimoto, M., Yamashita, H., & Ikeda, M. (1997) · PubMed · Cited by 21,010 · see citing works
Kok, J. S., Berg, I. J., & Scherder, E. J. A. (2013) · Dementia and Geriatric Cognitive Disorders Extra · doi:10.1159/000353441 · Cited by 20,589 · see citing works
Older Adults' Reasons for Using Technology while Aging in Place
Peek, S. T. M., Luijkx, K. G., Rijnaard, M. D., Nieboer, M. E., van der Voort, C. S., Aarts, S., van Hoof, J., Vrijhoef, H. J., & Wouters, E. (2015) · Gerontology · doi:10.1159/000430949 · Cited by 19,803 · see citing works
Sensitivity and False Alarm Rate of a Fall Sensor in Long-Term Fall Detection in the Elderly
Kangas, M., Korpelainen, R., Vikman, I., Nyberg, L., & Jämsä, T. J. (2014) · Gerontology · doi:10.1159/000362720 · Cited by 19,003 · see citing works
McKhann, G. M., Knopman, D. S., Chertkow, H., Hyman, B. T., Jack, C. R., Kawas, C. H., Klunk, W. E., Koroshetz, W. J., Manly, J. J., Mayeux, R., et al. (2011) · Alzheimer's & Dementia · doi:10.1016/j.jalz.2011.03.005 · Cited by 18,657 · see citing works
An integrated encyclopedia of DNA elements in the human genome
The ENCODE Project Consortium (2012) · Nature · doi:10.1038/nature11247 · Cited by 18,072 · see citing works
A framework for variation discovery and genotyping using next-generation DNA sequencing data
DePristo, M. A., Banks, E., Poplin, R. E., Garimella, K. V., Maguire, J., Hartl, C., Philippakis, A., del Angel, G., Rivas, M. A., Hanna, M., et al. (2011) · Nature Genetics · doi:10.1038/ng.806 · Cited by 11,216 · see citing works
The Clinical Dementia Rating (CDR): Current version and scoring rules
Morris, J. C. (1993) · Neurology · doi:10.1212/wnl.43.11.2412-a · Cited by 9,882 · see citing works
Corder, E. H., Saunders, A. M., Strittmatter, W. J., Schmechel, D. E., Gaskell, P. C., Small, G. W., Roses, A. D., Haines, J. L., & Pericak-Vance, M. A. (1993) · Science · doi:10.1126/science.8346443 · Cited by 9,429 · see citing works
A general framework for estimating the relative pathogenicity of human genetic variants
Kircher, M., Witten, D. M., Jain, P., O'Roak, B. J., Cooper, G. M., & Shendure, J. (2014) · Nature Genetics · doi:10.1038/ng.2892 · Cited by 6,183 · see citing works
Meta-Analysis of 74,046 Individuals Identifies 11 New Susceptibility Loci for Alzheimer’s Disease
(EADI), E. A. D. I., Lambert, J.-C., (GERAD), G. A. E. R. I. A. D., Alzheimer's Disease Genetic Consortium (ADGC), (CHARGE), C. F. H. A. A. R. I. G. E., Ibrahim-Verbaas, C. A., Harold, D., Naj, A. C., Sims, R., Bellenguez, C., et al. (2013) · Nature Genetics · doi:10.1038/ng.2802 · Cited by 4,336 · see citing works
Self-citationStrittmatter, W. J., Saunders, A. M., Schmechel, D., Pericak-Vance, M., Enghild, J., Salvesen, G. S., & Roses, A. D. (1993) · Proceedings of the National Academy of Sciences · doi:10.1073/pnas.90.5.1977 · Cited by 4,268 · see citing works
(1987) · PubMed · Cited by 2,657 · see citing works
Initiative, T. A. D. N., Hollingworth, P., CHARGE consortium, EADI1 consortium, Harold, D., Sims, R., Gerrish, A., Lambert, J.-C., Carrasquillo, M. M., Abraham, R., et al. (2011) · Nature Genetics · doi:10.1038/ng.803 · Cited by 1,997 · see citing works
Ye, K., Schulz, M. H., Long, Q., Apweiler, R., & Ning, Z. (2009) · Bioinformatics · doi:10.1093/bioinformatics/btp394 · Cited by 1,978 · see citing works
Naj, A. C., Jun, G., Beecham, G. W., Wang, L.-S., Vardarajan, B. N., Buros, J., Gallins, P. J., Buxbaum, J. D., Jarvik, G. P., Crane, P. K., et al. (2011) · Nature Genetics · doi:10.1038/ng.801 · Cited by 1,901 · see citing works
Self-citationShihab, H. A., Rogers, M. F., Gough, J., Mort, M. E., Cooper, D. N., Day, I. N. M., Gaunt, T. R., & Campbell, C. (2015) · Bioinformatics · doi:10.1093/bioinformatics/btv009 · Cited by 703 · see citing works
Genome-wide patterns of population structure and admixture among Hispanic/Latino populations
Bryc, K., Velez, C., Karafet, T., Moreno-Estrada, A., Reynolds, A., Auton, A., Hammer, M., Bustamante, C. D., & Ostrer, H. (2010) · Proceedings of the National Academy of Sciences · doi:10.1073/pnas.0914618107 · Cited by 442 · see citing works
Reitz, C., Jun, G., Naj, A., Rajbhandary, R., Vardarajan, B. N., Wang, L.-S., Valladares, O., Lin, C.-F., Larson, E. B., Graff-Radford, N. R., et al. (2013) · JAMA · doi:10.1001/jama.2013.2973 · Cited by 431 · see citing works
Diversity and Disparity in Dementia: The Impact of Ethnoracial Differences in Alzheimer Disease
Chin, A. L., Negash, S., & Hamilton, R. (2011) · Alzheimer Disease & Associated Disorders · doi:10.1097/wad.0b013e318211c6c9 · Cited by 416 · see citing works
Risk of Dementia Among White and African American Relatives of Patients With Alzheimer Disease
Green, R. C. (2002) · JAMA · doi:10.1001/jama.287.3.329 · Cited by 391 · see citing works
Self-citationWard, A., Crean, S., Mercaldi, C. J., Collins, J. M., Boyd, D., Cook, M. N., & Arrighi, H. M. (2012) · Neuroepidemiology · doi:10.1159/000334607 · Cited by 349 · see citing works
Loss-of-function variants in ABCA7 confer risk of Alzheimer's disease
DemGene, Steinberg, S., Stefansson, H., Jonsson, T., Johannsdottir, H., Ingason, A., Helgason, H., Sulem, P., Magnusson, O. T., Gudjonsson, S. A., et al. (2015) · Nature Genetics · doi:10.1038/ng.3246 · Cited by 324 · see citing works
Langmann, T., Mauerer, R., Zahn, A., Moehle, C., Probst, M., Stremmel, W., & Schmitz, G. (2003) · Clinical Chemistry · doi:10.1373/49.2.230 · Cited by 259 · see citing works
Kim, W. S., Li, H., Ruberu, K. R., Chan, S. L., Elliott, D. A., Low, J. K., Cheng, D., Karl, T., & Garner, B. (2013) · Journal of Neuroscience · doi:10.1523/jneurosci.4165-12.2013 · Cited by 208 · see citing works
Quazi, F., & Molday, R. S. (2013) · Journal of Biological Chemistry · doi:10.1074/jbc.m113.508812 · Cited by 205 · see citing works
Lee, J. H., Cheng, R., Barral, S., Reitz, C., Medrano, M., Lantigua, R., Jiménez-Velazquez, I. Z., Rogaeva, E., St. George-Hyslop, P. H., & Mayeux, R. (2011) · Archives of Neurology · doi:10.1001/archneurol.2010.292 · Cited by 190 · see citing works
Identification of a Novel Human Sterol-Sensitive ATP-Binding Cassette Transporter (ABCA7)
Kaminski, W. E., Orsó, E., Diederich, W., Klucken, J., Drobnik, W., & Schmitz, G. (2000) · Biochemical and Biophysical Research Communications · doi:10.1006/bbrc.2000.2954 · Cited by 166 · see citing works
Kim, W., Guillemin, G., Glaros, E., Lim, C. K., & Garner, B. (2006) · NeuroReport · doi:10.1097/01.wnr.0000221833.41340.cd · Cited by 158 · see citing works
Cuyvers, E., De Roeck, A., Van den Bossche, T., Van Cauwenberghe, C., Bettens, K., Vermeulen, S., Mattheijssens, M., Peeters, K., Engelborghs, S., Vandenbulcke, M., et al. (2015) · The Lancet Neurology · doi:10.1016/s1474-4422(15)00133-7 · Cited by 152 · see citing works
Vardarajan, B. N., Ghani, M., Kahn, A., Sheikh, S., Sato, C., Barral, S., Lee, J. H., Cheng, R., Reitz, C., Lantigua, R., et al. (2015) · Annals of Neurology · doi:10.1002/ana.24466 · Cited by 148 · see citing works
Self-citationATP‐binding cassette transporter A7 regulates processing of amyloid precursor protein in vitro
Chan, S. L., Kim, W. S., Kwok, J. B., Hill, A. F., Cappai, R., Rye, K., & Garner, B. (2008) · Journal of Neurochemistry · doi:10.1111/j.1471-4159.2008.05433.x · Cited by 133 · see citing works
Association of Apolipoprotein E Genotype and Alzheimer Disease in African Americans
Murrell, J. R., Price, B., Lane, K. A., Baiyewu, O., Gureje, O., Ogunniyi, A., Unverzagt, F. W., Smith-Gamble, V., Gao, S., Hendrie, H. C., et al. (2006) · Archives of Neurology · doi:10.1001/archneur.63.3.431 · Cited by 108 · see citing works
ABCA7 expression is associated with Alzheimer's disease polymorphism and disease status
Vasquez, J. B., Fardo, D. W., & Estus, S. (2013) · Neuroscience Letters · doi:10.1016/j.neulet.2013.09.058 · Cited by 101 · see citing works
Genetics of Alzheimer’s Disease in Caribbean Hispanic and African American Populations
Reitz, C., & Mayeux, R. P. (2013) · Biological Psychiatry · doi:10.1016/j.biopsych.2013.06.003 · Cited by 68 · see citing works
Role of Abca7 in Mouse Behaviours Relevant to Neurodegenerative Diseases
Logge, W., Cheng, D., Chesworth, R., Bhatia, S., Garner, B., Kim, W. S., & Karl, T. (2012) · PLoS ONE · doi:10.1371/journal.pone.0045959 · Cited by 49 · see citing works
Pahnke, J., Fröhlich, C., Krohn, M., Schumacher, T., & Paarmann, K. (2013) · Mechanisms of Ageing and Development · doi:10.1016/j.mad.2013.08.007 · Cited by 32 · see citing works
Vardarajan, B. N., Schaid, D. J., Reitz, C., Lantigua, R., Medrano, M. Z., Jiménez‐Velázquez, I. Z., Lee, J. H., Ghani, M., Rogaeva, E. A., George‐Hyslop, P. S., et al. (2014) · Genetics in Medicine · doi:10.1038/gim.2014.161 · Cited by 29 · see citing works
Flagged first, then by citations
1 of the 45 references couldn’t be matched to a known paper.
Cited by
Sorted by citations
Kunkle, B. W., Schmidt, M. A., Klein, H., Naj, A. C., Hamilton‐Nelson, K. L., Larson, E. B., Evans, D. A., Jager, P. L. D., Crane, P. K., Buxbaum, J. D., et al. (2020) · JAMA Neurology · doi:10.1001/jamaneurol.2020.3536 · Cited by 254 · see citing works
Untangling Genetic Risk for Alzheimer’s Disease
Pimenova, A. A., Raj, T., & Goate, A. M. (2018) · Biological Psychiatry · doi:10.1016/j.biopsych.2017.05.014 · Cited by 223 · see citing works
“Deep sequencing in African Americans carrying risk and p rotective alleles at ABCA7 led to the identification of a 44 base pair deletion in LD wit h he high risk allele, which results in a frameshift (85).”
BackgroundThe role of ABCA7 in Alzheimer’s disease: evidence from genomics, transcriptomics and methylomics
De Roeck, A., Van Broeckhoven, C., & Sleegers, K. (2019) · Acta Neuropathologica · doi:10.1007/s00401-019-01994-1 · Cited by 212 · see citing works
Ancestral origin of ApoE ε4 Alzheimer disease risk in Puerto Rican and African American populations
Rajabli, F., Feliciano, B. E., Celis, K., Hamilton-Nelson, K. L., Whitehead, P. L., Adams, L. D., Bussies, P. L., Manrique, C. P., Rodriguez, A., Rodriguez, V., et al. (2018) · PLOS Genetics · doi:10.1371/journal.pgen.1007791 · Cited by 206 · see citing works
A global view of the genetic basis of Alzheimer disease
Reitz, C., Pericak-Vance, M., Foroud, T., & Mayeux, R. (2023) · Nature Reviews Neurology · doi:10.1038/s41582-023-00789-z · Cited by 143 · see citing works
Genetic architecture of Alzheimer's disease
Neuner, S. M., TCW, J., & Goate, A. M. (2020) · Neurobiology of Disease · doi:10.1016/j.nbd.2020.104976 · Cited by 126 · see citing works
ABCA7 and Pathogenic Pathways of Alzheimer’s Disease
Aikawa, T., Holm, M., & Kanekiyo, T. (2018) · Brain Sciences · doi:10.3390/brainsci8020027 · Cited by 124 · see citing works
An intronic VNTR affects splicing of ABCA7 and increases risk of Alzheimer’s disease
On Behalf of the BELNEU Consortium, De Roeck, A., Duchateau, L., Van Dongen, J., Cacace, R., Bjerke, M., Van den Bossche, T., Cras, P., Vandenberghe, R., De Deyn, P. P., et al. (2018) · Acta Neuropathologica · doi:10.1007/s00401-018-1841-z · Cited by 93 · see citing works
Role of ABCA7 in Human Health and in Alzheimer’s Disease
Dib, S., Pahnke, J., & Gosselet, F. (2021) · International Journal of Molecular Sciences · doi:10.3390/ijms22094603 · Cited by 86 · see citing works
ABC transporters: human disease and pharmacotherapeutic potential
Moore, J. M., Bell, E. L., Hughes, R. O., & Garfield, A. S. (2022) · Trends in Molecular Medicine · doi:10.1016/j.molmed.2022.11.001 · Cited by 83 · see citing works
Deleterious ABCA7 mutations and transcript rescue mechanisms in early onset Alzheimer’s disease
On behalf of the European Early-Onset Dementia (EU EOD) consortium, De Roeck, A., Van den Bossche, T., van der Zee, J., Verheijen, J., De Coster, W., Van Dongen, J., Dillen, L., Baradaran-Heravi, Y., Heeman, B., et al. (2017) · Acta Neuropathologica · doi:10.1007/s00401-017-1714-x · Cited by 74 · see citing works
African ancestry GWAS of dementia in a large military cohort identifies significant risk loci
Sherva, R., Zhang, R., Sahelijo, N., Jun, G., Anglin, T., Chanfreau, C., Cho, K., Fonda, J. R., Gaziano, J. M., Harrington, K. M., et al. (2023) · Molecular Psychiatry · doi:10.1038/s41380-022-01890-3 · Cited by 68 · see citing works
“Neither the ABCA7 frameshift deletion reported in Cukier et al. [34] (rs142076058), nor the insertion/deletion polymorphism in the gene reported by Logue et al. (rs567222111) [16] were nominally significant in the combined MVP sample (p > 0.05).”
BackgroundInfluentialABCA7 and the altered lipidostasis hypothesis of Alzheimer's disease
Lyssenko, N. N., & Praticò, D. (2020) · Alzheimer s & Dementia · doi:10.1002/alz.12220 · Cited by 66 · see citing works
Chaves, J. C. S., Dando, S. J., White, A. R., & Oikari, L. E. (2024) · Biochimica et Biophysica Acta (BBA) - Molecular Basis of Disease · doi:10.1016/j.bbadis.2023.166967 · Cited by 62 · see citing works
The role of ATP-binding cassette subfamily A in the etiology of Alzheimer’s disease
Bossaerts, L., Cacace, R., & van Broeckhoven, C. (2022) · Molecular Neurodegeneration · doi:10.1186/s13024-022-00536-w · Cited by 50 · see citing works
“L1043fs) [138, 141, 154, 155] has been described in six pedigrees, all mimicking an autosomal dominant inheritance pattern.”
BackgroundABCA7 deficiency causes neuronal dysregulation by altering mitochondrial lipid metabolism
Kawatani, K., Holm, M., Starling, S. C., Martens, Y. A., Zhao, J., Lü, W., Ren, Y., Li, Z., Jiang, P., Jiang, Y., et al. (2023) · Molecular Psychiatry · doi:10.1038/s41380-023-02372-w · Cited by 55 · see citing works
“Of note, ABCA7 loss-of-function variants, including nonsense, frameshift, and canonical splice-site mutations, substantially increase the risk of AD [8].”
BackgroundAlzheimer Disease: Perspectives from Epidemiology and Genetics
Haines, J. (2018) · Journal of Law, Medicine & Ethics · doi:10.1177/1073110518804230 · Cited by 42 · see citing works
The impact of rare genetic variants on Alzheimer disease
Deyn, L. D., & Sleegers, K. (2025) · Nature Reviews Neurology · doi:10.1038/s41582-025-01062-1 · Cited by 43 · see citing works
“A well-known example is the occurrence of a common ABCA7 PTC variant in African ancestry 159 .”
ABCA7 loss-of-function variants, expression, and neurologic disease risk
Allen, M., Lincoln, S., Corda, M., Watzlawik, J. O., Carrasquillo, M. M., Reddy, J. S., Burgess, J. D., Nguyen, T., Malphrus, K. G., Petersen, R. C., et al. (2017) · Neurology Genetics · doi:10.1212/nxg.0000000000000126 · Cited by 37 · see citing works
Targeted Sequencing of Alzheimer Disease Genes in African Americans Implicates Novel Risk Variants
Logue, M. W., Lancour, D., Farrell, J. J., Simkina, I., Fallin, M. D., Lunetta, K. L., & Farrer, L. A. (2018) · Frontiers in Neuroscience · doi:10.3389/fnins.2018.00592 · Cited by 37 · see citing works
The ABC's of Alzheimer risk gene ABCA7
Duchateau, L., Wawrzyniak, N., & Sleegers, K. (2024) · Alzheimer s & Dementia · doi:10.1002/alz.13805 · Cited by 33 · see citing works
MPZL2 is a novel gene associated with autosomal recessive nonsyndromic moderate hearing loss
Bademci, G., Abad, C., İncesulu, A., Rad, A., Alper, Ö. M., Kolb, S. M., Cengiz, F. B., Diaz‐Horta, O., Sılan, F., Mıhçı, E., et al. (2018) · Human Genetics · doi:10.1007/s00439-018-1901-4 · Cited by 34 · see citing works
Genetics of Alzheimer’s Disease in the African American Population
Logue, M. W., Dasgupta, S., & Farrer, L. A. (2023) · Journal of Clinical Medicine · doi:10.3390/jcm12165189 · Cited by 28 · see citing works
“2016 [74] Variant discovery in 77 cases, Association in 531 cases and 527 controls/Replication cohort of 447 cases and 880 controls ABCA7 rs142076058 14 bp deletion 6.”
BackgroundGardner, O. K., Wang, L., Booven, D. V., Whitehead, P. L., Hamilton‐Nelson, K. L., Adams, L. D., Starks, T. D., Hofmann, N. K., Vance, J. M., Cuccaro, M. L., et al. (2019) · Human Molecular Genetics · doi:10.1093/hmg/ddz110 · Cited by 29 · see citing works
Lee, W., Choi, S. H., Shea, M. G., Cheng, P., Dombroski, B. A., Pitsillides, A., Heard‐Costa, N. L., Wang, H., Bulekova, K., Kuzma, A. B., et al. (2024) · Alzheimer s & Dementia · doi:10.1002/alz.14283 · Cited by 27 · see citing works
Association of rare variants in neurodegenerative genes with familial Alzheimer’s disease
Zhang, W., Jiao, B., Xiao, T., Liu, X., Liao, X., Xiao, X., Guo, L., Yuan, Z., Yan, X., Tang, B., et al. (2020) · Annals of Clinical and Translational Neurology · doi:10.1002/acn3.51197 · Cited by 28 · see citing works
“In an European population study, targeted resequencing identified an intronic variant in ABCA7,(12) whereas among AfricanAmericans, the most strongly associated SNP is rs115550680.(40) No rare variants in CR1 have been reported to be associated with AD by now.”
BackgroundMarca-Ysabel, M. V., Rajabli, F., Cornejo‐Olivas, M., Whitehead, P. G., Hofmann, N. K., Illanes‐Manrique, M., Véliz-Otani, D. M., Milla‐Neyra, K., Castro‐Suárez, S., Meza-Vega, M., et al. (2020) · Neurobiology of Aging · doi:10.1016/j.neurobiolaging.2020.10.003 · Cited by 27 · see citing works
Rubin, L., Ingram, L. A., Resciniti, N. V., Ashford‐Carroll, B., Leith, K. H., Rose, A., Ureña, S., McCollum, Q., & Friedman, D. B. (2021) · Frontiers in Public Health · doi:10.3389/fpubh.2021.784958 · Cited by 25 · see citing works
“(53) Case-control African Americans, Caribbean Hispanics HIHG and ADGC data sets 149 cases, 137 controls* LOAD ABC1, ABCA7”
BackgroundABCA7, a Genetic Risk Factor Associated with Alzheimer’s Disease Risk in African Americans
Stepler, K. E., Gillyard, T. R., Reed, C. B., Avery, T. M., Davis, J. S., & Robinson, R. A. S. (2022) · Journal of Alzheimer s Disease · doi:10.3233/jad-215306 · Cited by 28 · see citing works
Sinha, N., Reagh, Z. M., Tustison, N. J., Berg, C. N., Shaw, A., Myers, C. E., Hill, D., Yassa, M. A., & Gluck, M. A. (2018) · Hippocampus · doi:10.1002/hipo.23042 · Cited by 25 · see citing works
“Consistent with this, rs115550680 was found to be in LD with a 44-base pair deletion (rs142076058) in ABCA7 that is associated with AD in individuals of African ancestry (Cukier et al., 2016).”
BackgroundAlzheimer’s Disease Variant Portal: A Catalog of Genetic Findings for Alzheimer’s Disease
Kuksa, P. P., Liu, C., Fu, W., Qu, L., Zhao, Y., Katanić, Ž., Clark, K., Kuzma, A. B., Ho, P., Tzeng, K., et al. (2022) · Journal of Alzheimer s Disease · doi:10.3233/jad-215055 · Cited by 22 · see citing works
“GWAS on Hispanic, African-American, Asian, and other minority populations also led to new variants not observed in Caucasians [20–22].”
ResultBerg, C. N., Sinha, N., & Gluck, M. A. (2019) · Frontiers in Human Neuroscience · doi:10.3389/fnhum.2019.00387 · Cited by 22 · see citing works
Bossaerts, L., Hens, E., Cacace, R., Asselbergh, B., & Broeckhoven, C. V. (2022) · Acta Neuropathologica Communications · doi:10.1186/s40478-022-01346-3 · Cited by 21 · see citing works
LATE-NC risk alleles (in TMEM106B, GRN, and ABCC9 genes) among persons with African ancestry
Katsumata, Y., Fardo, D. W., Shade, L. M. P., Bowen, J. D., Crane, P. K., Jarvik, G. P., Keene, C. D., Larson, E. B., McCormick, W. C., McCurry, S. M., et al. (2023) · Journal of Neuropathology & Experimental Neurology · doi:10.1093/jnen/nlad059 · Cited by 21 · see citing works
Meta-Analysis of the Association between Variants in ABCA7 and Alzheimer’s Disease
Ma, F.-C., Wang, H.-F., Cao, X., Tan, C., Tan, L., & Yu, J. (2018) · Journal of Alzheimer s Disease · doi:10.3233/jad-180107 · Cited by 21 · see citing works
“LOF mutations, including nonsense, frameshift and canonical splice-site mutations, resulted in the loss of the biological function [15], and they were treated as a single allele for research [20].”
InfluentialSheth, J., Pancholi, D., Mistri, M., Nath, P., Ankleshwaria, C., Bhavsar, R., Puri, R., Phadke, S., & Sheth, F. (2018) · BMC Medical Genetics · doi:10.1186/s12881-018-0687-5 · Cited by 21 · see citing works
Kunkle, B. W., Carney, R. M., Kohli, M. A., Naj, A. C., Hamilton-Nelson, K. L., Whitehead, P. L., Wang, L., Lang, R., Cuccaro, M. L., Vance, J. M., et al. (2017) · Neuroscience Letters · doi:10.1016/j.neulet.2017.04.014 · Cited by 19 · see citing works
Self-citationSpecificity of ABCA7-mediated cell lipid efflux
Picataggi, A., Rodrigues, A., Cromley, D. A., Wang, H., Wiener, J. P., Garliyev, V., Billheimer, J. T., Grabiner, B. C., Hurt, J. A., Chen, A. C., et al. (2022) · Biochimica et Biophysica Acta (BBA) - Molecular and Cell Biology of Lipids · doi:10.1016/j.bbalip.2022.159157 · Cited by 20 · see citing works
Jayadev, S. (2022) · CONTINUUM Lifelong Learning in Neurology · doi:10.1212/con.0000000000001125 · Cited by 21 · see citing works
Tayran, H., Yılmaz, E., Bhattarai, P., Min, Y.-H., Wang, X., Ma, Y.-Y., Wang, N., Jeong, I., Nelson, N., Kassara, N., et al. (2024) · Cell Genomics · doi:10.1016/j.xgen.2024.100642 · Cited by 17 · see citing works
The Abca7V1613M variant reduces Aβ generation, plaque load, and neuronal damage
Butler, C. A., Mendoza‐Arvilla, A., Milinkeviciute, G., Cunha, C. D., Kawauchi, S., Rezaie, N., Liang, H. Y., Javonillo, D. I., Thach, A., Wang, S., et al. (2024) · Alzheimer s & Dementia · doi:10.1002/alz.13783 · Cited by 14 · see citing works
Griswold, A. J., Sivasankaran, S. K., Booven, D. V., Gardner, O. K., Rajabli, F., Whitehead, P. L., Hamilton‐Nelson, K. L., Adams, L. D., Scott, A. M., Hofmann, N. K., et al. (2020) · Journal of Alzheimer s Disease · doi:10.3233/jad-190855 · Cited by 20 · see citing works
Bossaerts, L., Hens, E., Hanseeuw, B. J., Vandenberghe, R. R., Cras, P. P., Deyn, P. P. D., Engelborghs, S., & Broeckhoven, C. V. (2021) · Neurobiology of Aging · doi:10.1016/j.neurobiolaging.2021.04.023 · Cited by 17 · see citing works
“, 2011) and African American cohorts (Cukier et al., 2016; Logue et al., 2011; Reitz et al., 2013).”
Nuytemans, K., Manrique, C. P., Uhlenberg, A., Scott, W. K., Cuccaro, M. L., Luca, C. C., Singer, C., & Vance, J. M. (2019) · Frontiers in Genetics · doi:10.3389/fgene.2019.00658 · Cited by 16 · see citing works
Admixture mapping identifies novel Alzheimer's disease risk regions in African Americans
Rajabli, F., Tosto, G., Hamilton‐Nelson, K. L., Kunkle, B. W., Vardarajan, B. N., Naj, A. C., Whitehead, P. G., Gardner, O. K., Bush, W. S., Sariya, S., et al. (2022) · Alzheimer s & Dementia · doi:10.1002/alz.12865 · Cited by 15 · see citing works
Stepler, K. E., & Robinson, R. A. S. (2019) · Advances in experimental medicine and biology · doi:10.1007/978-3-030-05542-4_1 · Cited by 15 · see citing works
ABCA 7 and risk of dementia and vascular disease in the Danish population
Kjeldsen, E. W., Tybjærg‐Hansen, A., Nordestgaard, B. G., & Frikke‐Schmidt, R. (2017) · Annals of Clinical and Translational Neurology · doi:10.1002/acn3.506 · Cited by 14 · see citing works
Kopel, J. J., Sehar, U., Choudhury, M., & Reddy, P. H. (2023) · Healthcare · doi:10.3390/healthcare11060868 · Cited by 13 · see citing works
“Mutations in the ABCA7 are associated with an increased risk of AD which is comparable to the increased risk observed in AA-carrying mutated APOE alleles [18,78,96].”
Xue, D., Blue, E., Conomos, M. P., & Fohner, A. E. (2024) · Alzheimer s & Dementia Translational Research & Clinical Interventions · doi:10.1002/trc2.12462 · Cited by 10 · see citing works
“35,36 Disparities in genetic knowledge have implications for downstream applications including risk prediction and understanding underlying diseasebiology,drugdevelopment,andelucidatingcausalrelationships between non-genetic risk factors and AD risk.”
BackgroundTTC3-Mediated Protein Quality Control, A Potential Mechanism for Cognitive Impairment
Zhou, X., Chen, X., Hong, T., Zhang, M., Cai, Y., & Cui, L. (2021) · Cellular and Molecular Neurobiology · doi:10.1007/s10571-021-01060-z · Cited by 11 · see citing works
Zhang, J., Pandey, M., Awe, A., Lue, N., Kittock, C. M., Fikse, E., Degner, K. N., Staples, J., Mokhasi, N., Chen, W., et al. (2024) · The American Journal of Human Genetics · doi:10.1016/j.ajhg.2024.01.005 · Cited by 10 · see citing works
S, H. S. G. N., Prasanna, V. L., Satish, K. S., Yergolkar, A. V., Krishnamurthy, M., Rajalekshmi, S. G., Radhika, K., & Burri, R. R. (2021) · Ageing Research Reviews · doi:10.1016/j.arr.2021.101421 · Cited by 10 · see citing works
Haploinsufficiency and Alzheimer’s Disease: The Possible Pathogenic and Protective Genetic Factors
Bagyinszky, E., & An, S. S. A. (2024) · International Journal of Molecular Sciences · doi:10.3390/ijms252211959 · Cited by 10 · see citing works
“Transcriptome analysis revealed that the deletion resulted in detectable RNA strands for the mutant allele, suggesting a potential impact on protein function [79].”
Ma, X., Prokopenko, D., Wang, N., Aikawa, T., Choi, Y., Zhang, C. M., Lei, D., Ren, Y., Kawatani, K., Starling, S. C., et al. (2025) · Neurobiology of Disease · doi:10.1016/j.nbd.2025.106813 · Cited by 10 · see citing works
“Of note, the risks of deletions of rs115550680G (OR=1.79) (Reitz et al., 2013) and rs142076058 (OR=1.81) (Cukier et al., 2016) are comparable J ou r na P r e - p r oo Journal Pre-proof to those of APOE-ε in African-Americans. the National described elsewhere National Institute Table 1), , minor…”
InfluentialClinical and genetic characteristics of 21 Spanish patients with biallelic pathogenic SPG7 mutations
Baviera‐Muñoz, R., Campins‐Romeu, M., Carretero‐Vilarroig, L., Bataller, I. S., Martínez‐Torres, I., Vazquez-Costa, J. F., Muelas, N., Sevilla, T., Vilchez, J. J., Aller, E., et al. (2021) · Journal of the Neurological Sciences · doi:10.1016/j.jns.2021.118062 · Cited by 9 · see citing works
Protective effects and mechanism of TPX2 on neurocyte apoptosis of rats in Alzheimer's disease model
Liang, K., Zhang, J., Yin, C.-B., Zhou, X., & Zhou, S. (2016) · Experimental and Therapeutic Medicine · doi:10.3892/etm.2016.4006 · Cited by 9 · see citing works
Nuytemans, K., Rajabli, F., Bussies, P. L., Celis, K., Scott, W. K., Singer, C., Luca, C. C., Viñuela, Á., Pericak‐Vance, M. A., & Vance, J. M. (2020) · Frontiers in Neurology · doi:10.3389/fneur.2020.573733 · Cited by 9 · see citing works
Akgün, B., Feliciano‐Astacio, B. E., Hamilton‐Nelson, K. L., Scott, K. M., Rivero, J., Adams, L. D., Sanchez, J. J., Valladares, G. S., Tejada, S. J., Bussies, P. L., et al. (2024) · Frontiers in Aging Neuroscience · doi:10.3389/fnagi.2024.1459796 · Cited by 7 · see citing works
Benefits and Challenges of Rare Genetic Variation in Alzheimer’s Disease
Grozeva, D., Saad, S., Menzies, G. E., & Sims, R. (2019) · Current Genetic Medicine Reports · doi:10.1007/s40142-019-0161-5 · Cited by 7 · see citing works
The Early‐Onset Alzheimer's Disease Whole‐Genome Sequencing Project: Study design and methodology
Ray, N. R., Ayodele, T., Jean‐Francois, M. N., Baez, P., Fernández, M. V., Bradley, J. L., Crane, P. K., Dalgard, C. L., Kuzma, A. B., Nicaretta, H. I., et al. (2023) · Alzheimer s & Dementia · doi:10.1002/alz.13370 · Cited by 8 · see citing works
Moura, S., Nasciben, L. B., Ramírez, A. M., Coombs, L. E., Rivero, J., Booven, D. J. V., DeRosa, B. A., Hamilton‐Nelson, K. L., Whitehead, P. L., Adams, L. D., et al. (2025) · Alzheimer s & Dementia · doi:10.1002/alz.70031 · Cited by 5 · see citing works
Linkage of Alzheimer disease families with Puerto Rican ancestry identifies a chromosome 9 locus
Rajabli, F., Feliciano‐Astacio, B. E., Cukier, H. N., Wang, L., Griswold, A. J., Hamilton‐Nelson, K. L., Adams, L. D., Rodríguez, V., Mena, P. R., Tejada, S. J., et al. (2021) · Neurobiology of Aging · doi:10.1016/j.neurobiolaging.2021.02.019 · Cited by 7 · see citing works
Milestone Review: The History of Molecular Genetics Analysis of Alzheimer's Disease
Hardy, J. (2025) · Journal of Neurochemistry · doi:10.1111/jnc.70148 · Cited by 6 · see citing works
Distinct sequence features underlie microdeletions and gross deletions in the human genome
Qi, M., Stenson, P. D., Ball, E. V., Tainer, J. A., Bacolla, A., Kehrer‐Sawatzki, H., Cooper, D. N., & Zhao, H. (2021) · Human Mutation · doi:10.1002/humu.24314 · Cited by 5 · see citing works
“Deletions are associated not only with common disorders, such as Alzheimer's disease (Cukier et al., 2016; Prihar et al., 1999), Parkinson's disease (Tan, 2016), intellectual disability (Sharp et al., 2006), autistic spectrum disorders (Sato et al., 2012; Vaags et al., 2012), and heritable cancers…”
BackgroundThe Role of Genetics in Alzheimer's Disease and Parkinson's Disease
Porter, T., Gozt, A., Mastaglia, F. L., & Laws, S. M. (2019) · Wiley eBooks · doi:10.1002/9781119356752.ch15 · Cited by 7 · see citing works
Akinwande, K. S., Whitehead, P. G., Diala, S., Coker, M. M., Adams, L. D., Ogunronbi, M., Balogun, O., Boateng, R., Kudzi, W., Falayi, A. T., et al. (2025) · Alzheimer s & Dementia · doi:10.1002/alz.70559 · Cited by 5 · see citing works
SNP-by-CpG Site Interactions in ABCA7 Are Associated with Cognition in Older African Americans
Chaar, D., Nguyen, K. A., Wang, Y.-Z., Ratliff, S. M., Mosley, T. H., Kardia, S. L. R., Smith, J. A., & Zhao, W. (2022) · Genes · doi:10.3390/genes13112150 · Cited by 5 · see citing works
Sinha, N., Fausto, B. A., Mander, B. A., & Gluck, M. A. (2023) · Journal of Alzheimer s Disease · doi:10.3233/jad-230043 · Cited by 5 · see citing works
“Similarly, a 44-base pair frameshift deletion in ABCA7 rs115550680 was associated with AD in African Americans [25].”
Tayran, H., Yılmaz, E., Bhattarai, P., Min, Y., Wang, X., Ma, Y., Nelson, N. N., Kassara, N., Coşacak, M. İ., Dogru, R. M., et al. (2024) · Alzheimer s & Dementia · doi:10.1002/alz.089273 · Cited by 6 · see citing works
A comparative study of structural variant calling in WGS from Alzheimer’s disease families
Malamon, J. S., Farrell, J. J., Xia, L. C., Dombroski, B. A., Das, G., Way, J., Kuzma, A. B., Valladares, O., Leung, Y. Y., Scanlon, A. J., et al. (2024) · Life Science Alliance · doi:10.26508/lsa.202302181 · Cited by 5 · see citing works
“Subsequent work in a larger sample showed that the deletion was associated with AD in African American populations (Cukier et al, 2016).”
BackgroundAlzheimer’s disease: a step closer to understanding type 3 diabetes in African Americans
Ferguson, S. A., Panos, J., Sloper, D. T., Varma, V., & Sarkar, S. (2021) · Metabolic Brain Disease · doi:10.1007/s11011-021-00754-z · Cited by 5 · see citing works
A genome-wide association study in Peruvians suggests new risk loci for Alzheimer DiseasePreprint
Akgün, B., Cornejo‐Olivas, M., Custodio, N., Mena, P. R., Soto‐Añari, M., Montesinos, R., Adams, L. D., Celis, K., Yang, Z., Huaman, B. C., et al. (2023) · medRxiv · doi:10.1101/2023.11.29.23299201 · Cited by 5 · see citing works
Górska, A. M., Santos‐García, I., Kvasnička, A., Dobešová, D., Friedecký, D., Gildenblat, J., & Pahnke, J. (2026) · Progress in Neurobiology · doi:10.1016/j.pneurobio.2026.102891 · Cited by 5 · see citing works
Gardner, O. K., Booven, D. V., Wang, L., Gu, T., Hofmann, N. K., Whitehead, P. L., Nuytemans, K., Hamilton‐Nelson, K. L., Adams, L. D., Starks, T. D., et al. (2022) · Human Molecular Genetics · doi:10.1093/hmg/ddac075 · Cited by 3 · see citing works
Liu, D., Zhang, H., Cao, L., Liu, J., Liu, Y., Bai, N., Zhou, Q., Xu, Z., Li, L., & Liu, H. (2024) · Frontiers in Aging Neuroscience · doi:10.3389/fnagi.2024.1406573 · Cited by 3 · see citing works
Akgün, B., Gulyayev, A. V., Coker, M. M., Hamilton‐Nelson, K. L., Olalusi, O., Adams, L. D., Akinwande, K., Whitehead, P. G., Diala, S., Ogunronbi, M., et al. (2025) · Alzheimer s & Dementia · doi:10.1002/alz.70583 · Cited by 2 · see citing works
Multi-ancestry studies in multi-omics of Alzheimer’s disease: Recent insights and future directions
Shir, D., Seifar, F., & Ertekin‐Taner, N. (2026) · Current Opinion in Neurobiology · doi:10.1016/j.conb.2026.103205 · Cited by 2 · see citing works
Garliyev, V., Lyssenko, C. A., Wiener, J. P., Praticò, D., & Lyssenko, N. N. (2024) · Journal of Neuropathology & Experimental Neurology · doi:10.1093/jnen/nlae060 · Cited by 2 · see citing works
Schultheis, N., Connell, A., Kapral, A., Becker, R. J., Mueller, R., Shah, S., O’Donnell, M., Roseman, M., Swanson, L., DeGuara, S., et al. (2024) · iScience · doi:10.1016/j.isci.2024.110256 · Cited by 2 · see citing works
“30,31 Anothergeneof interestin lipid biology is PCSK9 , which encodes a regulator of low-density lipoprotein (LDL) receptor levels on the cell surface by altering intracellular trafficking.”
Algahtani, H. A., Shirah, B. H., Alshareef, A., Al-Qahtani, M. H., Abdulkareem, A. A., & Naseer, M. I. (2020) · Intractable & Rare Diseases Research · doi:10.5582/irdr.2020.03033 · Cited by 2 · see citing works
A comprehensive analysis of copy number variation in a Turkish dementia cohort
Dehghani, N., Güven, G., Kun‐Rodrigues, C., Gouveia, C., Foster, K., Hanağası, H. A., Lohmann, E., Samancı, B., Gurvit, H. I., Bılgıç, B., et al. (2021) · Human Genomics · doi:10.1186/s40246-021-00346-z · Cited by 1 · see citing works
“In two loci genomewide associated with AD, structural variants have also been reported to be associated with disease risk: an 8-kb insertion in CR1 that creates the CR1-S isoform harboring an extra set of C3b/C4b binding sites [10], and a 44 base-pair frameshift deletion in ABCA7 that increases AD risk in African Amer…”
BackgroundGenetics of Alzheimer's disease: an update
Tang, M., & Reitz, C. (2017) · Future Neurology · doi:10.2217/fnl-2017-0003
Achouri-Rassas, A., Fray, S., Saied, Z., Sassi, S. B., Ali, N., & Baraket, G. (2025) · Neurological Research · doi:10.1080/01616412.2025.2472841 · Cited by 1 · see citing works
“The AA risk allele was sequenced with the following primers (rs115550680-F: GCCAATATGGCAAAAACCATC, rs115550680-R: TCCAAAACCCTGTGATAGCC) to generate a 245-bp amplicon [15].”
Biswas, E. E., Alturkestani, A. A., Jones, J., Korth, J., Affet, S., Ha, M., & Biswas, S. B. (2017) · Springer eBooks · doi:10.1007/978-3-319-67199-4_166 · Cited by 1 · see citing works
Malamon, J. S., Farrell, J. J., Xia, L. C., Dombroski, B. A., Lee, W., Das, G., Vardarajan, B. N., Way, J., Kuzma, A. B., Valladares, O., et al. (2022) · bioRxiv (Cold Spring Harbor Laboratory) · doi:10.1101/2022.05.19.492472 · Cited by 1 · see citing works
“Subsequent work in a larger sample showed that the deletion was associated with AD in African American populations (68 ).”
BackgroundRajabli, F., Feliciano‐Astacio, B. E., Cukier, H. N., Wang, L., Griswold, A. J., Hamilton‐Nelson, K. L., Adams, L. D., Rodríguez, V., Mena, P. R., Tejada, S. J., et al. (2020) · bioRxiv (Cold Spring Harbor Laboratory) · doi:10.1101/2020.03.10.986083
“Macdonald Foundation Department of Human Genetics, University of Miami, Miami, FL, USA (5)Hospital De Psiquiatría Estatal Dr.”
BackgroundBiswas, E. E., Alturkestani, A. A., Jones, J., Korth, J., Affet, S., Ha, M., & Biswas, S. B. (2017) · Springer eBooks · doi:10.1007/978-1-4614-6438-9_166-1
Renton, A. E., & Goate, A. (2017) · Oxford University Press eBooks · doi:10.1093/med/9780190681425.003.0051
Analysis of transporter activity in an Alzheimer’s disease blood-brain barrier cell model
Chaves, J. (2024) · Queensland University of Technology · doi:10.5204/thesis.eprints.248279
Degenerative Disorders of Cognition
O’Brien, K. S., Mechanic-Hamilton, D. J., Rascovsky, K., & Hamilton, R. H. (2024) · Springer eBooks · doi:10.1007/978-3-031-62727-9_4
Additional file 5 of A comprehensive analysis of copy number variation in a Turkish dementia cohort
Dehghani, N., Güven, G., Kun‐Rodrigues, C., Gouveia, C., Foster, K., Hanagasi, H., Lohmann, E., Samancı, B., Gurvit, H. I., Bilgiç, B., et al. (2021) · Figshare · doi:10.6084/m9.figshare.15071686
Additional file 2 of A comprehensive analysis of copy number variation in a Turkish dementia cohort
Dehghani, N., Güven, G., Kun‐Rodrigues, C., Gouveia, C., Foster, K., Hanagasi, H., Lohmann, E., Samancı, B., Gurvit, H. I., Bilgiç, B., et al. (2021) · Figshare · doi:10.6084/m9.figshare.15071677
Additional file 1 of A comprehensive analysis of copy number variation in a Turkish dementia cohort
Dehghani, N., Güven, G., Kun‐Rodrigues, C., Gouveia, C., Foster, K., Hanagasi, H., Lohmann, E., Samancı, B., Gurvit, H. I., Bilgiç, B., et al. (2021) · Figshare · doi:10.6084/m9.figshare.15071674
Additional file 3 of A comprehensive analysis of copy number variation in a Turkish dementia cohort
Dehghani, N., Güven, G., Kun‐Rodrigues, C., Gouveia, C., Foster, K., Hanagasi, H., Lohmann, E., Samancı, B., Gurvit, H. I., Bilgiç, B., et al. (2021) · Figshare · doi:10.6084/m9.figshare.15071680
Additional file 4 of A comprehensive analysis of copy number variation in a Turkish dementia cohort
Dehghani, N., Güven, G., Kun‐Rodrigues, C., Gouveia, C., Foster, K., Hanagasi, H., Lohmann, E., Samancı, B., Gurvit, H. I., Bilgiç, B., et al. (2021) · Figshare · doi:10.6084/m9.figshare.15071683
Additional file 6 of A comprehensive analysis of copy number variation in a Turkish dementia cohort
Dehghani, N., Güven, G., Kun‐Rodrigues, C., Gouveia, C., Foster, K., Hanagasi, H., Lohmann, E., Samancı, B., Gurvit, H. I., Bilgiç, B., et al. (2021) · Figshare · doi:10.6084/m9.figshare.15071689
Disrupted lipid homeostasis as a pathogenic mechanism in ABCA7 ‐associated Alzheimer's disease risk
Nam, Y., DeRosa, B. A., Ramírez, A. M., Ayele, B. A., Whitehead, P. L., Adams, L. D., Golightly, C. G., Starks, T. D., Laverde-Paz, M. J., Cukier, H. N., et al. (2026) · Alzheimer s & Dementia · doi:10.1002/alz.71312
“20 This ABCA7 deletion produces a frameshift mutation (p.Arg578Alafs) predicted to encode a truncated protein containing only 2 of the 12 transmembrane domains and lacking both nucleotide-binding domains (Figure 1A).”
InfluentialAdvancements in the Study of Missense Mutations in ABCA7 in Alzheimer’s Disease
Liu, L., & Zhu, B. (2026) · Journal of Molecular Neuroscience · doi:10.1007/s12031-026-02526-9
“For example, the PTC variant rs142076058 (p.Arg578Alafs) has been demonstrated to significantly increase the risk of AD in African Americans (Cukier et al. 2016).”
InfluentialLee, S., English, A. C., Peloso, G. M., Bis, J. C., Boerwinkle, E., Choi, S. H., Heard‐Costa, N. L., Lin, H., Xia, R., Seshadri, S. S., et al. (2026) · Genome biology · doi:10.1186/s13059-026-04206-8
“This deletion is located approximately 3 kb downstream of a previously reported 44-bp deletion (rs142076058) associated with AD risk in African American individuals [46].”
Heuer, S. E., Ahsan, F., Terzioglu, G., Misra, A., Duong, D. D., Katkar, C., Giera, M., van der Kant, R., Seyfried, N., & Young-Pearse, T. L. (2026) · bioRxiv · doi:10.64898/2026.10.16.759681
“Because TGs are major constituents of lipid droplets (LDs) (91), and accumulation of polyunsaturated TGs has previously been associated with LD accumulation in APOE4/4 astrocytes (18,92), we directly measured LD abundance.”
Influential
- Authors
- Cukier, H. N., Kunkle, B. W., Vardarajan, B. N., Rolati, S., Hamilton-Nelson, K. L., Kohli, M. A., Whitehead, P. L., Dombroski, B. A., Van Booven, D., Lang, R., Dykxhoorn, D. M., Farrer, L. A., Cuccaro, M. L., Vance, J. M., Gilbert, J. R., Beecham, G. W., Martin, E. R., Carney, R. M., Mayeux, R., Schellenberg, G. D., Byrd, G. S., Haines, J. L., Pericak-Vance, M. A., For the Alzheimer's Disease Genetics Consortium, Alzheimer's Disease Genetics Consortium, Albert, M. S., Albin, R. L., Apostolova, L. G., Arnold, S. E., Asthana, S., Atwood, C. S., Baldwin, C. T., Barmada, M. M., Barnes, L. L., Barral, S., Beach, T. G., Becker, J. T., Beecham, G. W., Beekly, D., Bennett, D. A., Bigio, E. H., Bird, T. D., Blacker, D., Boeve, B. F., Boxer, A., Burke, J. R., Burns, J. M., Buxbaum, J. D., Byrd, G. S., Cai, G., Cairns, N. J., Cantwell, L. B., Cao, C., Carlsson, C. M., Carney, R. M., Carrasquillo, M. M., Carroll, S. L., Chui, H. C., Clark, D. G., Cribbs, D. H., Crocco, E. A., Cruchaga, C., De Jager, P. L., DeCarli, C., Demirci, F. Y., Dick, M., Dickson, D. W., Duara, R., Ertekin-Taner, N., Evans, D. A., Faber, K. M., Fallin, M. D., Fallon, K. B., Fardo, D. W., Farlow, M. R., Farrer, L. A., Ferris, S., Foroud, T. M., Frosch, M. P., Galasko, D. R., Gearing, M., Geschwind, D. H., Ghetti, B., Gilbert, J. R., Go, R. C. P., Goate, A. M., Graff-Radford, N. R., Green, R. C., Griffith, P., Growdon, J. H., Haines, J. L., Hakonarson, H., Hamilton, R. L., Hamilton-Nelson, K. L., Haroutunian, V., Harrell, L. E., Honig, L. S., Huebinger, R. M., Hulette, C. M., Hyman, B. T., Jicha, G. A., Jin, L.-W., Jun, G., Kamboh, M. I., Karydas, A., Kauwe, J. S. K., Kaye, J. A., Kim, R., Kowall, N. W., Kramer, J. H., Kukull, W. A., Kunkle, B. W., LaFerla, F. M., Lah, J. J., Lang-Walker, R., Larson, E. B., Leverenz, J. B., Levey, A. I., Li, G., Lieberman, A. P., Logue, M. W., Lopez, O. L., Lunetta, K. L., Lyketsos, C. G., Mack, W. J., Manly, J. J., Marson, D. C., Martin, E. R., Martiniuk, F., Mash, D. C., Masliah, E., Mayeux, R., McKee, A. C., Mesulam, M., Miller, B. L., Miller, C. A., Miller, J. W., Montine, T. J., Morris, J. C., Murrell, J. R., Naj, A. C., Obisesan, T. O., Olichney, J. M., Pankratz, V. S., Parisi, J. E., Partch, A., Paulson, H. L., Pericak-Vance, M. A., Perry, W., Peskind, E., Petersen, R. C., Pierce, A., Poon, W. W., Potter, H., Quinn, J. F., Raj, A., Raj, T., Raskind, M., Reiman, E. M., Reisberg, B., Reitz, C., Ringman, J. M., Roberson, E. D., Rosen, H. J., Rosenberg, R. N., Sager, M. A., Sano, M., Saykin, A. J., Schellenberg, G. D., Schneider, J. A., Schneider, L. S., Seeley, W. W., Smith, A. G., Sonnen, J. A., Spina, S., Stern, R. A., Swerdlow, R. H., Tanzi, R. E., Thornton-Wells, T. A., Trojanowski, J. Q., Troncoso, J. C., Tsuang, D. W., Valladares, O., Van Deerlin, V. M., Van Eldik, L. J., Vardarajan, B. N., Vinters, H. V., Vonsattel, J. P., Wang, L.-S., Weintraub, S., Welsh-Bohmer, K. A., Williamson, J., Wingo, T. S., Wishnek, S., Woltjer, R. L., Wright, C. B., Younkin, S. G., Yu, C.-E., & Yu, L.
- Affiliations
- Boston University (US)
- From the John P. Hussman Institute for Human Genomics (H.N.C., B.W.K., S.R., K.L.H.-N., M.A.K., P.L.W., D.V.B., D.M.D., M.L.C., J.M.V., J.R.G., G.W.B., E.R.M., R.M.C., M.A.P.-V.), Department of Neurology (H.N.C., J.M.V., M.A.P.-V.), Dr. John T. Macdonald Foundation Department of Human Genetics (D.M.D., M.L.C., J.M.V., J.R.G., G.W.B., E.R.M., R.M.C.), Miller School of Medicine, University of Miami, FL; The Taub Institute for Research on Alzheimer's Disease and the Aging Brain (B.N.V., R.M.), Gertrude...
- ORCID
- Cukier, Holly N.
- Dombroski, Beth A.
- Dykxhoorn, Derek M.
- Cuccaro, Michael L.
- Vance, Jeffery M.
- Albert, Marilyn S.
- Albin, Roger L.
- Apostolova, Liana G.
- Arnold, Steven E.
- Asthana, Sanjay
- Atwood, Craig S.
- Barmada, M. Michael
- Barnes, Lisa L.
- Beach, Thomas G.
- Becker, James T.
- Bennett, David A.
- Bigio, Eileen H.
- Bird, Thomas D.
- Blacker, Deborah
- Boeve, Bradley F.
- Boxer, Adam
- Burke, James R.
- Burns, Jeffrey M.
- Buxbaum, Joseph D.
- Cairns, Nigel J.
- Cao, Chuanhai
- Carlsson, Cynthia M.
- Carrasquillo, Minerva M.
- Carroll, Steven L.
- Chui, Helena C.
- Clark, David G.
- Cribbs, David H.
- Crocco, Elizabeth A.
- Cruchaga, Carlos
- DeCarli, Charles
- Demirci, F. Yesim
- Dickson, Dennis W.
- Duara, Ranjan
- Evans, Denis A.
- Faber, Kelley M.
- Fallin, M. Daniele
- Fardo, David W.
- Farlow, Martin R.
- Ferris, Steven
- Foroud, Tatiana M.
- Frosch, Matthew P.
- Galasko, Douglas R.
- Gearing, Marla
- Geschwind, Daniel H.
- Ghetti, Bernardino
- Goate, Alison M.
- Green, Robert C.
- Griffith, Patrick
- Hakonarson, Hakon
- Hamilton, Ronald L.
- Haroutunian, Vahram
- Honig, Lawrence S.
- Huebinger, Ryan M.
- Hyman, Bradley T.
- Jicha, Gregory A.
- Jun, Gyungah
- Kamboh, M. Ilyas
- Kauwe, John S.K.
- Kaye, Jeffrey A.
- Kowall, Neil W.
- Kramer, Joel H.
- Kukull, Walter A.
- LaFerla, Frank M.
- Lah, James J.
- Larson, Eric B.
- Leverenz, James B.
- Levey, Allan I.
- Lieberman, Andrew P.
- Logue, Mark W.
- Lunetta, Kathryn L.
- Lyketsos, Constantine G.
- Mack, Wendy J.
- Manly, Jennifer J.
- Marson, Daniel C.
- Martiniuk, Frank
- Mash, Deborah C.
- Masliah, Eliezer
- McKee, Ann C.
- Mesulam, Marsel
- Miller, Bruce L.
- Montine, Thomas J.
- Morris, John C.
- Murrell, Jill R.
- Naj, Adam C.
- Obisesan, Thomas O.
- Olichney, John M.
- Pankratz, Vernon S.
- Paulson, Henry L.
- Peskind, Elaine
- Petersen, Ronald C.
- Poon, Wayne W.
- Potter, Huntington
- Quinn, Joseph F.
- Raj, Towfique
- Raskind, Murray
- Reiman, Eric M.
- Reisberg, Barry
- Reitz, Christiane
- Ringman, John M.
- Roberson, Erik D.
- Rosen, Howard J.
- Sano, Mary
- Saykin, Andrew J.
- Schneider, Julie A.
- Schneider, Lon S.
- Seeley, William W.
- Smith, Amanda G.
- Sonnen, Joshua A.
- Spina, Salvatore
- Stern, Robert A.
- Swerdlow, Russell H.
- Tanzi, Rudolph E.
- Trojanowski, John Q.
- Troncoso, Juan C.
- Tsuang, Debby W.
- Valladares, Otto
- Vinters, Harry V.
- Wang, Li-San
- Welsh-Bohmer, Kathleen A.
- Williamson, Jennifer
- Wingo, Thomas S.
- Woltjer, Randall L.
- Yu, Chang-En
- Yu, Lei
- Venue
- Neurology Genetics
- Published
- 2016-06
- Volume
- 2
- Issue
- 3
- Pages
- e79-e79
- ISSN
- 2376-7839 (ISSN-L)
- PMC
- PMC4871806
- OpenAlex
- W2401203110
- Cited by
- 100
- References
- 45
- Citations by year
- 2026: 6 · 2025: 7 · 2024: 15 · 2023: 9 · 2022: 12 · 2021: 16 · 2020: 9 · 2019: 7 · 2018: 9 · 2017: 9 · 2016: 1
- FWCI
- 6.98
- Type
- journal article
- Language
- en
- Open access
- gold
- doi.org
- Licence
- cc-by-nc-nd
- Locations
- Neurology Genetics (publishedVersion, cc-by-nc-nd)
- Europe PMC (PubMed Central) (publishedVersion, cc-by-nc-nd)
- PubMed Central (publishedVersion, cc-by-nc-nd)
- PubMed (publishedVersion)
- eScholarship (California Digital Library) (submittedVersion, cc-by-nc-nd)
- eScholarship (California Digital Library) (submittedVersion)
- Columbia Academic Commons (Columbia University)
- Funders
- National Institute on Aging (RF1AG015473, R01AG048927, P30AG010124, U01AG032984, R01AG041797, P30AG013846, U24AG056270, U24AG021886)
- Topics
- Health Sciences › Medicine › Physiology › Alzheimer's disease research and treatments
- Health Sciences › Medicine › Psychiatry and Mental health › Dementia and Cognitive Impairment Research
- Life Sciences › Biochemistry, Genetics and Molecular Biology › Genetics › Genetic Associations and Epidemiology
- Keywords
- ABCA7, Alzheimer's disease, frameshift deletion, African Americans, late-onset Alzheimer's disease, genetic risk variants, linkage disequilibrium, co-segregation, apolipoprotein E
About these checks
Registry, retraction, Cites and statistics results are computed, not judged, with one exception: a printed reference that no index lists is read once by a model before it counts as a citation error. Claims are extracted by a model and kept only when their quote appears verbatim in the text; each cited source is then checked, with a model’s help, for whether it says what the claim relies on. Those verdicts can be wrong — read the claim’s quote and the cited source before relying on one.
Statistics and arithmetic are recomputed, not judged.
Confidence bands are shown only for fields calibrated on our annotated test set. None is calibrated yet, so no band is shown.
What counts as a claim ›How we measure confidence ›How we check this ›
Are you an author, or do you see a problem with this page? Request a review
