Atlantic salmon (Salmo salar L.) as a marine functional source of gamma-tocopherol
Open accessAbstract
Gamma tocopherol (gT) exhibits beneficial cardiovascular effects partly due to its anti-inflammatory activity. Important sources of gT are vegetable oils. However, little is known to what extent gT can be transferred into marine animal species such as Atlantic salmon by feeding. Therefore, in this study we have investigated the transfer of dietary gT into salmon. To this end, fish were fed a diet supplemented with 170 ppm gT for 16 weeks whereby alpha tocopherol levels were adjusted to 190 ppm in this and the control diet. Feeding gT-rich diets resulted in a three-fold increase in gT concentrations in the liver and fillet compared to non-gT-supplemented controls. Tissue alpha tocopherol levels were not decreased indicating no antagonistic interaction between gamma- and alpha tocopherol in salmon. The concentration of total omega 3 fatty acids slightly increased in response to dietary gT. Furthermore, dietary gT significantly decreased malondialdehyde in the fillet, determined as a biomarker of lipid peroxidation. In the liver of gT fed salmon we observed an overall down-regulation of genes involved in lipid homeostasis. Additionally, gT improved the antioxidant capacity by up-regulating Gpx4a gene expression in the pyloric caeca. We suggest that Atlantic salmon may provide a marine functional source capable of enriching gT for human consumption.
The claims and statistics of this paper haven’t been checked yet.
Run the check — free, no account needed. It reads the open-access text and checks the sources it cites.
Integrity signals
Registry
Cites
Statistics
Claims the paper makes
The claims and statistics of this paper haven’t been checked yet.
Run the check — free, no account needed. It reads the open-access text and checks the sources it cites.
Claims other papers make about this one
Each is checked against this paper’s own text: does it say what the citing paper says it does?
EPA and DHA are prone to lipid peroxidation because of the presence of double bonds.
“Like many other PUFAs, EPA and DHA are prone to lipid peroxidation because of the presence of double bonds [44].”
From Novel Insights on Intake of Fish and Prevention of Sarcopenia: All Reasons for an Adequate Consumption (2020) · cites this paper as [44]
Self-check
Percentages, sums and reported differences re-computed from the paper’s own numbers.
The self-check needs the paper’s full text.
Cites
Marklund, S. L., & MARKLUND, G. (1974) · European Journal of Biochemistry · doi:10.1111/j.1432-1033.1974.tb03714.x · Cited by 10,382 · cited 2× · see citing works
“Marklund, S.; Marklund, G. Involvement of the superoxide anion radical in the autoxidation of pyrogallol and a convenient assay for superoxide dismutase.”
MethodPfaffl, M. W., Tichopad, A., Prgomet, C., & Neuvians, T. P. (2004) · Biotechnology Letters · doi:10.1023/b:bile.0000019559.84305.47 · Cited by 5,065 · cited 1× · see citing works
“The geometric mean of the reference genes β-actin and EF-1α was used to correct Ct values of target genes [47].”
Statistical analysis of real-time PCR data
Yuan, J. S., Reed, A., Chen, F., & Stewart, C. N. (2006) · BMC Bioinformatics · doi:10.1186/1471-2105-7-85 · Cited by 2,192 · cited 1× · see citing works
“, Cary, NC, USA) [45].”
A spectrophotometric method for determination of catalase activity in small tissue samples
Johansson, L. H., & Borg, L. (1988) · Analytical Biochemistry · doi:10.1016/0003-2697(88)90554-4 · Cited by 1,097 · cited 2× · see citing works
“Johansson, L.H.; Borg, L.A.”
Methodγ-Tocopherol, the major form of vitamin E in the US diet, deserves more attention
Jiang, Q., Christen, S., Shigenaga, M. K., & Ames, B. N. (2001) · The American Journal of Clinical Nutrition · doi:10.1093/ajcn/74.6.714 · Cited by 776 · cited 2× · see citing works
“Gamma tocopherol (gT) occurs at high concentrations in plant-derived oils including soya- and rapeseed oil [9,10].”
BackgroundThies, F., Garry, J. M., Yaqoob, P., Rerkasem, K., Williams, J., Shearman, C. P., Gallagher, P. J., Calder, P. C., & Grimble, R. F. (2003) · The Lancet · doi:10.1016/s0140-6736(03)12468-3 · Cited by 739 · cited 1× · see citing works
“Oily fish, such as Atlantic salmon, is an important source of long chain omega 3 fatty acids including eicosapentaenoic acid (EPA; C20:5n-3) and docosahexaenoic acid (DHA; C22:6n-3) which may exhibit beneficial cardiovascular effects [2–4].”
BackgroundChristen, S., Woodall, A., Shigenaga, M. K., Southwell‐Keely, P. T., Duncan, M. W., & Ames, B. N. (1997) · Proceedings of the National Academy of Sciences · doi:10.1073/pnas.94.7.3217 · Cited by 537 · cited 1× · see citing works
“In this context, it is postulated that gT acts as a trap for electrophilic nitrogen oxides forming stable carbon-centered adducts through the nucleophilic 5-position [11].”
BackgroundJiang, Q., Elson‐Schwab, I., Courtemanche, C., & Ames, B. N. (2000) · Proceedings of the National Academy of Sciences · doi:10.1073/pnas.200357097 · Cited by 524 · cited 2× · see citing works
“Interestingly, gT, but not alpha tocopherol, inhibited cyclooxygenase 2 in cultured macrophages, thereby mediating potent anti-inflammatory activity [12].”
BackgroundMolecular mechanism of α-tocopherol action
Azzi, A. (2007) · Free Radical Biology and Medicine · doi:10.1016/j.freeradbiomed.2007.03.013 · Cited by 380 · see citing works
Health Benefits of n-3 Polyunsaturated Fatty Acids
Siriwardhana, N., Kalupahana, N. S., & Moustaïd‐Moussa, N. (2012) · Advances in food and nutrition research · doi:10.1016/b978-0-12-416003-3.00013-5 · Cited by 368 · see citing works
Torstensen, B. E., Espe, M., Sanden, M., Stubhaug, I., Waagbø, R., Hemre, G.-I., Fontanillas, R., Nordgarden, U., Hevrøy, E. M., Olsvik, P. A., et al. (2008) · Aquaculture · doi:10.1016/j.aquaculture.2008.08.025 · Cited by 265 · cited 1× · see citing works
“Feeds were analyzed for moisture, total fat, protein and ash by using in-house near-infrared reflectance (NIR) methodology at the Skretting ARC laboratory as previously described by [33].”
MethodSteibel, J. P., Poletto, R., Coussens, P. M., & Rosa, G. J. M. (2009) · Genomics · doi:10.1016/j.ygeno.2009.04.008 · Cited by 261 · cited 1× · see citing works
“[46].”
Leaver, M. J., Villeneuve, L., Obach, A., Jensen, L. B., Bron, J. E., Tocher, D. R., & Taggart, J. B. (2008) · BMC Genomics · doi:10.1186/1471-2164-9-299 · Cited by 236 · cited 7× · see citing works
“Δ6fad_a CCCCAGACGTTTGTGTCAG CCTGGATTGTTGCTTTGGAT [42]”
BackgroundInfluentialDual electrode liquid chromatography detector for thiols and disulfides
Allison, L. A., & Shoup, R. E. (1983) · Analytical Chemistry · doi:10.1021/ac00252a006 · Cited by 235 · cited 1× · see citing works
“Glutathione (GSH) was detected according to a modified method described previously [37].”
MethodRegulation of cell signalling by vitamin E
Rimbach, G. H., Minihane, A. M., Majewicz, J., Fischer, A., Pallauf, J., Virgli, F., & Weinberg, P. D. (2002) · Proceedings of The Nutrition Society · doi:10.1079/pns2002183 · Cited by 220 · cited 1× · see citing works
“In addition to its antioxidant function, important gene-regulatory properties of Vitamin E have been described [7,8].”
BackgroundMalav, O. P., Talukder, S., Gokulakrishnan, P., & Chand, S. (2013) · Critical Reviews in Food Science and Nutrition · doi:10.1080/10408398.2012.689381 · Cited by 212 · see citing works
Metabolism, interactions, requirements and functions of vitamin E in fish
Hamre, K. (2010) · Aquaculture Nutrition · doi:10.1111/j.1365-2095.2010.00806.x · Cited by 211 · cited 3× · see citing works
“analyzed alpha and gamma tocopherol levels in liver and fillet suggest that the tissue retention of alpha tocopherol was higher as compared to gamma tocopherol which is in line with literature data [14].”
BackgroundResultInfluentialHuang, H.-Y., & Appel, L. J. (2003) · Journal of Nutrition · doi:10.1093/jn/133.10.3137 · Cited by 189 · see citing works
Modulation of signal transduction by vitamin E
Zingg, J.-M. A. (2007) · Molecular Aspects of Medicine · doi:10.1016/j.mam.2006.12.009 · Cited by 170 · see citing works
Minghetti, M., Leaver, M. J., & Tocher, D. R. (2010) · Biochimica et Biophysica Acta (BBA) - Molecular and Cell Biology of Lipids · doi:10.1016/j.bbalip.2010.12.008 · Cited by 165 · cited 4× · see citing works
“Elov5a ACAAGACAGGAATCTCTTTCAGATTAA TCTGGGGTTACTGTGCTATAGTGTAC [43]”
InfluentialProtection against glutamate-induced cytotoxicity in C6 glial cells by thiol antioxidants
Han, D., Sen, C. K., Roy, S., Kobayashi, M. S., Tritschler, H., & Packer, L. (1997) · American Journal of Physiology-Regulatory, Integrative and Comparative Physiology · doi:10.1152/ajpregu.1997.273.5.r1771 · Cited by 135 · cited 1× · see citing works
“HPLC-EC detection of GSH was performed using an ESA (Chelmsford, MA, USA) colorimetric detector [38].”
MethodGene-Regulatory Activity of α-Tocopherol
Rimbach, G. H., Moehring, J., Huebbe, P., & Lodge, J. K. (2010) · Molecules · doi:10.3390/molecules15031746 · Cited by 130 · see citing works
Barella, L., Muller, P. Y., Schlachter, M., Hunziker, W. H., Stöcklin, E., Spitzer, V., Meier, N., de Pascual‐Teresa, S., Minihane, A. M., & Rimbach, G. H. (2004) · Biochimica et Biophysica Acta (BBA) - Molecular Basis of Disease · doi:10.1016/j.bbadis.2004.02.002 · Cited by 112 · cited 1× · see citing works
“In addition to its antioxidant function, important gene-regulatory properties of Vitamin E have been described [7,8].”
BackgroundMorais, S., Silva, T. S., Cordeiro, O. D., Rodrigues, P. M., Guy, D. R., Bron, J. E., Taggart, J. B., Bell, J. G., & Tocher, D. R. (2012) · BMC Genomics · doi:10.1186/1471-2164-13-448 · Cited by 105 · cited 1× · see citing works
“Different gene expression patterns of elongases and desaturases have been reported in the liver and pyloric caeca of salmon fed vegetable oils [28,29].”
BackgroundRole of ω3 Longchain Polyunsaturated Fatty Acids in Reducing Cardio- Metabolic Risk Factors
Abeywardena, M. Y., & Patten, G. S. (2011) · Endocrine Metabolic & Immune Disorders - Drug Targets · doi:10.2174/187153011796429817 · Cited by 104 · cited 1× · see citing works
“Oily fish, such as Atlantic salmon, is an important source of long chain omega 3 fatty acids including eicosapentaenoic acid (EPA; C20:5n-3) and docosahexaenoic acid (DHA; C22:6n-3) which may exhibit beneficial cardiovascular effects [2–4].”
BackgroundDiets to prevent coronary heart disease 1957–2013: what have we learned
Dalen, J. E., & Devries, S. (2014) · The American Journal of Medicine · doi:10.1016/j.amjmed.2013.12.014 · Cited by 94 · cited 1× · see citing works
“There is evidence that the consumption of oily fish may significantly decrease cardiovascular disease risk in humans [1].”
BackgroundDoes dietary tocopherol level affect fatty acid metabolism in fish?
Mourente, G., Bell, J. G., & Tocher, D. R. (2007) · Fish Physiology and Biochemistry · doi:10.1007/s10695-007-9139-4 · Cited by 90 · see citing works
Scientific Opinion on Fish Oil for Human Consumption. Food Hygiene, including Rancidity
(BIOHAZ), E. P. O. B. H. (2010) · EFSA Journal · doi:10.2903/j.efsa.2010.1874 · Cited by 85 · see citing works
A laboratory efficient method for intramuscular fat analysis
Segura, J., & López-Bote, C. J. (2013) · Food Chemistry · doi:10.1016/j.foodchem.2013.08.131 · Cited by 72 · cited 3× · see citing works
“Segura, J.; Lopez-Bote, C.J.”
MethodInfluentialMalandrakis, E. E., Exadactylos, A., Dadali, O., Golomazou, E., Klaoudatos, S., & Panagiotaki, P. (2013) · Comparative Biochemistry and Physiology Part B Biochemistry and Molecular Biology · doi:10.1016/j.cbpb.2013.11.005 · Cited by 70 · cited 1× · see citing works
“[31] suggested that the GPx status, which was improved by gamma tocopherol in our study, might be considered as an important indicator of fish welfare.”
BackgroundLandrier, J., Gouranton, E., Reboul, E., Cardinault, N., Yazidi, C. E., Malezet‐Desmoulins, C., André, M., Nowicki, M., Souidi, M., & Borel, P. (2010) · The Journal of Nutritional Biochemistry · doi:10.1016/j.jnutbio.2009.10.008 · Cited by 64 · cited 1× · see citing works
“Studies in hepatocytes and Caco-2 cells have shown a decrease in cholesterol synthesis and secretion due to tocopherols via down-regulation of LXR, BCA1, ABCG1, SREBP1c or SREBP-2 transcription factors [22,23].”
BackgroundGrahl‐Nielsen, O., & Barnung, T. N. (1985) · Marine Environmental Research · doi:10.1016/0141-1136(85)90090-x · Cited by 63 · see citing works
Novel Transcriptional Activities of Vitamin E: Inhibition of Cholesterol Biosynthesis
Valastyan, S., Thakur, V., Johnson, A., Kumar, K., & Manor, D. (2007) · Biochemistry · doi:10.1021/bi701432q · Cited by 62 · cited 2× · see citing works
“Additionally, there is evidence that alpha tocopherol can modulate the expression and activity of Δ9 and Δ6 fad [22,24].”
BackgroundChristen, S., Jiang, Q., Shigenaga, M. K., & Ames, B. N. (2002) · Journal of Lipid Research · doi:10.1194/jlr.d200023-jlr200 · Cited by 46 · see citing works
Distribution of α‐and γ‐tocopherols in Atlantic salmon (Salmo salar) tissues
Parazo, M. M., Lall, S. P., Castell, J. D., & ACKMAN, R. G. (1998) · Lipids · doi:10.1007/s11745-998-0259-x · Cited by 40 · see citing works
Modulated phases of phospholipid bilayers induced by tocopherols
Kamal, M. A., & Raghunathan, V. A. (2012) · Biochimica et Biophysica Acta (BBA) - Biomembranes · doi:10.1016/j.bbamem.2012.06.016 · Cited by 39 · cited 1× · see citing works
“Moreover, gT exerts different structural influence on the membrane than alpha tocopherol [26].”
BackgroundMorais, S., Taggart, J. B., Guy, D. R., Bell, J. G., & Tocher, D. R. (2012) · BMC Genomics · doi:10.1186/1471-2164-13-410 · Cited by 37 · see citing works
Wang, L., Harris, S. M., Espinoza, H. M., McClain, V., & Gallagher, E. P. (2012) · Aquatic Toxicology · doi:10.1016/j.aquatox.2012.02.025 · Cited by 29 · cited 4× · see citing works
“phospholipid hydroperoxides [30], in the pyloric caeca of fish fed gT suggests a protective role of gT in lipid peroxidation.”
BackgroundInfluentialDetermination of malondialdehyde in traditional fish products by HPLC
Tsaknis, J., Lalas, S. I., & Evmorfopoulos, E. (1999) · The Analyst · doi:10.1039/a902026h · Cited by 28 · cited 2× · see citing works
“However, MDA is an important biomarker of lipid peroxidation and may also partly reflect the sensory quality of fish [15].”
BackgroundMethodIpharraguerre, I. R., Tedó, G., Menoyo, D., Nuria, D. D. C., Holst, J. J., Nofrarías, M., Mereu, A., & Burrin, D. G. (2013) · Journal of Nutrition · doi:10.3945/jn.113.177865 · Cited by 28 · cited 1× · see citing works
“[41].”
Alteration of Δ-6 desaturase by vitamin E in rat brain and liver
Despret, S., Dinh, L., Clément, M., & Bourre, J. M. (1992) · Neuroscience Letters · doi:10.1016/0304-3940(92)90193-b · Cited by 27 · cited 1× · see citing works
“Additionally, there is evidence that alpha tocopherol can modulate the expression and activity of Δ9 and Δ6 fad [22,24].”
BackgroundVestergren, A. S., Wagner, L., Picková, J., Rosenlund, G., Kamal‐Eldin, A., & Trattner, S. (2012) · Lipids · doi:10.1007/s11745-012-3697-7 · Cited by 25 · see citing works
Faizan, M., Esatbeyoglu, T., Bayram, B., & Rimbach, G. H. (2014) · Journal of Food Science · doi:10.1111/1750-3841.12412 · Cited by 23 · cited 2× · see citing works
“impairs the sensory quality of oily fish [17].”
BackgroundMethodFaizan, M., Stubhaug, I., Menoyo, D., Esatbeyoglu, T., Wagner, A. E., Struksnæs, G., Koppe, W., & Rimbach, G. (2013) · International Journal for Vitamin and Nutrition Research · doi:10.1024/0300-9831/a000166 · Cited by 20 · cited 3× · see citing works
“Contrarily, high dietary alpha tocopherol concentrations have been reported to decrease gT tissue concentrations [5].”
BackgroundInfluentialAbsorption by rats of tocopherols present in edible vegetable oils
Porsgaard, T., & Høy, C. (2000) · Lipids · doi:10.1007/s11745-000-0621-z · Cited by 19 · cited 1× · see citing works
“Gamma tocopherol (gT) occurs at high concentrations in plant-derived oils including soya- and rapeseed oil [9,10].”
Background
Flagged first, then by citations
1 of the 46 references couldn’t be matched to a known paper.
Cited by
Sorted by citations
Malav, O. P., Talukder, S., Gokulakrishnan, P., & Chand, S. (2013) · Critical Reviews in Food Science and Nutrition · doi:10.1080/10408398.2012.689381 · Cited by 212 · see citing works
Rondanelli, M., Rigon, C., Perna, S., Gasparri, C., Iannello, G., Akber, R., Alalwan, T. A., & Freije, A. M. (2020) · Nutrients · doi:10.3390/nu12020307 · Cited by 44 · see citing works
“In addition, dietary gT had decreased malondialdehyde values by 25%, thereby demonstrating lower lipid peroxidation [44].”
BackgroundInfluentialSánchez-Moya, A., García-Meilán, I., Riera‐Heredia, N., Vélez, E. J., Lutfi, E., Fontanillas, R., Gutiérrez, J., Capilla, E., & Navarro, I. (2019) · Aquaculture · doi:10.1016/j.aquaculture.2019.734881 · Cited by 38 · see citing works
Vitamin nutrition in salmonid aquaculture: From avoiding deficiencies to enhancing functionalities
Liu, A., To, V. P. T. H., Santigosa, E., Dumas, A., & Hernandez, J. M. (2022) · Aquaculture · doi:10.1016/j.aquaculture.2022.738654 · Cited by 31 · see citing works
Orlando, P., Giardinieri, A., Lucci, P., Nartea, A., Balzano, M., Pacetti, D., Frega, N. G., Silvestri, S., & Tiano, L. (2020) · LWT · doi:10.1016/j.lwt.2020.110011 · Cited by 24 · see citing works
Menoyo, D., Kühn, G., Ruiz‐López, N., Pallauf, K., Stubhaug, I., Pastor, J. J., Ipharraguerre, I. R., & Rimbach, G. H. (2018) · animal · doi:10.1017/s1751731118000812 · Cited by 10 · see citing works
Kühn, G., Pallauf, K., García, J., Segura, J., Ipharraguerre, I. R., Mereu, A., Stubhaug, I., Koppe, W., Rimbach, G. H., & Menoyo, D. (2016) · Aquaculture Nutrition · doi:10.1111/anu.12440 · Cited by 10 · see citing works
Pohořelá, B., Gramblička, T., Doležal, M., Dvořáková, D., Pulkrábová, J., Kouřimská, L., Ilko, V., & Pánek, J. (2022) · Journal of Food Quality · doi:10.1155/2022/9318889 · Cited by 8 · see citing works
“-e role of antioxidants, which protect the oil from rancidity, is fulfilled by naturally occurring tocopherols [28].”
BackgroundOPTIMIZATION TECHNOLOGY OF FAT-SOLUBLE VITAMINS PRODUCTION BASED ON ALKALINE HYDROLYSIS
Сысуев, Е. Б., Stepanova, E. F., & Носкова, В. Д. (2022) · Pharmacy & Pharmacology · doi:10.19163/2307-9266-2022-10-3-255-266 · Cited by 5 · see citing works
Nutritional evaluation of the full-day diet
Pohořelá, B., Polachova, A., Růžičková, M., Doležal, M., Pulkrábová, J., & Pánek, J. (2022) · Czech Journal of Food Sciences · doi:10.17221/273/2021-cjfs · Cited by 3 · see citing works
Grilo, E. C., Costa, P. N., Gurgel, C. S. S., Bezerra, D. F., Bellot, P. E. N. R., & Dimenstein, R. (2016) · REVISTA DO INSTITUTO ADOLFO LUTZ · doi:10.53393/rial.2015.v74.33475 · Cited by 3 · see citing works
Psychosocial and Oxidative Stress and Health of Adults
Annor, F. B. (2022) · Digital Archive @ GSU · doi:10.57709/7034307
- Authors
- Menoyo, D., Sanz-Bayón, C., Nessa, A., Esatbeyoglu, T., Faizan, M., Pallauf, K., De Diego, N., Wagner, A., Ipharraguerre, I., Stubhaug, I., & Rimbach, G.
- Affiliations
- Universidad Politécnica de Madrid (ES)
- Skretting (Norway) (NO)
- Christian-Albrechts-Universität zu Kiel (DE)
- Department of Animal Production, Technical School of Agricultural Engineering, Polytechnic University of Madrid, 28040 Madrid, Spain
- Lucta, Can Parellada 28, 08170 Montornés del Vallés, Barcelona, Spain
- Corresponding author
- Rimbach, Gerald
- ORCID
- Venue
- Marine Drugs
- Publisher
- MDPI AG
- Published
- 2014-12-09
- Volume
- 12
- Issue
- 12
- Pages
- 5944-5959
- ISSN
- 1660-3397 (ISSN-L)
- PMC
- PMC4278211
- OpenAlex
- W2080272293
- Cited by
- 12
- References
- 46
- Citations by year
- 2022: 5 · 2020: 2 · 2019: 1 · 2018: 1 · 2016: 2 · 2013: 1
- FWCI
- 1.02
- Type
- journal article
- Language
- en
- Open access
- gold
- dx.doi.org
- Licence
- Locations
- Marine Drugs (publishedVersion, cc-by)
- Europe PMC (PubMed Central) (publishedVersion, cc-by)
- PubMed Central (publishedVersion, cc-by)
- PubMed (publishedVersion)
- LA Referencia (Red Federada de Repositorios Institucionales de Publicaciones Científicas) (acceptedVersion, cc-by-nc-nd)
- Hispana (acceptedVersion, cc-by-nc-nd)
- DOAJ (DOAJ: Directory of Open Access Journals) (submittedVersion, cc-by-sa)
- Archivo Digital UPM (Universidad Politécnica de Madrid) (submittedVersion, cc-by-nc-nd)
- Funders
- EU (MC-IAPP GA285856)
- Topics
- Life Sciences › Agricultural and Biological Sciences › Aquatic Science › Aquaculture Nutrition and Growth
- Health Sciences › Medicine › Biochemistry › Antioxidant Activity and Oxidative Stress
- Physical Sciences › Chemistry › Organic Chemistry › Edible Oils Quality and Analysis
- Keywords
- gamma-tocopherol, Atlantic salmon, alpha-tocopherol, omega-3 fatty acids, lipid peroxidation, malondialdehyde, antioxidant capacity, functional foods, fish fillets, liver
- MeSH terms
- Animals, Animal Feed, Diet, Lipids, Liver, Malondialdehyde, Lipid Peroxidation, Fatty Acids, Omega-3, Down-Regulation, Dietary Supplements, Salmo salar, alpha-Tocopherol, gamma-Tocopherol
About these checks
Registry, retraction, Cites and statistics results are computed, not judged, with one exception: a printed reference that no index lists is read once by a model before it counts as a citation error. Claims are extracted by a model and kept only when their quote appears verbatim in the text; each cited source is then checked, with a model’s help, for whether it says what the claim relies on. Those verdicts can be wrong — read the claim’s quote and the cited source before relying on one.
Statistics and arithmetic are recomputed, not judged.
Confidence bands are shown only for fields calibrated on our annotated test set. None is calibrated yet, so no band is shown.
What counts as a claim ›How we measure confidence ›How we check this ›
Are you an author, or do you see a problem with this page? Request a review
