Cited by 1,284Inflammation biomarkers and pathwaysImmune Response and InflammationNeutrophil, Myeloperoxidase and Oxidative Mechanisms

The DOI matches its Crossref record; 13 of the 13 references it cites were found in a registry or an index.

Cutting Edge: Inflammatory Responses Can Be Triggered by TREM-1, a Novel Receptor Expressed on Neutrophils and Monocytes

Bouchon, Axel, Dietrich, Jes, Colonna, Marco·2000·The Journal of Immunology

DOI 10.4049/jimmunol.164.10.4991

Open this paper in CoChat — free account

Abstract

We have identified new activating receptors of the Ig superfamily expressed on human myeloid cells, called TREM (triggering receptor expressed on myeloid cells). TREM-1 is selectively expressed on blood neutrophils and a subset of monocytes and is up-regulated by bacterial LPS. Engagement of TREM-1 triggers secretion of IL-8, monocyte chemotactic protein-1, and TNF-alpha and induces neutrophil degranulation. Intracellularly, TREM-1 induces Ca2+ mobilization and tyrosine phosphorylation of extracellular signal-related kinase 1 (ERK1), ERK2 and phospholipase C-gamma. To mediate activation, TREM-1 associates with the transmembrane adapter molecule DAP12. Thus, TREM-1 mediates activation of neutrophil and monocytes, and may have a predominant role in inflammatory responses.

Integrity signals

Registry

Crossref · 10.4049/jimmunol.164.10.4991

Cites

13 of 13 references verified0 citation errors · 0 not checkable

Statistics

Recomputing p-values needs the paper’s full text.

Claims the paper makes

This paper’s full text isn’t openly available, so its claims and self-check weren’t run. The registry and citation checks still apply.

Claims other papers make about this one

Each is checked against this paper’s own text: does it say what the citing paper says it does?

Traffic signals for lymphocyte recirculation and leukocyte emigration: The multistep paradigm
Springer, T. A. (1994) · Cell · doi:10.1016/0092-8674(94)90337-9 · Cited by 7,009
NK CELL RECEPTORS
Lanier, L. L. (1998) · Annual Review of Immunology · doi:10.1146/annurev.immunol.16.1.359 · Cited by 1,641
Recognition of Gram-negative bacteria and endotoxin by the innate immune system
Ulevitch, R. J., & Tobias, P. S. (1999) · Current Opinion in Immunology · doi:10.1016/s0952-7915(99)80004-1 · Cited by 567
NKp44, A Triggering Receptor Involved in Tumor Cell Lysis by Activated Human Natural Killer Cells, Is a Novel Member of the Immunoglobulin Superfamily
Cantoni, C., Bottino, C., Vitale, M., Pessino, A. M., Augugliaro, R., Malaspina, A., Parolini, S., Moretta, L., Moretta, A., & Biassoni, R. (1999) · The Journal of Experimental Medicine · doi:10.1084/jem.189.5.787 · Cited by 450
A Novel Inhibitory Receptor (ILT3) Expressed on Monocytes, Macrophages, and Dendritic Cells Involved in Antigen Processing
Cella, M., Döhring, C., Samaridis, J., Dessing, M., Brockhaus, M., Lanzavecchia, A., & Colonna, M. (1997) · The Journal of Experimental Medicine · doi:10.1084/jem.185.10.1743 · Cited by 430
Myeloid DAP12-associating lectin (MDL)-1 is a cell surface receptor involved in the activation of myeloid cells
Bakker, A. B. H., Baker, E. G., Sutherland, G. R., Phillips, J. H., & Lanier, L. L. (1999) · Proceedings of the National Academy of Sciences · doi:10.1073/pnas.96.17.9792 · Cited by 210
Human myeloid cells express an activating ILT receptor (ILT1) that associates with Fc receptor gamma-chain.
Nakajima, H., Samaridis, J., Ångman, L., & Colonna, M. (1999) · PubMed · Cited by 173
Cutting Edge: Signal-Regulatory Protein β1 Is a DAP12-Associated Activating Receptor Expressed in Myeloid Cells
Dietrich, J., Cella, M., Seiffert, M., Bühring, H., & Colonna, M. (2000) · The Journal of Immunology · doi:10.4049/jimmunol.164.1.9 · Cited by 172
Cutting Edge: Human Myeloid Cells Express an Activating ILT Receptor (ILT1) That Associates with Fc Receptor γ-Chain
Nakajima, H., Samaridis, J., Ångman, L., & Colonna, M. (1999) · The Journal of Immunology · doi:10.4049/jimmunol.162.1.5 · Cited by 152
Biochemical Nature and Cellular Distribution of the Paired Immunoglobulin-like Receptors, PIR-A and PIR-B
Kubagawa, H., Chen, C., Ho, L. H., Shimada, T., Gartland, L., Mashburn, C. B., Uehara, T., Ravetch, J. V., & Cooper, M. D. (1999) · The Journal of Experimental Medicine · doi:10.1084/jem.189.2.309 · Cited by 148

Flagged first, then by citations

Show all 13 references

Research works printed but not linked: 13

1999, Curr. Opin. Immunol., 19
1995, Semin. Cell Biol., 345
1999, J. Immunol., 5
1998, J. Immunol., 4042
1999, J. Exp. Med., 309
2000, J. Immunol., 9
1999, Proc. Natl. Acad. Sci. USA, 9792
1998, Annu. Rev. Immunol., 359
1999, J. Exp. Med., 787
1991, Trends Biotechnol., 109
1997, J. Exp. Med., 1743
1997, The Leukocyte Antigen Facts Book
1994, Cell, 301

Sorted by citations

Items 201–300 of 1,000

Modulation of the Triggering Receptor Expressed on Myeloid Cells–1 Pathway during Pneumonia in Rats
Gibot, S., Alauzet, C., Massin, F., et al. (2006) · The Journal of Infectious Diseases · doi:10.1086/506950 · Cited by 89
“family, a new family of receptors that is distantly related to NKp44, has been described [5, 6].”
BackgroundInfluential
Immune escape and resistance to immunotherapy in mismatch repair deficient tumors
Mestrallet, G., Brown, M., Bozkus, C. C., & Bhardwaj, N. (2023) · Frontiers in Immunology · doi:10.3389/fimmu.2023.1210164 · Cited by 91
The diagnostic value of CRP, IL-8, PCT, and sTREM-1 in the detection of bacterial infections in pediatric oncology patients with febrile neutropenia
Miedema, K. G. E., de Bont, E. S. J. M., Elferink, R. F. M. O., van Vliet, M. J., Nijhuis, C. S. M. O., Kamps, W. A., & Tissing, W. J. E. (2010) · Supportive Care in Cancer · doi:10.1007/s00520-010-0987-6 · Cited by 89
“sTREM-1 has been identified on neutrophils, mature monocytes, and macrophages, and is upregulated by LPS, bacteria, and fungi [24].”
Background
Role of sTREM-1 in predicting mortality of infection: a systematic review and meta-analysis
Su, L., Liu, D., Chai, W., Liu, D., & Long, Y. (2016) · BMJ Open · doi:10.1136/bmjopen-2015-010314 · Cited by 88
TREM-1 orchestrates angiotensin II–induced monocyte trafficking and promotes experimental abdominal aortic aneurysm
Vandestienne, M., Zhang, Y., Santos‐Zas, I., Al-Rifai, R., Joffre, J., Giraud, A., Laurans, L., Esposito, B., Pinet, F., Bruneval, P., et al. (2020) · Journal of Clinical Investigation · doi:10.1172/jci142468 · Cited by 92
“In order to substantiate the effect of TREM-1 pharmacological blockade, AngII-infused Apoe–/– mice were treated with daily intraperitoneal injections of LR12 peptide (which was well tolerTriggering receptor expressed on myeloid cells 1 (TREM-1) is a member of the immunoglobulin superfamily (7, 8) constitutively expres…”
Method
Monocytes from Cystic Fibrosis Patients Are Locked in an LPS Tolerance State: Down-Regulation of TREM-1 as Putative Underlying Mechanism
del Fresno, C., Goméz-Piña, V., Lores, V., et al. (2008) · PLoS ONE · doi:10.1371/journal.pone.0002667 · Cited by 87
“Recently, the immunoglobulin-related transmembrane receptor termed triggering receptor expressed on myeloid cells, (TREM)-1, has been recognized as an important element of the immune response, which strongly enhances leukocyte activation in the presence of microbial products [6,7].”
Background
Emerging roles for triggering receptor expressed on myeloid cells receptor family signaling in inflammatory diseases
Pelham, C. J., & Agrawal, D. K. (2013) · Expert Review of Clinical Immunology · doi:10.1586/1744666x.2014.866519 · Cited by 90
PDC-TREM, a plasmacytoid dendritic cell-specific receptor, is responsible for augmented production of type I interferon
Watarai, H., Sekine-Kondo, E., Inoue, S., Nakagawa, R., Kaisho, T., & Taniguchi, M. (2008) · Proceedings of the National Academy of Sciences · doi:10.1073/pnas.0710351105 · Cited by 86
ITAM-based signaling beyond the adaptive immune response
Fodor, S., Jakus, Z., & Mócsai, A. (2005) · Immunology Letters · doi:10.1016/j.imlet.2005.11.001 · Cited by 91
Circulating soluble triggering receptor expressed on myeloid cells-1 (sTREM-1) as diagnostic and prognostic marker in neonatal sepsis
Adly, A. A. M., Ismail, E. A. R., Andrawes, N. G., et al. (2013) · Cytokine · doi:10.1016/j.cyto.2013.11.004 · Cited by 85
Crystal Structure of the Human Myeloid Cell Activating Receptor TREM-1
Radaev, S., Kattah, M. G., Rostro, B., Colonna, M., & Sun, P. D. (2003) · Structure · doi:10.1016/j.str.2003.11.001 · Cited by 85
TREM‐1 expression in macrophages is regulated at transcriptional level by NF‐κB and PU.1
Zeng, H., Ornatowska, M., Joo, M., & Sadikot, R. T. (2007) · European Journal of Immunology · doi:10.1002/eji.200737270 · Cited by 88
Novel immunoglobulin superfamily gene cluster, mapping to a region of human chromosome 17q25, linked to psoriasis susceptibility
Speckman, R. A., Daw, J., Helms, C. A., Duan, S., Cao, L. H., Taillon‐Miller, P., Kwok, P., Menter, A., & Bowcock, A. M. (2003) · Human Genetics · doi:10.1007/s00439-002-0851-y · Cited by 84
TREM2/DAP12 Complex Regulates Inflammatory Responses in Microglia via the JNK Signaling Pathway
Zhong, L., Zhang, Z.-L., Li, X., Liao, C., Mou, P., Wang, T., Wang, Z., Wang, Z., Wei, M., Xu, H., et al. (2017) · Frontiers in Aging Neuroscience · doi:10.3389/fnagi.2017.00204 · Cited by 92
“For instance, the association of DAP12 with TREM1 has been shown to amplify the inflammatory response (Bouchon et al., 2000; Gibot et al., 2004); while the association with TREM2 dampens the production of pro-inflammatory cytokines (Takahashi et al., 2005; Turnbull et al., 2006).”
BackgroundInfluential
Functions of Macrophages in the Maintenance of Intestinal Homeostasis
Wang, S., Ye, Q., Zeng, X., & Qiao, S. (2019) · Journal of Immunology Research · doi:10.1155/2019/1512969 · Cited by 83
Soluble Triggering Receptor Expressed on Myeloid cells-1 in bronchoalveolar lavage fluid is not predictive for ventilator-associated pneumonia
Oudhuis, G. J., Beuving, J., Bergmans, D. C. J. J., et al. (2009) · Intensive Care Medicine · doi:10.1007/s00134-009-1463-y · Cited by 83
“It is a glycoprotein, expressed as receptor on neutrophils and CD14 monocytes/macrophages [4].”
Background
The regulatory role of Toll-like receptors after ischemic stroke: neurosteroids as TLR modulators with the focus on TLR2/4
Tajalli-Nezhad, S., Karimian, M., Beyer, C., Atlasi, M. A., & Tameh, A. A. (2018) · Cellular and Molecular Life Sciences · doi:10.1007/s00018-018-2953-2 · Cited by 83
TREM Receptors Connecting Bowel Inflammation to Neurodegenerative Disorders
Natale, G., Biagioni, F., Busceti, C. L., Gambardella, S., Limanaqi, F., & Fornai, F. (2019) · Cells · doi:10.3390/cells8101124 · Cited by 83
“TREM-2 activation by several bacterial and yeast compounds promotes phagocytosis [5,45].”
BackgroundInfluential
TREM-1 Inhibition Restores Impaired Autophagy Activity and Reduces Colitis in Mice
Kökten, T., Gibot, S., Lepage, P., D’Alessio, S., Hablot, J., Ndiaye, N. C., Busby-Venner, H., Monot, C., Garnier, B., Moulin, D., et al. (2017) · Journal of Crohn s and Colitis · doi:10.1093/ecco-jcc/jjx129 · Cited by 89
Blocking triggering receptor expressed on myeloid cells-1 attenuates lipopolysaccharide-induced acute lung injury via inhibiting NLRP3 inflammasome activation
Liu, T., Zhou, Y., Li, P., Duan, J., Liu, Y.-P., Sun, G.-Y., Wan, L., Dong, L., Fang, X., Jiang, J.-X., et al. (2016) · Scientific Reports · doi:10.1038/srep39473 · Cited by 81
The Triggering Receptor Expressed on Myeloid Cells 2: A Molecular Link of Neuroinflammation and Neurodegenerative Diseases
Walter, J. (2016) · Journal of Biological Chemistry · doi:10.1074/jbc.r115.704981 · Cited by 80
“The first gene of the TREM family, TREM1, was identified in natural killer cells and shown to be also expressed in different monocytes and monocyte-derived macrophages (20).”
Background
Macrophage phenotype and its relationship with renal function in human diabetic nephropathy
Zhang, X., Yang, Y., & Zhao, Y. (2019) · PLoS ONE · doi:10.1371/journal.pone.0221991 · Cited by 80
Mycobacterium bovisBCG Cell Wall-Specific Differentially Expressed Genes Identified by Differential Display and cDNA Subtraction in Human Macrophages
Begum, N. A., Ishii, K., Kurita-Taniguchi, M., Tanabe, M., Kobayashi, M., Moriwaki, Y., Matsumoto, M., Fukumori, Y., Azuma, I., Toyoshima, K., et al. (2004) · Infection and Immunity · doi:10.1128/iai.72.2.937-948.2004 · Cited by 80
“TREM and MDL receptors (5, 9) are expressed specifically on”
Background
Immunopathogenic mechanisms and immunoregulatory therapies in MASLD
He, Y., Chen, Y., Qian, S., van Der Merwe, S., Dhar, D., Brenner, D. A., & Tacke, F. (2025) · Cellular & Molecular Immunology · doi:10.1038/s41423-025-01307-5 · Cited by 81
Prospective evaluation of the efficacy, safety, and optimal biomarker enrichment strategy for nangibotide, a TREM-1 inhibitor, in patients with septic shock (ASTONISH): a double-blind, randomised, controlled, phase 2b trial
François, B., Lambden, S., Fivez, T., et al. (2023) · The Lancet Respiratory Medicine · doi:10.1016/s2213-2600(23)00158-3 · Cited by 79
The microglial innate immune receptors TREM-1 and TREM-2 in the anterior cingulate cortex (ACC) drive visceral hypersensitivity and depressive-like behaviors following DSS-induced colitis
Wu, K., Liu, Y.-Y., Shao, S., Song, W., Chen, X.-H., Dong, Y.-T., & Zhang, Y.-M. (2023) · Brain Behavior and Immunity · doi:10.1016/j.bbi.2023.06.003 · Cited by 84
Microglia TREM1-mediated neuroinflammation contributes to central sensitization via the NF-κB pathway in a chronic migraine model
Sun, S., Fan, Z., Liu, X., et al. (2024) · The Journal of Headache and Pain · doi:10.1186/s10194-023-01707-w · Cited by 79
“TREM1 (a trigger receptor 1 expressed on myeloid cells) is widely expressed in myeloid cells (monocytes, granulocytes) and microglia [12–14].”
Background
Signal adaptor DAP10 associates with MDL-1 and triggers osteoclastogenesis in cooperation with DAP12
Inui, M., Kikuchi, Y., Aoki, N., Endo, S., Maeda, T., Sugahara–Tobinai, A., Fujimura, S., Nakamura, A., Kumanogoh, A., Colonna, M., et al. (2009) · Proceedings of the National Academy of Sciences · doi:10.1073/pnas.0900463106 · Cited by 77
“A defect in the DAP12–TREM-2 function leads to the development of heritable Nasu–Hakola disease in humans (11, 14).”
BackgroundInfluential
Soluble triggering receptor expressed on myeloid cells-1 in acute respiratory infections
Phua, J., Koay, E. S., Zhang, D., et al. (2006) · European Respiratory Journal · doi:10.1183/09031936.06.00005606 · Cited by 78
Macrophage polarization: an effective approach to targeted therapy of inflammatory bowel disease
Du, Y., Rong, L., Cong, Y., Shen, L., Zhang, N., & Wang, B. (2021) · Expert Opinion on Therapeutic Targets · doi:10.1080/14728222.2021.1901079 · Cited by 81
“mainly on monocytes and neutrophils [133,134].”
TREM-1, HMGB1 and RAGE in the Shoulder Tendon: Dual Mechanisms for Inflammation Based on the Coincidence of Glenohumeral Arthritis
Thankam, F. G., Dilisio, M. F., Dietz, N. E., & Agrawal, D. K. (2016) · PLoS ONE · doi:10.1371/journal.pone.0165492 · Cited by 78
Insights into the Pathogenesis of Anaplastic Large-Cell Lymphoma through Genome-wide DNA Methylation Profiling
Hassler, M. R., Pulverer, W., Lakshminarasimhan, R., Redl, E., Hacker, J., Garland, G. D., Merkel, O., Schiefer, A., Simonitsch‐Klupp, I., Kenner, L., et al. (2016) · Cell Reports · doi:10.1016/j.celrep.2016.09.018 · Cited by 76
“TREM1 is a triggering receptor promoting cytokine and chemokine production (Bouchon et al., 2000).”
Background
IL-17A neutralizing antibody regulates monosodium urate crystal-induced gouty inflammation
Raucci, F., Iqbal, A. J., Saviano, A., Minosi, P., Piccolo, M., Irace, C., Caso, F., Scarpa, R., Pieretti, S., Mascolo, N., et al. (2019) · Pharmacological Research · doi:10.1016/j.phrs.2019.104351 · Cited by 78
COVID-19 risk stratification algorithms based on sTREM-1 and IL-6 in emergency department
Singer, M. V., Brahier, T., Ngai, M., Wright, J. K., Weckman, A. M., Erice, C., Meuwly, J., Hügli, O., Kain, K. C., & Boillat‐Blanco, N. (2020) · Journal of Allergy and Clinical Immunology · doi:10.1016/j.jaci.2020.10.001 · Cited by 73
“018 Respiratory rate (vpm), median (IQR) 23 (18-28) 20 (17-23) 23 (18-28) 26 (25-34) .”
Circulating nucleosomes as a predictor of sepsis and organ dysfunction in critically ill patients
Chen, Q., Ye, L., Jin, Y., Zhang, N., Lou, T., Qiu, Z., Jin, Y., Cheng, B., & Fang, X. (2012) · International Journal of Infectious Diseases · doi:10.1016/j.ijid.2012.03.007 · Cited by 76
TREM-1 and DAP12 expression in monocytes of patients with severe psychiatric disorders. EGR3, ATF3 and PU.1 as important transcription factors
Weigelt, K., Carvalho, L. A., Drexhage, R. C., Wijkhuijs, A. J. M., de Wit, H., van Beveren, N. J. M., Birkenhäger, T. K., Bergink, V., & Drexhage, H. A. (2011) · Brain Behavior and Immunity · doi:10.1016/j.bbi.2011.03.006 · Cited by 76
“TREM-1, DAP12 and PU.1 have been described as key genes in inflammatory processes (Bouchon et al., 2000, 2001; del Fresno et al., 2008; Gallant and Gilkeson, 2006; Tessarz and Cerwenka, 2008).”
Influential
TREM-1 Modulation Strategies for Sepsis
Siskind, S., Brenner, M., & Wang, P. (2022) · Frontiers in Immunology · doi:10.3389/fimmu.2022.907387 · Cited by 76
A novel ligand-independent peptide inhibitor of TREM-1 suppresses tumor growth in human lung cancer xenografts and prolongs survival of mice with lipopolysaccharide-induced septic shock
Sigalov, A. B. (2014) · International Immunopharmacology · doi:10.1016/j.intimp.2014.05.001 · Cited by 77
“First reported in 2000 [43], TREM-1 amplifies the inflammatory response and plays a role in innate and adaptive immune responses [17, 44–46].”
Background
Effects of aging on triggering receptor expressed on myeloid cells (TREM)‐1‐induced PMN functions
Fortin, C. F., Lesur, O., & Fülöp, T. (2007) · FEBS Letters · doi:10.1016/j.febslet.2007.02.029 · Cited by 75
“Most of our knowledge comes from experiments done in monocytes [2,3].”
BackgroundInfluential
The Assembly of Diverse Immune Receptors Is Focused on a Polar Membrane-Embedded Interaction Site
Feng, J. A., Call, M. E., & Wucherpfennig, K. W. (2006) · PLoS Biology · doi:10.1371/journal.pbio.0040142 · Cited by 75
Soluble triggering receptor expressed on myeloid cell-1 (sTREM-1): a potential biomarker for the diagnosis of infectious diseases
Cao, C., Gu, J., & Zhang, J. (2017) · Frontiers of Medicine · doi:10.1007/s11684-017-0505-z · Cited by 75
“The activation of neutrophils and monocytes then causes a series of intracellular changes, including calcium mobilization and tyrosine phosphorylation, which help amplify inflammation [1].”
BackgroundInfluential
TREM2 regulates innate immunity in Alzheimer’s disease
Li, J.-T., & Zhang, Y. (2018) · Journal of Neuroinflammation · doi:10.1186/s12974-018-1148-y · Cited by 76
Curcumin mediated epigenetic modulation inhibits TREM-1 expression in response to lipopolysaccharide
Yuan, Z., Syed, M. A., Panchal, D., Rogers, D., Joo, M., & Sadikot, R. T. (2012) · The International Journal of Biochemistry & Cell Biology · doi:10.1016/j.biocel.2012.08.001 · Cited by 74
“TREM-1 is an important amplifier of TLR initiated inflammatory response and blockade of TREM-1 has shown to improve survival in lethal models of sepsis (Bouchon et al., 2000; Ford and McVicar, 2009).”
Background
The Early Second Hit in Trauma Management Augments the Proinflammatory Immune Response to Multiple Injuries
Tschoeke, S. K., Hellmuth, M., Hostmann, A., Ertel, W., & Oberholzer, A. (2007) · The Journal of Trauma: Injury, Infection, and Critical Care · doi:10.1097/ta.0b013e318047b7f0 · Cited by 72
Expression, crystallization and X-ray data collection from microcrystals of the extracellular domain of the human inhibitory receptor expressed on myeloid cells IREM-1
Dimasi, N., Flot, D. M., Dupeux, F., et al. (2007) · Acta Crystallographica Section F Structural Biology and Crystallization Communications · doi:10.1107/s1744309107004903 · Cited by 74
“…al., 1996; Chung et al., 2003; Clark et al., 2000; Green et al., 1998; Cantoni et al., 1999; Alvarez-Errico et al., 2004; Aguilar et al., 2004; MartinezBarriocanal & Sayos, 2006; Allcock et al., 2003; Bouchon et al., 2000; van den Berg et al., 2004; Pandey & Agrawal, 2006; Dietrich et al., 2000).”
Background
Increased levels of soluble triggering receptor expressed on myeloid cells-1 in patients with acute pancreatitis*
Yasuda, T., Takeyama, Y., Ueda, T., et al. (2008) · Critical Care Medicine · doi:10.1097/ccm.0b013e31817b8824 · Cited by 74
“Recent investigations clarified that activation of TREM-1 on monocytes and neutrophils in the presence of toll-like receptor (TLR) ligands synergistically increases the production of proinflammatory cytokines (5, 7, 8, 29) and that blocking TREM-1 on human monocytes/ macrophage cell line inhibited the HMGB1-induced cy…”
Background
Therapeutic approaches to innate immunity: severe sepsis and septic shock
Lolis, E., & Bucala, R. (2003) · Nature Reviews Drug Discovery · doi:10.1038/nrd1153 · Cited by 74
Correlation of Serum-Soluble Triggering Receptor Expressed on Myeloid Cells-1 with Clinical Disease Activity in Inflammatory Bowel Disease
Park, J. J., Cheon, J. H., Kim, B. Y., Kim, D. H., Kim, E. S., Kim, T. I., Lee, K. R., & Kim, W. H. (2008) · Digestive Diseases and Sciences · doi:10.1007/s10620-008-0514-5 · Cited by 76
“Triggering receptor expressed on myeloid cells-1 (TREM-1), a member of the immunoglobulin superfamily expressed on blood neutrophils and a subset of monocytes, is upregulated in various inflammatory diseases [9, 10].”
Background
TREM-1 Amplifies Corneal Inflammation after Pseudomonas aeruginosa Infection by Modulating Toll-Like Receptor Signaling and Th1/Th2-Type Immune Responses
Wu, M., Peng, A., Sun, M., Deng, Q., Hazlett, L. D., Yuan, J., Liu, X., Gao, Q., Feng, L., He, J., et al. (2011) · Infection and Immunity · doi:10.1128/iai.00144-11 · Cited by 72
“TREM-1 is a recently identified activating receptor expressed at high levels on PMNs and a subset of CD14 monocytes/macrophages that infiltrate infected tissue (4).”
Background
IL-4 Confers NK Stimulatory Capacity to Murine Dendritic Cells: A Signaling Pathway Involving KARAP/DAP12-Triggering Receptor Expressed on Myeloid Cell 2 Molecules
Terme, M., Tomasello, E., Maruyama, K., Crépineau, F., Chaput, N., Flament, C., Marolleau, J., Angevin, E., Wagner, E. F., Salomon, B. L., et al. (2004) · The Journal of Immunology · doi:10.4049/jimmunol.172.10.5957 · Cited by 72
“(31) reported a strong down-regulation of MDL-1 and TREM-1 during monocyte differentiation toward the dendritic lineage in the presence of IL-4 associated with a concomitant up-regulation of TREM2.”
BackgroundMethod
Induction of triggering receptor expressed on myeloid cells 1 in murine resident peritoneal macrophages by monosodium urate monohydrate crystals
Murakami, Y., Akahoshi, T., Hayashi, I., Endo, H., Kawai, S., Inoue, M., Kondo, H., & Kitasato, H. (2006) · Arthritis & Rheumatism · doi:10.1002/art.21633 · Cited by 72
Human Intestinal Mononuclear Phagocytes in Health and Inflammatory Bowel Disease
Caër, C., & Wick, M. J. (2020) · Frontiers in Immunology · doi:10.3389/fimmu.2020.00410 · Cited by 76
Trem-Like Transcript 2 Is Expressed on Cells of the Myeloid/Granuloid and B Lymphoid Lineage and Is Up-Regulated in Response to Inflammation
King, R. G., Herrin, B. R., & Justement, L. B. (2006) · The Journal of Immunology · doi:10.4049/jimmunol.176.10.6012 · Cited by 71
“By virtue of the interaction with DAP-12, TREM molecules, as well as the related NKp44 receptor, are able to initiate tyrosine-based signaling leading to cellular activation (1, 2, 22).”
Background
Intervention of an inflammation amplifier, triggering receptor expressed on myeloid cells 1, for treatment of autoimmune arthritis
Murakami, Y., Akahoshi, T., Aoki, N., Toyomoto, M., Miyasaka, N., & Kohsaka, H. (2009) · Arthritis & Rheumatism · doi:10.1002/art.24554 · Cited by 71
Triggering Receptor Expressed on Myeloid Cells 1 (TREM-1)-mediated Bcl-2 Induction Prolongs Macrophage Survival*
Yuan, Z.-H., Syed, M., Panchal, D., Joo, M., Colonna, M., Brantly, M., & Sadikot, R. (2014) · Journal of Biological Chemistry · doi:10.1074/jbc.m113.536490 · Cited by 67
“TREM-1 is a member of the superimmunoglobulin receptor that is expressed on monocytes and neutrophils (11, 12, 31, 37, 46, 47).”
Background
Initial characterization of TREM-like transcript (TLT)-1: a putative inhibitory receptor within the TREM cluster.
Washington, A., Quigley, L., & McVicar, D. (2002) · Blood · doi:10.1182/blood-2002-02-0523 · Cited by 80
Distinct peripheral blood monocyte and neutrophil transcriptional programs following intracerebral hemorrhage and different etiologies of ischemic stroke
Carmona-Mora, P., Ander, B. P., Jickling, G. C., Dykstra-Aiello, C., Zhan, X., Ferino, E., Hamade, F., Amini, H., Hull, H., Sharp, F. R., et al. (2020) · Journal of Cerebral Blood Flow & Metabolism · doi:10.1177/0271678x20953912 · Cited by 68
“The last two were inhibited, suggesting a self-regulatory loop for monocytes to progress into the resolving phase of the injury.(74,75)”
Background
Adaptations of intestinal macrophages to an antigen-rich environment
Schenk, M., & Mueller, C. (2006) · Seminars in Immunology · doi:10.1016/j.smim.2006.09.002 · Cited by 70
Intestinal macrophages: differentiation and involvement in intestinal immunopathologies
Weber, B., Saurer, L., & Mueller, C. (2009) · Seminars in Immunopathology · doi:10.1007/s00281-009-0156-5 · Cited by 69
“, CD40, CD86, and CD32) on monocytes, and prolongs the survival of TREM-1-positive inflammatory cells [54, 55].”
Background
The innate immune system in Alzheimer's disease
Boutajangout, A., & Wisniewski, T. (2013) · International Journal of Cell Biology · doi:10.1155/2013/576383 · Cited by 69
“[15] A.”
Background
sTREM-1 is a specific biomarker of TREM-1 pathway activation
Jolly, L., Carrasco, K., Salcedo‐Magguilli, M., et al. (2021) · Cellular and Molecular Immunology · doi:10.1038/s41423-021-00733-5 · Cited by 69
TREM2/β-catenin attenuates NLRP3 inflammasome-mediated macrophage pyroptosis to promote bacterial clearance of pyogenic bacteria
Wang, Y., Cao, C., Zhu, Y., Fan, H., Liu, Q., Liu, Y., Chen, K., Wu, Y., Liang, S., Li, M., et al. (2022) · Cell Death & Disease · doi:10.1038/s41419-022-05193-x · Cited by 69
“Triggering receptors expressed on myeloid cells 2 (TREM2) is a broadly expressed PRR on macrophages, dendritic cells, and microglia cells [9, 10], which be considered an important therapeutic target for neurodegenerative disease, infectious disease and tumor immunotherapy [11, 12].”
Background
The diverse functions of Src family kinases in macrophages.
Abram, C., & Lowell, C. (2008) · Frontiers in Bioscience · doi:10.2741/3015 · Cited by 81
“Crosslinking of TREM1 results in increased cellular tyrosine phosphorylation (154).”
Background
Induction of triggering receptor expressed on myeloid cells (TREM-1) in airway epithelial cells by 1,25(OH) 2 vitamin D 3
Rigo, I., McMahon, L., Dhawan, P., et al. (2011) · Innate Immunity · doi:10.1177/1753425911399796 · Cited by 69
“In contrast, PU.1 has been shown to suppress the expression of TREM-1.”
BackgroundMethodInfluential
Transcriptomic Network Support Distinct Roles of Classical and Non-Classical Monocytes in Human
Anbazhagan, K., Duroux-Richard, I., Jørgensen, C., & Apparailly, F. (2014) · International Reviews of Immunology · doi:10.3109/08830185.2014.902453 · Cited by 74
“TREM1 is a receptor that amplifies the production of pro-inflammatory chemokines and cytokines in response to bacterial and fungal infections and ultimately leads to septic shock [28–30].”
Background
Nangibotide in patients with septic shock: a Phase 2a randomized controlled clinical trial
François, B., Wittebole, X., Ferrer, R., Mira, J. P., Dugernier, T., Gibot, S., Derive, M., Olivier, A., Cuvier, V., Witte, S., et al. (2020) · Intensive Care Medicine · doi:10.1007/s00134-020-06109-z · Cited by 73
Significance of Blood and Cerebrospinal Fluid Biomarkers for Alzheimer’s Disease: Sensitivity, Specificity and Potential for Clinical Use
d’Abramo, C., D'adamio, L., & Giliberto, L. (2020) · Journal of Personalized Medicine · doi:10.3390/jpm10030116 · Cited by 71
Lipopolysaccharide-Induced Up-Regulation of Triggering Receptor Expressed on Myeloid Cells-1 Expression on Macrophages Is Regulated by Endogenous Prostaglandin E2
Murakami, Y., Kohsaka, H., Kitasato, H., & Akahoshi, T. (2007) · The Journal of Immunology · doi:10.4049/jimmunol.178.2.1144 · Cited by 68
Cross‐talk between pathogen recognizing Toll‐like receptors and immunoglobulin Fc receptors in immunity
van Egmond, M., Vidarsson, G., & Bakema, J. E. (2015) · Immunological Reviews · doi:10.1111/imr.12333 · Cited by 69
“Activation of TREM-1 (via agonistic antibodies, as the natural ligand is yet unknown) and TLR4 on monocytes synergistically amplified the production of various cytokines including TNFa and MCP-1 (68, 69).”
Background
Tumor necrosis factor-α regulates triggering receptor expressed on myeloid cells-1-dependent matrix metalloproteinases in the carotid plaques of symptomatic patients with carotid stenosis
Rao, V. H., Rai, V., Stoupa, S., Subramanian, S., & Agrawal, D. K. (2016) · Atherosclerosis · doi:10.1016/j.atherosclerosis.2016.03.021 · Cited by 68
“TREM-1 is expressed on monocytes/macrophages, neutrophils is increased by various stimuli such as TLR ligands [19, 26, 27] and secrete matrix metalloproteinase (MMPs) that degrade extracellular matrix proteins such as gelatin (MMP-2 and MMP-9), collagen (MMP-1, MMP-8 and MMP-13), elastin (MMP-12) and fibrin (MMP-3 and…”
BackgroundInfluential
Recognition of tumor cells by the innate immune system
Soloski, M. J. (2001) · Current Opinion in Immunology · doi:10.1016/s0952-7915(00)00198-9 · Cited by 68
Regulatory mechanisms of neutrophil migration from the circulation to the airspace
Lin, W.-C., & Fessler, M. B. (2021) · Cellular and Molecular Life Sciences · doi:10.1007/s00018-021-03768-z · Cited by 70
Porphyromonas gingivalis Regulates TREM-1 in Human Polymorphonuclear Neutrophils via Its Gingipains
Bostancı, N., Thurnheer, T., Aduse‐Opoku, J., Curtis, M. A., Zinkernagel, A. S., & Belibasakis, G. N. (2013) · PLoS ONE · doi:10.1371/journal.pone.0075784 · Cited by 67
“Earlier studies have also demonstrated that, in response to bacterial challenge, TREM-1 engagement enhances the release of IL-8 from PMNs [5,23], or monocytic cells [8,22,40].”
BackgroundResultInfluential
Soluble Triggering Receptor Expressed on Myeloid Cells 1 Is Released in Patients with Stable Chronic Obstructive Pulmonary Disease
Radsak, M. P., Taube, C., Haselmayer, P., et al. (2007) · Clinical and Developmental Immunology · doi:10.1155/2007/52040 · Cited by 67
“The TREM-1cDNAs have been described previously [11].”
Background
Soluble Triggering Receptor Expressed on Myeloid Cell-1 Is Increased in Patients With Ventilator-Associated Pneumonia
Horonenko, G., Hoyt, J. C., Robbins, R., Singarajah, C., Umar, A., Pattengill, J., & Hayden, J. M. (2007) · CHEST Journal · doi:10.1378/chest.06-2731 · Cited by 67
DAP12 Expression in Lung Macrophages Mediates Ischemia/Reperfusion Injury by Promoting Neutrophil Extravasation
Spahn, J. H., Li, W., Bribriesco, A., Liu, J., Shen, H., Ibricevic, A., Pan, J.-H., Zinselmeyer, B. H., Brody, S. L., Goldstein, D. R., et al. (2015) · The Journal of Immunology · doi:10.4049/jimmunol.1401415 · Cited by 67
Microglia, Trem2, and Neurodegeneration
Shi, Q., Gutierrez, R. A., & Bhat, M. A. (2025) · The Neuroscientist · doi:10.1177/10738584241254118 · Cited by 69
Diagnostic Accuracy of HMGB-1, sTREM-1, and CD64 as Markers of Sepsis in Patients Recently Admitted to the Emergency Department
Gámez-Díaz, L. Y., Enríquez, L. E., Matute, J. D., Velásquez, S., Gómez, I. D., Toro, F., Ospina, S., Bedoya, V. I., Arango, C., Valencia, M. L., et al. (2011) · Academic Emergency Medicine · doi:10.1111/j.1553-2712.2011.01113.x · Cited by 69
TREM‐2 Promotes Macrophage‐Mediated Eradication of Pseudomonas aeruginosa via a PI3K/Akt Pathway
Zhu, M., Li, D., Wu, Y., Huang, X., & Wu, M. (2014) · Scandinavian Journal of Immunology · doi:10.1111/sji.12148 · Cited by 67
RING-finger type E3 ubiquitin ligase inhibitors as novel candidates for the treatment of rheumatoid arthritis
Yagishita, N., Aratani, S., Leach, C. A., Amano, T., Yamano, Y., Nakatani, K., Nishioka, K., & Nakajima, T. (2012) · International Journal of Molecular Medicine · doi:10.3892/ijmm.2012.1129 · Cited by 68
Biomarkers of Sepsis-Induced Acute Kidney Injury
Wang, K., Xie, S., Xiao, K., Yan, P., He, W., & Xie, L. (2018) · BioMed Research International · doi:10.1155/2018/6937947 · Cited by 65
“TREM-1 is a receptor of the immunoglobulin superfamily associated with the inflammatory response, with a relative molecular weight of 26 kDa [37].”
Background
Extracellular CIRP and TREM‐1 axis promotes ICAM‐1‐Rho‐mediated NETosis in sepsis
Murao, A., Arif, A., Brenner, M., Denning, N., Jin, H. Z., Takizawa, S., Nicastro, B., Wang, P., & Aziz, M. (2020) · The FASEB Journal · doi:10.1096/fj.202000482r · Cited by 65
Re‐evaluating the role of vitamin D in the periodontium
Stein, S. H., Livada, R., & Tipton, D. A. (2013) · Journal of Periodontal Research · doi:10.1111/jre.12149 · Cited by 64
The Role of Toll-Like Receptors (TLR-2 and -4) and Triggering Receptor Expressed on Myeloid Cells 1 (TREM-1) in Human Term and Preterm Labor
Youssef, R., Ledingham, M. A., Bollapragada, S. S., O’Gorman, N., Jordan, F., Young, A., & Norman, J. E. (2009) · Reproductive Sciences · doi:10.1177/1933719109336621 · Cited by 65
“The sequences of the TREM-1 primer pairs used were as previously published by Bouchon et al.(23) (50 GCTGGTGCACAGGAAGGATG and 30 GGCTGGAAGTCAGAGGACATT).”
BackgroundMethodInfluential
Bacterial Sensor Triggering Receptor Expressed on Myeloid Cells-2 Regulates the Mucosal Inflammatory Response
Correale, C., Genua, M., Vetrano, S., Mazzini, E., Martinoli, C., Spinelli, A., Arena, V., Peyrin‐Biroulet, L., Caprioli, F., Passini, N., et al. (2012) · Gastroenterology · doi:10.1053/j.gastro.2012.10.040 · Cited by 65
CD200 Receptor Family Members Represent Novel DAP12-associated Activating Receptors on Basophils and Mast Cells
Voehringer, D., Rosen, D. B., Lanier, L. L., et al. (2004) · Journal of Biological Chemistry · doi:10.1074/jbc.m406997200 · Cited by 65
TREM-1-accentuated lung injury via miR-155 is inhibited by LP17 nanomedicine
Yuan, Z., Syed, M. A., Panchal, D., et al. (2015) · American Journal of Physiology-Lung Cellular and Molecular Physiology · doi:10.1152/ajplung.00195.2015 · Cited by 64
“Previous studies have shown that TREM-1 blockade improves survival in sepsis (2, 3).”
Modulation of Cytokine Release and Gene Expression by the Immunosuppressive Domain of gp41 of HIV-1
Denner, J., Eschricht, M., Lauck, M., Semaan, M., Schlaermann, P., Ryu, H., & Akyüz, L. (2013) · PLoS ONE · doi:10.1371/journal.pone.0055199 · Cited by 63
“TREM-1 has a role as a regulator of innate and adaptive immunity [24,25].”
Background
What happens to microglial TREM2 in Alzheimer’s disease: Immunoregulatory turned into immunopathogenic?
Lue, L.-F., Schmitz, C., & Walker, D. G. (2015) · Neuroscience · doi:10.1016/j.neuroscience.2014.09.050 · Cited by 63
“…Lectin (MDL) 1 and LY49H; I-type lectin, Siglec H] and members of the Ig superfamily [e.g. signal regulatory protein b1 (SIRPb1), TREM1, and NKp44] (Bakker et al., 1999; Cantoni et al., 1999; Gosselin et al., 1999; Bouchon et al., 2000; Dietrich et al., 2000; Blasius et al., 2006).”
New Insight in LPS Antagonist
Ianaro, A., Tersigni, M., & D’Acquisto, F. (2009) · Mini-Reviews in Medicinal Chemistry · doi:10.2174/1389557510909030306 · Cited by 62
Transcriptional Analysis Reveals Gender-Specific Changes in the Aging of the Human Immune System
Marttila, S., Jylhävä, J., Nevalainen, T., Nykter, M., Jylhä, M. K., Hervonen, A., Tserel, L., Peterson, P., & Hurme, M. (2013) · PLoS ONE · doi:10.1371/journal.pone.0066229 · Cited by 63
“TREM1 signaling has a role in acute inflammation; it is expressed in blood neutrophils and monocytes, and its expression is induced by pathogens (LPS, bacteria and fungi [14], [15]).”
Background
TREM-1 Protects HIV-1-Infected Macrophages from Apoptosis through Maintenance of Mitochondrial Function
Campbell, G. R., To, R. K., & Spector, S. A. (2019) · mBio · doi:10.1128/mbio.02638-19 · Cited by 63
“Thus, TREM1 requires TYRO protein tyrosine kinase binding protein (TYROBP) for signaling (18, 19).”
Background
A New Triggering Receptor Expressed on Myeloid Cells (Trem) Family Member, Trem-Like 4, Binds to Dead Cells and Is a DNAX Activation Protein 12-Linked Marker for Subsets of Mouse Macrophages and Dendritic Cells
Hemmi, H., Idoyaga, J., Suda, K., Suda, N., Kennedy, K., Noda, M., Aderem, A. A., & Steinman, R. M. (2009) · The Journal of Immunology · doi:10.4049/jimmunol.182.3.1278 · Cited by 62
“Bacterial products are reported to up-regulate expression of TREM1 on human monocytes and neutrophils (34, 41), whereas maturation stimuli down-regulate expression of human TREM2 on B C B C B C B C B C B C Sp lee n”
Background
Triggering receptor expressed on myeloid cells (TREM-1) is regulated post-transcriptionally and its ligand is present in the sera of some septic patients
Wong‐Baeza, I., González-Roldán, N., Ferat-Osorio, E. A., Esquivel-Callejas, N., Aduna-Vicente, R., Arriaga‐Pizano, L., la Vega, H. A., Villasís-Keever, M. Á., Torres-González, R., Estrada‐García, I., et al. (2006) · Clinical & Experimental Immunology · doi:10.1111/j.1365-2249.2006.03158.x · Cited by 62
Detection of circulating platelet–monocyte complexes in persons infected with human immunodeficiency virus type-1
Singh, M. V., Davidson, D. C., Kiebala, M., et al. (2012) · Journal of Virological Methods · doi:10.1016/j.jviromet.2012.02.005 · Cited by 61
“It has also been demonstrated that the cross-talk with activated platelets induces monocytes to mature into a more pro-inflammatory subtype (Bouchon et al., 2000; Weyrich et al., 1996; Weyrich et al., 1995).”
Background
MYD88‐dependent and ‐independent activation of TREM‐1 via specific TLR ligands
Zheng, H., Heiderscheidt, C. A., Joo, M., Gao, X., Knežević, N. N., Mehta, D., & Sadikot, R. T. (2009) · European Journal of Immunology · doi:10.1002/eji.200839156 · Cited by 62
Non-T Cell Activation Linker (NTAL) Negatively Regulates TREM-1/DAP12-Induced Inflammatory Cytokine Production in Myeloid Cells
Tessarz, A. S., Weiler, S., Zanzinger, K., Angelisová, P., Hořejšı́, V., & Cerwenka, A. (2007) · The Journal of Immunology · doi:10.4049/jimmunol.178.4.1991 · Cited by 62
“No detectable levels of TNF- and IL-8 were measured after stimulation with LPS alone for 4, 8, or 16h (data not shown).”
BackgroundInfluential
Recent advances in crystal-induced acute inflammation
Akahoshi, T., Murakami, Y., & Kitasato, H. (2007) · Current Opinion in Rheumatology · doi:10.1097/bor.0b013e328014529a · Cited by 61
Diagnostic utility of the soluble triggering receptor expressed on myeloid cells-1 in bronchoalveolar lavage fluid from patients with bilateral lung infiltrates
Huh, J. W., Lim, C., Koh, Y., et al. (2008) · Critical Care · doi:10.1186/cc6770 · Cited by 60
“Triggering receptors expressed on myeloid cells (TREMs) are members of the immunoglobulin (Ig) superfamily, a critical component of the innate immune defense system against infection [9,10].”
Background
Triggering receptor expressed on myeloid cells receptor family modulators: a patent review
Pelham, C. J., Pandya, A. N., & Agrawal, D. K. (2014) · Expert Opinion on Therapeutic Patents · doi:10.1517/13543776.2014.977865 · Cited by 62
“TREM-1 and TREM-2 can become reduced from >30 kDa to ~26 kDa following N-deglycosylation, as demonstrated by immunoprecipitation and western blot [1,96].”
BackgroundInfluential

Authors: Bouchon, A., Dietrich, J., & Colonna, M.
Affiliations: Basel Institute for Immunology , Basel ,
ORCID: Dietrich, Jes
Colonna, Marco
Venue: The Journal of Immunology
Publisher: Oxford University Press (OUP)
Published: 2000-05
Volume: 164
Issue: 10
Pages: 4991-4995
ISSN: 0022-1767 (ISSN-L)
1550-6606
DOI: 10.4049/jimmunol.164.10.4991
OpenAlex: W2149698238
Semantic Scholar: c6fffd66acdcb27c928605f7aca443056a3a6c3f
Cited by: 1,284
References: 13
Citations by year: 2026: 38 · 2025: 47 · 2024: 73 · 2023: 87 · 2022: 51 · 2021: 65 · 2020: 83 · 2019: 49 · 2018: 55 · 2017: 51 · 2016: 59 · 2015: 47 · 2014: 48 · 2013: 68 · 2012: 50
FWCI: 6.50
Type: journal article
Language: en
Open access: closed
Licence: academic.oup.com/pages/standard-publication-reuse-rights (vor)
Locations: The Journal of Immunology (publishedVersion)
PubMed (publishedVersion)
Topics: Life Sciences › Immunology and Microbiology › Immunology › Inflammation biomarkers and pathways
Life Sciences › Immunology and Microbiology › Immunology › Immune Response and Inflammation
Life Sciences › Immunology and Microbiology › Immunology › Neutrophil, Myeloperoxidase and Oxidative Mechanisms
Keywords: TREM-1, neutrophils, monocytes, inflammation, IL-8 secretion, MCP-1, TNF-α, neutrophil degranulation, calcium mobilization, phospholipase C-gamma, myeloid cell activation
MeSH terms: Triggering Receptor Expressed on Myeloid Cells-1, Amino Acid Sequence, Fungi, Multigene Family, Gram-Negative Bacteria, Gram-Positive Bacteria, Humans, Immunoglobulins, Inflammation, Macrophage Activation, Membrane Glycoproteins, Membrane Proteins, Molecular Sequence Data, Molecular Weight, Monocytes, Neutrophils, Phosphorylation, Receptors, Immunologic, Tyrosine, Biomarkers, Up-Regulation, Cytokines, Neutrophil Activation, Chemokines, Calcium Signaling, Adaptor Proteins, Signal Transducing

About these checks

Registry, retraction, Cites and statistics results are computed, not judged, with one exception: a printed reference that no index lists is read once by a model before it counts as a citation error. Claims are extracted by a model and kept only when their quote appears verbatim in the text; each cited source is then checked, with a model’s help, for whether it says what the claim relies on. Those verdicts can be wrong — read the claim’s quote and the cited source before relying on one.

Statistics and arithmetic are recomputed, not judged.

Confidence bands are shown only for fields calibrated on our annotated test set. None is calibrated yet, so no band is shown.

What counts as a claim ›How we measure confidence ›How we check this ›

Are you an author, or do you see a problem with this page? Request a review

Cutting Edge: Inflammatory Responses Can Be Triggered by TREM-1, a Novel Receptor Expressed on Neutrophils and Monocytes

Abstract

Overview

Integrity signals

Verification

Claims the paper makes

Claims other papers make about this one

Citations

Cites

Cited by

Related

Metadata

Record

About these checks