Cited by 413Regulation of Appetite and ObesityPancreatic function and diabetesNeuroscience and Neuropharmacology Research

The DOI matches its Crossref record; 62 of the 62 references it cites were found in a registry or an index.

Synaptic Glutamate Release by Ventromedial Hypothalamic Neurons Is Part of the Neurocircuitry that Prevents Hypoglycemia

Open access

Tong, Qingchun, Ye, ChianPing, McCrimmon, Rory J., Dhillon, Harveen, Choi, Brian, Kramer, Melissa D., Yu, Jia, Yang, Zongfang, Christiansen, Lauryn M., Lee, Charlotte E., Choi, Cheol Soo, Zigman, Jeffrey M., Shulman, Gerald I., Sherwin, Robert S., Elmquist, Joel K., Lowell, Bradford B.·2007·Cell Metabolism

DOI 10.1016/j.cmet.2007.04.001PMC PMC1934926

Open this paper in CoChat — free account Open PDF

Abstract

The importance of neuropeptides in the hypothalamus has been experimentally established. Due to difficulties in assessing function in vivo, the roles of the fast-acting neurotransmitters glutamate and GABA are largely unknown. Synaptic vesicular transporters (VGLUTs for glutamate and VGAT for GABA) are required for vesicular uptake and, consequently, synaptic release of neurotransmitters. Ventromedial hypothalamic (VMH) neurons are predominantly glutamatergic and express VGLUT2. To evaluate the role of glutamate release from VMH neurons, we generated mice lacking VGLUT2 selectively in SF1 neurons (a major subset of VMH neurons). These mice have hypoglycemia during fasting secondary to impaired fasting-induced increases in the glucose-raising pancreatic hormone glucagon and impaired induction in liver of mRNAs encoding PGC-1alpha and the gluconeogenic enzymes PEPCK and G6Pase. Similarly, these mice have defective counterregulatory responses to insulin-induced hypoglycemia and 2-deoxyglucose (an antimetabolite). Thus, glutamate release from VMH neurons is an important component of the neurocircuitry that functions to prevent hypoglycemia.

Integrity signals

Registry

Crossref · 10.1016/j.cmet.2007.04.001

Cites

62 of 62 references verified0 citation errors · 0 not checkable

Statistics

Recomputing p-values needs the paper’s full text.

Claims the paper makes

We couldn’t retrieve this paper’s full text, so its claims and self-check weren’t run. The registry and citation checks still apply.

Claims other papers make about this one

Each is checked against this paper’s own text: does it say what the citing paper says it does?

Hypothalamic regulation of sleep and circadian rhythms
Saper, C. B., Scammell, T. E., & Lu, J. (2005) · Nature · doi:10.1038/nature04284 · Cited by 2,804
Leptin activates anorexigenic POMC neurons through a neural network in the arcuate nucleus
Cowley, M. A., Smart, J. L., Rubinstein, M., Cerdán, M. G., Diano, S., Horvath, T. L., Cone, R. D., & Low, M. J. (2001) · Nature · doi:10.1038/35078085 · Cited by 2,356
Control of hepatic gluconeogenesis through the transcriptional coactivator PGC-1
Yoon, J. C., Puigserver, P., Chen, G., Donovan, J., Wu, Z., Rhee, J., Adelmant, G., Stafford, J., Kahn, C. R., Granner, D. K., et al. (2001) · Nature · doi:10.1038/35093050 · Cited by 1,821
Differential expression of orexin receptors 1 and 2 in the rat brain
Marcus, J. N., Aschkenasi, C. J., Lee, C. E., Chemelli, R. M., Saper, C. B., Yanagisawa, M., & Elmquist, J. K. (2001) · Journal of Comparative Neurology · doi:10.1002/cne.1190 · Cited by 1,659
Anatomy and regulation of the central melanocortin system
Cone, R. D. (2005) · Nature Neuroscience · doi:10.1038/nn1455 · Cited by 1,583
A Highly Efficient Escherichia coli-Based Chromosome Engineering System Adapted for Recombinogenic Targeting and Subcloning of BAC DNA
Lee, E.-C., Yu, D., de Velasco, J. M., Tessarollo, L., Swing, D. A., Court, D. L., Jenkins, N. A., & Copeland, N. G. (2001) · Genomics · doi:10.1006/geno.2000.6451 · Cited by 1,180
Brain-derived neurotrophic factor regulates energy balance downstream of melanocortin-4 receptor
Xu, B., Goulding, E. H., Zang, K., Cepoi, D., Cone, R. D., Jones, K. R., Tecott, L. H., & Reichardt, L. F. (2003) · Nature Neuroscience · doi:10.1038/nn1073 · Cited by 896
Leptin directly activates SF1 neurons in the VMH, and this action by leptin is required for normal body-weight homeostasis
Dhillon, H., Zigman, J. M., Ye, C., Lee, C. E., McGovern, R. A., Tang, V., Kenny, C. D., Christiansen, L. M., White, R. D., Edelstein, E. A., et al. (2006) · Neuron · doi:10.1016/j.neuron.2005.12.021 · Cited by 791
VGLUTs define subsets of excitatory neurons and suggest novel roles for glutamate
Fremeau, R. T., Voglmaier, S., Seal, R. P., & Edwards, R. H. (2004) · Trends in Neurosciences · doi:10.1016/j.tins.2003.11.005 · Cited by 745
Activation of in the brain
Herrera, D., & Robertson, H. A. (1996) · Progress in Neurobiology · doi:10.1016/s0301-0082(96)00021-4 · Cited by 713

Show all 62 references

Sorted by citations

Items 201–300 of 411

Age‐dependent changes in amino acid phenotype and the role of glutamate release from hypothalamic proopiomelanocortin neurons
Dennison, C. S., King, C. M., Dicken, M. S., & Hentges, S. T. (2015) · The Journal of Comparative Neurology · doi:10.1002/cne.23900 · Cited by 29
“Thus, the Cre/lox approach effectively eliminated glutamate release from Cre-expressing neurons, as shown previously for other hypothalamic neurons (Tong et al., 2007).”
Background
Selfish brain and selfish immune system interplay: A theoretical framework for metabolic comorbidities of mood disorders
Yamagata, A. S., Mansur, R. B., Rizzo, L. B., Rosenstock, T. R., McIntyre, R. S., & Brietzke, E. M. (2016) · Neuroscience & Biobehavioral Reviews · doi:10.1016/j.neubiorev.2016.11.010 · Cited by 29
Glutamate in primary afferents is required for itch transmission
Cui, L., Guo, J. J., Cranfill, S. L., Gautam, M., Bhattarai, J. P., Olson, W. P., Beattie, K., Challis, R. C., Wu, Q., Song, X., et al. (2022) · Neuron · doi:10.1016/j.neuron.2021.12.007 · Cited by 27
Ventromedial hypothalamic expression of Bdnf is required to establish normal patterns of afferent GABAergic connectivity and responses to hypoglycemia
Kamitakahara, A. K., Xu, B., & Simerly, R. B. (2015) · Molecular Metabolism · doi:10.1016/j.molmet.2015.11.007 · Cited by 28
“Deletion of the vesicular glutamate transporter gene from SF1 neurons reduces glutamate release from the VMH and results in impaired glucagon and epinephrine secretion during insulin-induced hypoglycemia [10].”
Background
Hypothalamic metabolic compartmentation during appetite regulation as revealed by magnetic resonance imaging and spectroscopy methods
Lizarbe, B., Benítez, A., Brioso, G. A. P., Sánchez-Montañés, M. A., López‐Larrubia, P., Ballesteros, P., & Cerdán, S. (2013) · Frontiers in Neuroenergetics · doi:10.3389/fnene.2013.00006 · Cited by 29
“In particular, intracerebral glutamate administration is known to elicit an intense orexigenic response (Stanley et al., 1993) while knock out mice in glutamate or GABA vesicular transporters are known to exhibit altered feeding behavior (Tong et al., 2007; Xu et al., 2012).”
Background
Insulin action on GABA neurons is a critical regulator of energy balance but not fertility in mice.
Evans, M. C., Rizwan, M. Z., & Anderson, G. (2014) · Endocrinology · doi:10.1210/en.2014-1412 · Cited by 28
Atoh1-dependent rhombic lip neurons are required for temporal delay between independent respiratory oscillators in embryonic mice
Tupal, S., Huang, W., Picardo, M. C. D., Ling, G., Negro, C. A. D., Zoghbi, H. Y., & Gray, P. A. (2014) · eLife · doi:10.7554/elife.02265 · Cited by 27
“, 2010), and VGlut2Flox/Flox (VGlut2F/F) (Tong et al., 2007) mice.”
MethodInfluential
The hypothalamic regulation of metabolic adaptations to exercise
Fujikawa, T., Castorena, C. M., Lee, S., & Elmquist, J. K. (2017) · Journal of Neuroendocrinology · doi:10.1111/jne.12533 · Cited by 28
TRPCing around the hypothalamus
Kelly, M. J., Qiu, J., & Rønnekleiv, O. K. (2018) · Frontiers in Neuroendocrinology · doi:10.1016/j.yfrne.2018.05.004 · Cited by 29
“, 2017), which provide an additional excitatory drive to POMC neurons (Conde et al., 2017; Tong et al., 2007).”
Background
The Role of Mediobasal Hypothalamic PACAP in the Control of Body Weight and Metabolism
Bozadjieva-Kramer, N., Ross, R., JOHNSON, D. Q., Fenselau, H., Haggerty, D. L., Atwood, B. K., Lowell, B. B., & Flak, J. N. (2021) · Endocrinology · doi:10.1210/endocr/bqab012 · Cited by 28
Steroidogenic Factor 1 in the Ventromedial Nucleus of the Hypothalamus Regulates Age-Dependent Obesity
Kinyua, A. W., Yang, D. J., Chang, I., & Kim, K. W. (2016) · PLoS ONE · doi:10.1371/journal.pone.0162352 · Cited by 28
“The primers used for Vglut2 probe were 5’ttggccccgggaaa gagg 3’ and 5’agcagtatcgcagccccaaag 3’ [14].”
BackgroundMethodInfluential
Ion channels in the central regulation of energy and glucose homeostasis
Sohn, J. (2013) · Frontiers in Neuroscience · doi:10.3389/fnins.2013.00085 · Cited by 25
“Considering that glutamate release from SF1 neurons regulate glucose homeostasis (Tong et al., 2007), it will be worthwhile to study the role of iGluRs expressed by arcuate POMC neurons in glucose homeostasis.”
Background
Glutamatergic cerebellar neurons differentially contribute to the acquisition of motor and social behaviors
van der Heijden, M. E., Hipolito, A. G. R., Kim, L. H., Kizek, D. J., Perez, R. M., Lin, T., & Sillitoe, R. V. (2023) · Nature Communications · doi:10.1038/s41467-023-38475-9 · Cited by 29
Ablation of LMO4 in glutamatergic neurons impairs leptin control of fat metabolism
Zhou, X. C., Gomez-Smith, M., Qin, Z., Duquette, P. M., Cárdenas‐Blanco, A., Rai, P. S., Harper, M., Tsai, E. C., Anisman, H., & Chen, H. (2011) · Cellular and Molecular Life Sciences · doi:10.1007/s00018-011-0794-3 · Cited by 26
“metabolism [6, 7].”
Diabetes Mellitus and Disturbances in Brain Connectivity: A Bidirectional Relationship?
Mansur, R. B., Cha, D. S., Woldeyohannes, H. O., Soczynska, J. K., Zugman, A., Brietzke, E. M., & McIntyre, R. S. (2014) · NeuroMolecular Medicine · doi:10.1007/s12017-014-8316-8 · Cited by 27
“…that a decrease in the cerebral content of ATP results in glutamate release, HPA axis and sympathetic nervous system activation, as well as pancreatic b-cells inhibition and gluconeogenesis stimulation (Peters et al. 2004; Mulder et al. 2005; Pocai et al. 2005; Chan et al. 2007; Tong et al. 2007).”
Background
Testing the role of preBötzinger Complex somatostatin neurons in respiratory and vocal behaviors
Tupal, S., Rieger, M. A., Ling, G., Park, T. J., Dougherty, J. D., Goodchild, A. K., & Gray, P. A. (2014) · European Journal of Neuroscience · doi:10.1111/ejn.12669 · Cited by 26
Inflammatory and Glutamatergic Homeostasis Are Involved in Successful Aging
Hascup, E. R., Wang, F., Kopchick, J. J., & Bartke, A. (2015) · The Journals of Gerontology Series A · doi:10.1093/gerona/glv010 · Cited by 26
Glutamate inputs send prediction error of reward, but not negative value of aversive stimuli, to dopamine neurons
Amo, R., Uchida, N., & Watabe‐Uchida, M. (2024) · Neuron · doi:10.1016/j.neuron.2023.12.019 · Cited by 23
Activation of hypothalamic RIP‐Cre neurons promotes beiging of WAT via sympathetic nervous system
Wang, B., Li, A., Li, X., Ho, P. W., Wu, D., Wang, X., Liu, Z., Wu, K. K.-L., Yau, S., Xu, A., et al. (2018) · EMBO Reports · doi:10.15252/embr.201744977 · Cited by 25
“First, RIP-Cre neurons in ARC are heterogeneous and GABAergic (i.e., release the inhibitory neurotransmitter GABA) in nature [38,51], whereas the majority of VMH neurons are glutamatergic (i.e., release the excitatory neurotransmitter glutamine) [52].”
Hypoglycemia-Sensing Neurons of the Ventromedial Hypothalamus Require AMPK-Induced Txn2 Expression but Are Dispensable for Physiological Counterregulation
Quenneville, S., Labouèbe, G., Basco, D., Metref, S., Viollet, B., Foretz, M., & Thorens, B. (2020) · Diabetes · doi:10.2337/db20-0577 · Cited by 24
“More recently, it has been shown that inactivation of the vesicular glutamate transporter (vGlut2) gene in Sf1 neurons, which represent most of the VMN neurons, suppresses glutamatergic synaptic transmission and prevents the normal counterregulatory response to hypoglycemia (9).”
BackgroundMethod
Role of insulin in the neuroendocrine control of reproduction
Evans, M. C., Hill, J. W., & Anderson, G. M. (2021) · Journal of Neuroendocrinology · doi:10.1111/jne.12930 · Cited by 24
Hormonal Control of Metabolism by the Hypothalamus-Autonomic Nervous System-Liver Axis
Kalsbeek, A., Bruinstroop, E., Yi, C., Klieverik, L. P., Liu, J., & Fliers, E. (2014) · Frontiers of hormone research · doi:10.1159/000358312 · Cited by 25
New Insights in Ghrelin Orexigenic Effect
Diéguez, C., Boit, K. D., Novelle, M. G., de Morentin, P. B. M., Nogueiras, R., & López, M. (2010) · Frontiers of hormone research · doi:10.1159/000318511 · Cited by 28
Brain nuclear receptors and body weight regulation
Xu, Y., O’Malley, B. W., & Elmquist, J. K. (2017) · Journal of Clinical Investigation · doi:10.1172/jci88891 · Cited by 25
“Further, glutamate release from SF1 neurons has been implicated in the regulation of body weight, glucose balance (45), locomotor activity, and anxiety in mice (46).”
Impaired Glutamatergic Neurotransmission in the Ventromedial Hypothalamus May Contribute to Defective Counterregulation in Recurrently Hypoglycemic Rats
Chowdhury, G. M. I., Wang, P., Ciardi, A., Mamillapalli, R., Johnson, J., Zhu, W., Eid, T., Behar, K. L., & Chan, O. T. M. (2017) · Diabetes · doi:10.2337/db16-1589 · Cited by 21
Eliminating the VGlut2-Dependent Glutamatergic Transmission of Parvalbumin-Expressing Neurons Leads to Deficits in Locomotion and Vocalization, Decreased Pain Sensitivity, and Increased Dominance
Roccaro-Waldmeyer, D. M., Girard, F., Milani, D., Vannoni, E., Prétôt, L., Wolfer, D. P., & Celio, M. R. (2018) · Frontiers in Behavioral Neuroscience · doi:10.3389/fnbeh.2018.00146 · Cited by 24
“The efficacy of such a Cre-Lox approach, used in combination with Slc17a6-Loxmutant mice, has been confirmed previously (Tong et al., 2007; Wallén-Mackenzie et al., 2009; Birgner et al., 2010).”
Method
Neural Progenitor Cells and the Hypothalamus
Makrygianni, E. A., & Chrousos, G. P. (2023) · Cells · doi:10.3390/cells12141822 · Cited by 30
“Abbreviations ACTH: adrenocorticotropic hormone; AgRP: agouti-related peptide; α-MSH: α-melanocyte-stimulating hormone; AP; area postrema; ARC: arcuate nucleus; ASCL1: Achaete-Scute Family BHLH Transcription Factor 1; AVP: arginine vasopressin; AVPR: arginine vasopressin receptor; AV V-SVZ: anterior ventral ventricula…”
BackgroundInfluential
Neuronal regulation of glucagon secretion and gluconeogenesis
Thorens, B. (2022) · Journal of Diabetes Investigation · doi:10.1111/jdi.13745 · Cited by 25
Chronic high-fat diet induces overeating and impairs synaptic transmission in feeding-related brain regions
Wang, X., & Li, H. (2022) · Frontiers in Molecular Neuroscience · doi:10.3389/fnmol.2022.1019446 · Cited by 24
[C3(OH)2mim][BF4]-Au/Pt biosensor for glutamate sensing in vivo integrated with on-line microdialysis system
Yu, Y., Liu, X., Jiang, D., Sun, Q., Zhou, T., Zhu, M., Jin, L., & Shi, G. (2010) · Biosensors and Bioelectronics · doi:10.1016/j.bios.2010.12.031 · Cited by 25
“It is also involved in the process of mediating energy xpenditure, insulin–glucose homeostasis, the sleep–awake cycle, nd the neuroendocrine output of the pituitary gland in the venromedial hypothalamus (Tong et al., 2007; Wilson and Johnson, 008).”
Background
Neurobiological characteristics underlying metabolic differences between males and females
Chowen, J. A., Freire‐Regatillo, A., & Argente, J. (2018) · Progress in Neurobiology · doi:10.1016/j.pneurobio.2018.09.001 · Cited by 24
Sex-Specific Control of Fat Mass and Counterregulation by Hypothalamic Glucokinase
Steinbusch, L. K. M., Picard, A., Bonnet, M. S., Basco, D., Labouèbe, G., & Thorens, B. (2016) · Diabetes · doi:10.2337/db15-1514 · Cited by 23
“For instance, inhibition of glutamatergic transmission by inactivation of the synaptic vesicular transporter vGLUT2 gene prevented the normal glucagon response to hypoglycemia (25), thereby supporting a glucose-sensing role of these neurons.”
Background
A developmental switch between electrical and neuropeptide communication in the ventromedial hypothalamus
Shao, Y.-Q., Fan, L., Wu, W., Zhu, Y.-J., & Xu, H. (2022) · Current Biology · doi:10.1016/j.cub.2022.05.029 · Cited by 21
Quantification of Behavioral Deficits in Developing Mice With Dystonic Behaviors
van der Heijden, M. E., Gill, J. S., Hipolito, A. G. R., Leon, L. E. S., & Sillitoe, R. V. (2022) · Dystonia · doi:10.3389/dyst.2022.10494 · Cited by 18
“For the experiments in this study, we crossed male mice that were heterozygous for Ptf1aCre (JAX #023329) (56) and homozygous for the LoxP-flanked glutamatergic vesicular transporter 2 gene, Vglut2fl (JAX #012898) (57), to female mice that were homozygous for Vglut2fl.”
Method
The Suprachiasmatic Nucleus Modulates the Sensitivity of Arcuate Nucleus to Hypoglycemia in the Male Rat
Chao, D. H. M., Mercado, L. L., Foppen, E., Guzmán‐Ruiz, M. A., Basualdo, M. C., Escobar, C., & Buijs, R. M. (2016) · Endocrinology · doi:10.1210/en.2015-1751 · Cited by 22
The glutamate receptor GluK2 contributes to the regulation of glucose homeostasis and its deterioration during aging
Abarkan, M., Gaitan, J., Lebreton, F., Perrier, R., Jaffredo, M., Mulle, C., Magnan, C., Raoux, M., & Lang, J. (2019) · Molecular Metabolism · doi:10.1016/j.molmet.2019.09.011 · Cited by 20
“In this context glutamate plays a role in ventromedial hypothalamic neurons [64] and via kainate receptors in the dorsal motor nucleus of the vagus that regulates stimulatory parasympathetic output to the islets [65].”
Background
Euglycemia Restoration by Central Leptin in Type 1 Diabetes Requires STAT3 Signaling but Not Fast-Acting Neurotransmitter Release
Xu, Y., Chang, J. T., Myers, M. G., Xu, Y., & Tong, Q. (2016) · Diabetes · doi:10.2337/db15-1160 · Cited by 21
“A recent study (21,22) suggests that leptin action in the ventromedial hypothalamic (VMH) neurons, which are mainly glutamatergic, is also sufficient to mediate glucose-lowering effects of central leptin action, suggesting a role for glutamate release in mediating the leptin action.”
Background
GHRH Neurons from the Ventromedial Hypothalamic Nucleus Provide Dynamic and Sex-Specific Input to the Brain Glucose-Regulatory Network
Sapkota, S., Ali, M. H., Alshamrani, A. A., Napit, P. R., Roy, S. C., Pasula, M. B., & Briski, K. P. (2023) · Neuroscience · doi:10.1016/j.neuroscience.2023.08.006 · Cited by 21
Endogenous BDNF regulates inhibitory synaptic transmission in the ventromedial nucleus of the hypothalamus
Jo, Y. (2011) · Journal of Neurophysiology · doi:10.1152/jn.00353.2011 · Cited by 21
“Mice lacking vesicular glutamate transporter in SF-1 neurons develop a modest increase in body weight when fed a high-fat and high-sucrose diet (Tong et al. 2007).”
Background
Glycogen Phosphorylase Isoform Regulation of Ventromedial Hypothalamic Nucleus Gluco-Regulatory Neuron 5′-AMP-Activated Protein Kinase and Transmitter Marker Protein Expression
Uddin, M. M., Ibrahim, M. M. H., & Briski, K. P. (2021) · ASN NEURO · doi:10.1177/17590914211035020 · Cited by 20
“Knockout of the neuron-specific vesicular glutamate transporter-2 was observed to suppress glucagon and epinephrine secretion and to inhibit hepatic gluconeogenic enzyme gene expression in the mouse (Tong et al., 2007).”
Background
Anoctamin 4 channel currents activate glucose-inhibited neurons in the mouse ventromedial hypothalamus during hypoglycemia
Tu, L., Bean, J. C., He, Y., Liu, H., Yu, M., Liu, H., Zhang, N., Yin, N., Han, J., Scarcelli, N. A., et al. (2023) · Journal of Clinical Investigation · doi:10.1172/jci163391 · Cited by 20
“Mice with genetic loss of glutamate release from VMH neurons exert a lower fasting glucose level and impaired counterregulatory response to insulin-induced hypoglycemia and glucopenia (14).”
Background
Distinct roles of spinal commissural interneurons in transmission of contralateral sensory information
Laflamme, O. D., Markin, S. N., Deska‐Gauthier, D., Banks, R. A., Zhang, Y., Danner, S. M., & Akay, T. (2023) · Current Biology · doi:10.1016/j.cub.2023.07.014 · Cited by 20
Expanding neurotransmitters in the hypothalamic neurocircuitry for energy balance regulation
Xu, Y., & Tong, Q. (2011) · Protein & Cell · doi:10.1007/s13238-011-1112-4 · Cited by 20
“Using deletion of VGLUT2 or VGAT as a means to disrupt glutamate or GABA release, studies are beginning to reveal their roles in leptin neural pathways (Tong et al., 2007, 2008).”
BackgroundMethodInfluential
The corpulent phenotype—how the brain maximizes survival in stressful environments
Peters, A., Kubera, B., Hubold, C., & Langemann, D. (2013) · Frontiers in Neuroscience · doi:10.3389/fnins.2013.00047 · Cited by 22
“Keywords: mortality, obesity, phenotypic plasticity, selfish brain theory, stress reactivity”
Background
High-Intensity Exercise as a Dishabituating Stimulus Restores Counterregulatory Responses in Recurrently Hypoglycemic Rodents
McNeilly, A. D., Gallagher, J. R., Huang, J. T.-J., Ashford, M. L. J., & McCrimmon, R. J. (2017) · Diabetes · doi:10.2337/db16-1533 · Cited by 20
“Loss of VMH glutamatergic Steroidogenic Factor 1 (SF1) activity suppresses the CRR to hypoglycemia (21), while specific deletion of BDNF in VMH SF1 neurons also results in a reduced CRR to hypoglycemia (22).”
Background
Remote control of glucose-sensing neurons to analyze glucose metabolism
Alvarsson, A., & Stanley, S. A. (2018) · American Journal of Physiology-Endocrinology and Metabolism · doi:10.1152/ajpendo.00469.2017 · Cited by 22
Hypoglycemia: Role of Hypothalamic Glucose-Inhibited (GI) Neurons in Detection and Correction
Zhou, C., Teegala, S. B., Khan, B. A., Gonzalez, C., & Routh, V. H. (2018) · Frontiers in Physiology · doi:10.3389/fphys.2018.00192 · Cited by 19
“Strong evidence in rodents supports a role for ventromedial hypothalamus (VMH) glucose sensors in the hormonal CRR (Borg et al., 1994, 1995, 1997; Tong et al., 2007) as well as in glucoprivic feeding (Dunn-Meynell et al., 2009).”
Background
2. Hypoglycemia Detection
Routh, V. H., Donovan, C. M., & Ritter, S. (2012) · Translational endocrinology & metabolism · doi:10.1210/team.9781936704200.ch2 · Cited by 19
The principle of ‘brain energy on demand’ and its predictive power for stress, sleep, stroke, obesity and diabetes
Peters, A., Sprengell, M., & Kubera, B. (2022) · Neuroscience & Biobehavioral Reviews · doi:10.1016/j.neubiorev.2022.104847 · Cited by 19
“In turn, these VMH neurons release glutamate (Tong et al., 2007) and in so doing activate the sympathetic nervous system (SNS) and the hypothalamuspituitary-adrenal (HPA) axis.”
Cerebellar nuclei cells produce distinct pathogenic spike signatures in mouse models of ataxia, dystonia, and tremor
van der Heijden, M. E., Brown, A. M., Kizek, D. J., & Sillitoe, R. V. (2024) · eLife · doi:10.7554/elife.91483.3 · Cited by 18
Rapid glutamate release in the mediobasal hypothalamus accompanies feeding and is exaggerated by an obesogenic food
Guyenet, S. J., Matsen, M. E., Morton, G. J., Kaiyala, K. J., & Schwartz, M. W. (2013) · Molecular Metabolism · doi:10.1016/j.molmet.2013.02.001 · Cited by 18
Running the Female Power Grid Across Lifespan Through Brain Estrogen Signaling
Ingraham, H. A., Herber, C. B., & Krause, W. C. (2021) · Annual Review of Physiology · doi:10.1146/annurev-physiol-061121-035914 · Cited by 18
A proteomics–metabolomics approach indicates changes in hypothalamic glutamate–GABA metabolism of adult female rats submitted to intrauterine growth restriction
Pedroso, A. P., Dornellas, A. P. S., de Souza, A. P., Pagotto, J. F., Oyama, L. M., do Nascimento, C. M. O., Klawitter, J., Christians, U., Tashima, A. K., & Ribeiro, E. B. (2018) · European Journal of Nutrition · doi:10.1007/s00394-018-1851-6 · Cited by 17
Melanin-concentrating hormone neurons promote rapid eye movement sleep independent of glutamate release
Naganuma, F., Bandaru, S. S., Absi, G., Chee, M. J. S., & Vetrivelan, R. (2018) · Brain Structure and Function · doi:10.1007/s00429-018-1766-2 · Cited by 17
Dopaminergic signaling to ventral striatum neurons initiates sniffing behavior
Johnson, N. L., Cotelo-Larrea, A., Stetzik, L. A., Akkaya, U. M., Zhang, Z., Gadziola, M. A., Varga, A. G., Ma, M., & Wesson, D. W. (2025) · Nature Communications · doi:10.1038/s41467-024-55644-6 · Cited by 19
Galnt2 neurons in the ventromedial hypothalamus counterregulate hypoglycemia via a brain-liver neurocircuit
Wang, J., Sun, X., Gong, X., Dai, W., Hong, H., Jiang, L., Wang, Z., Tang, Z., Wu, X., Sun, P., et al. (2025) · Cell Metabolism · doi:10.1016/j.cmet.2025.09.006 · Cited by 18
Brain-Body Control of Glucose Homeostasis—Insights From Model Organisms
MacDonald, A. J., Yang, Y. H. C., Cruz, A. M., Beall, C., & Ellacott, K. L. J. (2021) · Frontiers in Endocrinology · doi:10.3389/fendo.2021.662769 · Cited by 16
“However, evidence suggests that hindbrain-limited recurrent glucoprivation does not alter CRR (62), suggesting that adaptations to hypoglycemia that cause defective CRR are likely forebrainmediated.”
BackgroundMethodInfluential
Population coding of predator imminence in the hypothalamus
Cheung, K. Y. M., Nair, A., Li, L.-Y., Shapiro, M. G., & Anderson, D. J. (2025) · Neuron · doi:10.1016/j.neuron.2025.02.003 · Cited by 16
CB1Rs in VMH neurons regulate glucose homeostasis but not body weight
Castorena, C. M., Caron, A., Michael, N. J., Ahmed, N. I., Arnold, A. G., Lee, J., Lee, C., Limboy, C., Tinajero, A., Granier, M., et al. (2021) · American Journal of Physiology-Endocrinology and Metabolism · doi:10.1152/ajpendo.00044.2021 · Cited by 16
A Role for the Forebrain in Mediating Time-of-Day Differences in Glucocorticoid Counterregulatory Responses to Hypoglycemia in Rats
Gorton, L. M., Khan, A. M., Bohland, M., Sanchez‐Watts, G., Donovan, C. M., & Watts, A. G. (2007) · Endocrinology · doi:10.1210/en.2007-0194 · Cited by 16
“However, glucose-sensing mechanisms located in the hypothalamus, particularly those in the region of the ventromedial and arcuate nuclei, seem much less important for the ACTH response to hypoglycemia (18, 46, 47).”
P110β in the ventromedial hypothalamus regulates glucose and energy metabolism
Fujikawa, T., Choi, Y., Yang, D. J., Shin, D. M., Donato, J., Kohno, D., Lee, C. E., Elias, C. F., Lee, S., & Kim, K. W. (2019) · Experimental & Molecular Medicine · doi:10.1038/s12276-019-0249-8 · Cited by 18
EphA5-EphrinA5 Interactions Within the Ventromedial Hypothalamus Influence Counterregulatory Hormone Release and Local Glutamine/Glutamate Balance During Hypoglycemia
Szepietowska, B., Zhu, W., Czyzyk, J. K., Eid, T., & Sherwin, R. S. (2012) · Diabetes · doi:10.2337/db12-0982 · Cited by 16
“Mice with impaired glutamatergic neurotransmission secondary to the loss the glutamate transporter, VGLUT2, selectively in SF1 VMH neurons exhibit a modest reduction in fasting glucose levels, marked suppression of glucagon secretion, and diminished catecholamine responses during insulin-induced hypoglycemia (37).”
BackgroundMethod
The unique expression profile of FAM19A1 in the mouse brain and its association with hyperactivity, long-term memory and fear acquisition
Yong, H. J., Ha, N., Cho, E. B., Yun, S., Kim, H., Hwang, J., & Seong, J. Y. (2020) · Scientific Reports · doi:10.1038/s41598-020-60266-1 · Cited by 15
Proxyfan acts as a neutral antagonist of histamine H3 receptors in the feeding‐related hypothalamic ventromedial nucleus
Clapp, R., & Luckman, S. M. (2012) · British Journal of Pharmacology · doi:10.1111/j.1476-5381.2012.02056.x · Cited by 15
“…still relatively little is known about the phenotypes of the neurones involved, although pituitary adenylate cyclase-activating polypeptide (Hawke et al., 2009), brainderived neurotrophic factor (Unger et al., 2007) and glutamate-containing (Tong et al., 2007) neurones are clearly involved.”
Background
Cerebellar nuclei cells produce distinct pathogenic spike signatures in mouse models of ataxia, dystonia, and tremor
van der Heijden, M. E., Brown, A. M., Kizek, D. J., & Sillitoe, R. V. (2023) · eLife · doi:10.7554/elife.91483 · Cited by 33
“…( Tong et al., 2008 ), Ptf1a Cre (gift from Dr. Chris Wright) ( Kawaguchi et al., 2002 ), Slc17a6 fl (also known as Vglut2 fl ; JAX:012898) ( Tong et al., 2007 ), Pdx1 Cre (gift from Dr. Qingchun Tong) ( Gu et al., 2002 ), Car8 wdl/wdl (JAX:004625) ( Jiao et al., 2005 ), Atxn1 154Q…”
Glutamate neurotransmission from leptin receptor cells is required for typical puberty and reproductive function in female mice
de Miera, C. S., Bellefontaine, N., Allen, S. J., Myers, M. G., & Elias, C. F. (2024) · eLife · doi:10.7554/elife.93204 · Cited by 16
“…), the Lepr Cre knock-in ( Lepr - Cre, JAX; stock 032457) ( Leshan et al., 2006 ), Kiss1 hrGFP ( Kiss1 - hrGFP; JAX, stock 023425) ( Cravo et al., 2013 ), Vglut2 flox ( Slc17a6 or Vglut2 gene, JAX; Stock 012898) ( Tong et al., 2007 ), and C57BL/6 (JAX; Stock 000664) mice were used for experiments.”
Background
Developmental control of rod number via a light-dependent retrograde pathway from intrinsically photosensitive retinal ganglion cells
D’Souza, S. P., Upton, B. A., Eldred, K. C., Glass, I. A., Nayak, G., Grover, K. E., Ahmed, A., Nguyen, M., Hu, Y., Gamlin, P. D., et al. (2024) · Developmental Cell · doi:10.1016/j.devcel.2024.07.018 · Cited by 17
Defective autophagy in Sf1 neurons perturbs the metabolic response to fasting and causes mitochondrial dysfunction
Coupé, B., Leloup, C., Asiedu, K., Maillard, J., Pénicaud, L., Horváth, T. L., & Bouret, S. G. (2021) · Molecular Metabolism · doi:10.1016/j.molmet.2021.101186 · Cited by 14
“Previous studies reported a role for SF1 neurons in glucose metabolism [16; 19; 26; 27].”
Background
Brain More Resistant to Energy Restriction Than Body: A Systematic Review
Sprengell, M., Kubera, B., & Peters, A. (2021) · Frontiers in Neuroscience · doi:10.3389/fnins.2021.639617 · Cited by 16
“, 2007), and via glutamatergic mechanisms these VMH neurons activate the sympathoadrenal system (Tong et al., 2007; Lindberg et al., 2013).”
Background
Responses to cholecystokinin in the ventromedial nucleus of the rat hypothalamus in vivo
Sabatier, N., & Leng, G. (2010) · European Journal of Neuroscience · doi:10.1111/j.1460-9568.2010.07144.x · Cited by 14
“Recent studies showed that many neurons in the VMN express the orphan nuclear receptor steroidogenic factor-1 (SF-1), which appears to be crucial for appetite inhibition in mice (Majdic et al., 2002; Liu et al., 2006).”
BackgroundInfluential
Energy state alters regulation of proopiomelanocortin neurons by glutamatergic ventromedial hypothalamus neurons: pre- and postsynaptic mechanisms
Rau, A. R., & Hentges, S. T. (2021) · Journal of Neurophysiology · doi:10.1152/jn.00359.2020 · Cited by 13
SOCS3 Ablation in Leptin Receptor-Expressing Cells Causes Autonomic and Cardiac Dysfunctions in Middle-Aged Mice despite Improving Energy and Glucose Metabolism
Pedroso, J. A. B., da Silva, I. B., Zampieri, T. T., Totola, L. T., Moreira, T. S., Taniguti, A. P. T., Diniz, G. P., Barreto‐Chaves, M. L. M., & Donato, J. (2022) · International Journal of Molecular Sciences · doi:10.3390/ijms23126484 · Cited by 13
“The prevention of glutamatergic neurotransmission from VMH neurons also reduces fasting glycemia and the counterregulatory response to hypoglycemia [80].”
Background
Hypothalamic ventromedial COUP-TFII protects against hypoglycemia-associated autonomic failure
Sabra-Makke, L., Maritan, M., Planchais, J., Boutant, M., Pégorier, J. P., Even, P. C., Vasseur-Cognet, M., & Bossard, P. (2013) · Proceedings of the National Academy of Sciences · doi:10.1073/pnas.1219262110 · Cited by 13
AMPA/kainate receptors in the ventromedial hypothalamus mediate the effects of glutamate on estrus termination in the rat
Georgescu, M., Cyr, D., & Pfaus, J. G. (2012) · Pharmacology Biochemistry and Behavior · doi:10.1016/j.pbb.2012.04.001 · Cited by 13
“Studies on hypoglycemia have found that glutamate release from steroidogenic factor-1 neurons within the VMH is an important mechanism within the neurocircuitry that underlies prevention of hypoglycemia (Tong et al., 2007).”
Background
Stage-Specific Inhibition of TrkB Activity Leads to Long-Lasting and Sexually Dimorphic Effects on Body Weight and Hypothalamic Gene Expression
Byerly, M. S., Swanson, R. D., Wong, G. W., & Blackshaw, S. (2013) · PLoS ONE · doi:10.1371/journal.pone.0080781 · Cited by 13
“Many key physiological processes are regulated by the VMH, including glucose homeostasis and appetite control [44–47].”
Background
Rapid-onset hypoglycemia suppresses Fos expression in discrete parts of the ventromedial nucleus of the hypothalamus
Foster, N. N., Azam, S., & Watts, A. G. (2016) · American Journal of Physiology-Regulatory, Integrative and Comparative Physiology · doi:10.1152/ajpregu.00042.2016 · Cited by 12
“Many studies implicate the ventromedial nucleus of the hypothalamus (VMH) as a key nucleus for sensing glucose deficits and controlling epinephrine and glucagon CRRs during the rapid-onset hypoglycemia that develops between 20 and 30 min after insulin treatment (13, 16, 27, 28, 34, 49, 53).”
Background
Neurochemical Basis of Inter-Organ Crosstalk in Health and Obesity: Focus on the Hypothalamus and the Brainstem
Haspula, D., & Cui, Z. (2023) · Cells · doi:10.3390/cells12131801 · Cited by 12
BAD Modulates Counterregulatory Responses to Hypoglycemia and Protective Glucoprivic Feeding
Osundiji, M. A., Godes, M., Evans, M. L., & Danial, N. N. (2011) · PLoS ONE · doi:10.1371/journal.pone.0028016 · Cited by 12
“In addition, neurotransmitters such as c-amino butyric acid (GABA) [26,27,28,29], glutamate [30], N-methyl Daspartate (NMDA) [31], as well as corticotrophin-releasing factor receptors [32] have been implicated in hypoglycemia counterregulation.”
Background
Glucose Transport
McCall, A. L. (2019) · Elsevier eBooks · doi:10.1016/b978-0-12-813146-6.00022-9 · Cited by 12
Central and peripheral neural circuits regulating glucose homeostasis
Espinoza, D., Seibold, F., & Stanley, S. A. (2025) · npj Biomedical Innovations. · doi:10.1038/s44385-025-00036-8 · Cited by 13
“In contrast, deletion of the glutamate transporter vGlut2 to block glutamate release from SF-1 neurons blunted glucagon release and lowered blood glucose in response to insulin-induced hypoglycemia 34 .”
Canonical transient receptor potential channels and hypothalamic control of homeostatic functions
Kelly, M. J., & Wagner, E. J. (2024) · Journal of Neuroendocrinology · doi:10.1111/jne.13392 · Cited by 11
“84,85 Similar to Kiss1 ARH neurons, TRPC 5 channels are also an effector target for multiple peptide receptors in POMC neurons.”
Defining spatial nonuniformities of all ipRGC types using an improved Opn4 recombinase mouse line
Dyer, B., Yu, S. O., Brown, R. L., Lang, R. A., & D’Souza, S. P. (2024) · Cell Reports Methods · doi:10.1016/j.crmeth.2024.100837 · Cited by 11
Hypothalamic cannabinoid signaling: Consequences for eating behavior
Lord, M. N., & Noble, E. E. (2024) · Pharmacology Research & Perspectives · doi:10.1002/prp2.1251 · Cited by 10
Hypothalamic–Pituitary and Adipose Tissue Responses to the Effect of Resistin in Sheep: The Integration of Leptin and Resistin Signaling Involving a Suppressor of Cytokine Signaling 3 and the Long Form of the Leptin Receptor
Zieba, D. A., Biernat, W., Szczęsna, M., Kirsz, K., & Misztal, T. (2019) · Nutrients · doi:10.3390/nu11092180 · Cited by 11
“The VMH, which is rich in glucose-sensing neurons, and the LeptRb neurons in this nucleus may also participate in glucose homeostasis regulation [31,32].”
Background
Influence of data sampling methods on the representation of neural spiking activity in vivo
van der Heijden, M. E., Brown, A. M., & Sillitoe, R. V. (2022) · iScience · doi:10.1016/j.isci.2022.105429 · Cited by 11
Hypothalamic Neurones Governing Glucose Homeostasis
Coppari, R. (2015) · Journal of Neuroendocrinology · doi:10.1111/jne.12276 · Cited by 12
Spatially resolved molecular sex differences at single-cell resolution in the adult human ventromedial and arcuate hypothalamus
Mulvey, B., Wang, Y., Divecha, H. R., Bach, S. V., Montgomery, K. D., Cinquemani, S., Chandra, A., Du, Y., Miller, R. A., Kleinman, J. E., et al. (2026) · Cell Reports · doi:10.1016/j.celrep.2025.116877 · Cited by 10
“Further, “regulation of insulin secretion” genes were enriched among highly expressed genes in vVMH, consistent with its glucoregulatory function in rodents ( 90 ) ,( 91 , 92 ) .”
Sex-Dimorphic Effects of Hypoglycemia on Metabolic Sensor mRNA Expression in Ventromedial Hypothalamic Nucleus-Dorsomedial Division (VMNdm) Growth Hormone-Releasing Hormone Neurons
Sapkota, S., & Briski, K. P. (2024) · ACS Chemical Neuroscience · doi:10.1021/acschemneuro.4c00206 · Cited by 9
An alternative neural basis underlying leptin resistance
Li, H., Su, C., Xu, Y., Ludwig, M. Q., Davis, J. F., & Tong, Q. (2025) · Cell Reports · doi:10.1016/j.celrep.2025.115863 · Cited by 11
“Since the ventromedial hypothalamus surrounds the Arc and mostly consists of glutamatergic neurons with Vglut2 expression, 23 the presence of Vglut2-Cre will limit NachBac expression in GABAergic neurons within the Arc (Figure 2B).”
Steroidogenic Factor-1 form and function: From phospholipids to physiology
Campbell, A. N., Choi, W. J., Ethan, S., Orun, A. R., Poland, J. C., Stivison, E., Kubina, J. N., Hudson, K. L., Loi, M. N. C., Bhatia, J. N., et al. (2023) · Advances in Biological Regulation · doi:10.1016/j.jbior.2023.100991 · Cited by 9
Hypothalamic Irak4 is a genetically controlled regulator of hypoglycemia-induced glucagon secretion
Picard, A., Berney, X. P., Castillo‐Armengol, J., Tarussio, D., Jan, M., Sánchez-Archidona, A. R., Croizier, S., & Thorens, B. (2022) · Molecular Metabolism · doi:10.1016/j.molmet.2022.101479 · Cited by 9
Silencing the Output of Cerebellar Neurons Using Cell Type-Specific Genetic Deletion of Vesicular GABA and Glutamate Transporters
van der Heijden, M. E., Brown, A. M., & Sillitoe, R. V. (2022) · Neuromethods · doi:10.1007/978-1-0716-2026-7_3 · Cited by 9
Energy Partitioning, Ingestive Behavior, and Reproductive Success
Schneider, J. E., & Watts, A. G. (2009) · Elsevier eBooks · doi:10.1016/b978-008088783-8.00006-1 · Cited by 9
Oseltamivir phosphate (Tamiflu) alters neurobehavior of zebrafish larvae by inducing mitochondrial dysfunction
Wang, S., Zou, M., Zhu, Z., Wang, Z., Li, K., Ruan, J., Zhao, B., Pan, C., Lan, X., Zhang, S., et al. (2024) · The Science of The Total Environment · doi:10.1016/j.scitotenv.2024.177077 · Cited by 8
Investigating metabolic regulation using targeted neuromodulation
Devarakonda, K., & Stanley, S. A. (2017) · Annals of the New York Academy of Sciences · doi:10.1111/nyas.13468 · Cited by 7
Remembrance of things past: The consequences of recurrent hypoglycaemia in diabetes
McCrimmon, R. J. (2022) · Diabetic Medicine · doi:10.1111/dme.14973 · Cited by 7
Regulation of Satiety by Bdnf-e2-Expressing Neurons through TrkB Activation in Ventromedial Hypothalamus
Chu, P., Guo, W., You, H., & Lu, B. (2023) · Biomolecules · doi:10.3390/biom13050822 · Cited by 8
“Indeed, the expression of BDNF or VGLUT2 in ventrolateral part of VMH seemed undisrupted in these SF1-neuron specific knockout mice [52,53].”
Background
Homeostatic regulation of excitatory synapses on striatal medium spiny neurons expressing the D2 dopamine receptor
Thibault, D., Giguère, N., Loustalot, F., Bourque, M.-J., Ducrot, C., Mestikawy, S. E., & Trudeau, L. (2015) · Brain Structure and Function · doi:10.1007/s00429-015-1029-4 · Cited by 8
Location of glutamatergic/aspartatergic neurons projecting to the hypothalamic ventromedial nucleus studied by autoradiography of retrogradely transported [3H]d-aspartate
Kiss, J., Csáki, Á., & Halász, B. (2011) · Neuroscience · doi:10.1016/j.neuroscience.2010.12.047 · Cited by 8
The Nutritional Induction of COUP-TFII Gene Expression in Ventromedial Hypothalamic Neurons Is Mediated by the Melanocortin Pathway
Sabra-Makke, L., Tourrel‐Cuzin, C., Denis, R., Moldes, M., Pégorier, J. P., Luquet, S. H., Vasseur-Cognet, M., & Bossard, P. (2010) · PLoS ONE · doi:10.1371/journal.pone.0013464 · Cited by 8
“Among the identified VMH markers, the nuclear receptor steroidogenic factor 1 (SF1) is expressed in a large subpopulation of neurons involved in the central control of glucose homeostasis [21,22].”
Background

Authors: Tong, Q., Ye, C., McCrimmon, R. J., Dhillon, H., Choi, B., Kramer, M. D., Yu, J., Yang, Z., Christiansen, L. M., Lee, C. E., Choi, C. S., Zigman, J. M., Shulman, G. I., Sherwin, R. S., Elmquist, J. K., & Lowell, B. B.
Affiliations: Beth Israel Deaconess Medical Center (US)
Yale University (US)
The University of Texas Southwestern Medical Center (US)
Howard Hughes Medical Institute (US)
Corresponding author: Lowell, Bradford B.
ORCID: Tong, Qingchun
McCrimmon, Rory J.
Yu, Jia
Lee, Charlotte E.
Choi, Cheol Soo
Zigman, Jeffrey M.
Shulman, Gerald I.
Elmquist, Joel K.
Lowell, Bradford B.
Venue: Cell Metabolism
Publisher: Elsevier BV
Published: 2007-05
Volume: 5
Issue: 5
Pages: 383-393
ISSN: 1550-4131 (ISSN-L)
DOI: 10.1016/j.cmet.2007.04.001
PMC: PMC1934926
OpenAlex: W1995998852
Cited by: 413
References: 62
Citations by year: 2026: 10 · 2025: 20 · 2024: 32 · 2023: 23 · 2022: 23 · 2021: 30 · 2020: 22 · 2019: 10 · 2018: 25 · 2017: 27 · 2016: 16 · 2015: 19 · 2014: 20 · 2013: 26 · 2012: 27
FWCI: 7.89
Type: journal article
Language: en
Open access: bronze
doi.org
Licence: www.elsevier.com/tdm/userlicense/1.0/ (tdm)
www.elsevier.com/open-access/userlicense/1.0/ (vor, 2305 d)
Locations: Cell Metabolism (publishedVersion)
PubMed (publishedVersion)
PubMed Central (acceptedVersion)
Discovery Research Portal (University of Dundee) (submittedVersion)
Funders: American Diabetes Association Research Foundation
Richard and Susan Smith Family Foundation
Boston Area Diabetes Endocrinology Research Center
National Institutes of Health
National Institute of Diabetes and Digestive and Kidney Diseases (P30DK057521, P01DK56116, R01DK071051, P01DK056116, P30DK046200, R01DK040936, R01DK071320, U24DK059635, DK071320, R01DK069831, R01DK072409, R37DK020495)
Topics: Life Sciences › Neuroscience › Endocrine and Autonomic Systems › Regulation of Appetite and Obesity
Health Sciences › Medicine › Endocrinology, Diabetes and Metabolism › Pancreatic function and diabetes
Life Sciences › Neuroscience › Cellular and Molecular Neuroscience › Neuroscience and Neuropharmacology Research
Keywords: ventromedial hypothalamus, glutamate release, VGLUT2, glucagon, hypoglycemia, insulin-induced hypoglycemia, PGC-1α, gluconeogenesis, phosphoenolpyruvate carboxykinase, glucose-6-phosphatase, 2-deoxyglucose, hypothalamic neurons, glucose homeostasis
MeSH terms: Peroxisome Proliferator-Activated Receptor Gamma Coactivator 1-alpha, Animals, Electrophysiology, Glucagon, Glucose-6-Phosphatase, Hypoglycemia, Hypothalamus, Insulin, Liver, Mice, Transgenic, Neurons, Synapses, Transcription Factors, Trans-Activators, In Situ Hybridization, Glutamic Acid, Vesicular Glutamate Transport Protein 2, Mice

About these checks

Registry, retraction, Cites and statistics results are computed, not judged, with one exception: a printed reference that no index lists is read once by a model before it counts as a citation error. Claims are extracted by a model and kept only when their quote appears verbatim in the text; each cited source is then checked, with a model’s help, for whether it says what the claim relies on. Those verdicts can be wrong — read the claim’s quote and the cited source before relying on one.

Statistics and arithmetic are recomputed, not judged.

Confidence bands are shown only for fields calibrated on our annotated test set. None is calibrated yet, so no band is shown.

What counts as a claim ›How we measure confidence ›How we check this ›

Are you an author, or do you see a problem with this page? Request a review

Synaptic Glutamate Release by Ventromedial Hypothalamic Neurons Is Part of the Neurocircuitry that Prevents Hypoglycemia

Abstract

Overview

Integrity signals

Verification

Claims the paper makes

Claims other papers make about this one

Citations

Cites

Cited by

Related

Metadata

Record

About these checks