Low vitamin C and increased oxidative stress and cell death in mice that lack the sodium-dependent vitamin C transporter SVCT2
Open accessAbstract
The sodium-dependent vitamin C transporter (SVCT2) is responsible for the transport of vitamin C into cells in multiple organs, from either the blood or the cerebrospinal fluid. Mice null for SVCT2 (SVCT2(-/-)) do not survive past birth but the cause of death has not yet been ascertained. After mating of SVCT2(+/-) males and SVCT2(+/-) females, fewer SVCT2(-/-) and SVCT2(+/-) progeny were observed than would be expected according to Mendelian ratios. Vitamin C levels in SVCT2(-/-), SVCT2(+/-), and SVCT2(+/+) were genotype-dependent. SVCT2(-/-) fetuses had significantly lower vitamin C levels than littermates in placenta, cortex, and lung, but not in liver (the site of vitamin C synthesis). Low vitamin C levels in placenta and cortex were associated with elevations in several markers of oxidative stress: malondialdehyde, isoketals, F(2)-isoprostanes, and F(4)-neuroprostanes. Oxidative stress was not elevated in fetal SVCT2(-/-) lung tissue despite low vitamin C levels. In addition to the expected severe hemorrhage in cortex, we also found hemorrhage in the brain stem, which was accompanied by cell loss. We found evidence of increased apoptosis in SVCT2(-/-) mice and disruption of the basement membrane in fetal brain. Together these data show that SVCT2 is critical for maintaining vitamin C levels in fetal and placental tissues and that the lack of SVCT2, and the resulting low vitamin C levels, results in fetal death and, in SVCT2(-/-) mice that survive the gestation period, in oxidative stress and cell death.
The claims and statistics of this paper haven’t been checked yet.
Run the check — free, no account needed. It reads the open-access text and checks the sources it cites.
Integrity signals
Registry
Cites
Statistics
Claims the paper makes
The claims and statistics of this paper haven’t been checked yet.
Run the check — free, no account needed. It reads the open-access text and checks the sources it cites.
Claims other papers make about this one
Each is checked against this paper’s own text: does it say what the citing paper says it does?
According to animal studies, SVCT2 is important for transport of vitamin C from mother to fetus, but SVCT1 likely participates in this process.
“According to animal studies, SVCT2 is also important for the transport of vitamin C from the mother to the fetus, but SVCT1 likely participates in this process [69,70,78].”
From Vitamin C-Sources, Physiological Role, Kinetics, Deficiency, Use, Toxicity, and Determination (2021) · cites this paper as [69]
The Discussion reports that placental vitamin C levels track SVCT2 genotype and concludes that SVCT2 controls vitamin C entry into the fetal side of the placenta. It says SVCT1 may also transport some vitamin C in the placenta, but that it is not necessary for this transport; this supports possible participation, not the stronger claim that SVCT1 likely participates. (LLM, conf=0.84)
Experimental — accuracy not yet measuredFetuses without an SVCT2 transporter have no vitamin C in the cortex and lungs and lower levels of vitamin C in the placenta.
“A good example is a fetus without an SVCT2 transporter. These fetuses have no vitamin C in the cortex and lungs together with lower levels of vitamin C in the placenta.”
From Vitamin C-Sources, Physiological Role, Kinetics, Deficiency, Use, Toxicity, and Determination (2021) · cites this paper as [69]
The Results (VC tissue contents) report that SVCT2-null fetal lungs were completely devoid of vitamin C and that placental levels were lower. Cortical vitamin C was barely detectable, rather than established to be entirely absent, so the claim’s “no vitamin C” wording overstates that finding. (LLM, conf=0.88)
Experimental — accuracy not yet measuredThe absence of SVCT2 is incompatible with life.
“The absence of SVCT2 is incompatible with life [69,70].”
From Vitamin C-Sources, Physiological Role, Kinetics, Deficiency, Use, Toxicity, and Determination (2021) · cites this paper as [69]
Vitamin C is taken up by cells via SVCT2.
“Vitamin C is taken up by the cells via SVCT2 (SLC23A2, Figure 2C), which is a close analogue of SVCT1 with which it shares 65% sequence homology.”
From Vitamin C-Sources, Physiological Role, Kinetics, Deficiency, Use, Toxicity, and Determination (2021) · cites this paper as [69]
The absence of SVCT2 in rodents results in very low levels of vitamin C in the brain, emphasizing the importance of SVCT2 for brain vitamin C transport.
“Moreover, the absence of SVCT2 in rodents results in very low levels of vitamin C in the brain, clearly emphasizing the importance of this transport for the brain [69,70].”
From Vitamin C-Sources, Physiological Role, Kinetics, Deficiency, Use, Toxicity, and Determination (2021) · cites this paper as [69]
In fetuses without an SVCT2 transporter, markers of lipid peroxidation are elevated in the cortex and placenta but not in the lungs.
“The markers of lipid peroxidation are clearly elevated in the cortex and placenta but not in the lungs [69].”
From Vitamin C-Sources, Physiological Role, Kinetics, Deficiency, Use, Toxicity, and Determination (2021) · cites this paper as [69]
Self-check
Percentages, sums and reported differences re-computed from the paper’s own numbers.
The self-check needs the paper’s full text.
Cites
A family of mammalian Na+-dependent L-ascorbic acid transporters
Tsukaguchi, H., Tokui, T., Mackenzie, B., Berger, U. V., Chen, X.-Z., Wang, Y., Brubaker, R. F., & Hediger, M. A. (1999) · Nature · doi:10.1038/19986 · Cited by 882 · cited 5× · see citing works
“The SVCT1 mediates VC absorption in the intestine and reabsorption in the kidney proximal tubule cells.”
BackgroundInfluentialVitamin C function in the brain: Vital role of the ascorbate transporter SVCT2
Harrison, F. E., & May, J. M. (2009) · Free Radical Biology and Medicine · doi:10.1016/j.freeradbiomed.2008.12.018 · Cited by 661 · cited 3× · see citing works
“VC also has multiple non-antioxidant functions in brain [3].”
BackgroundInfluentialMutations in Col4a1 Cause Perinatal Cerebral Hemorrhage and Porencephaly
Gould, D. B., Phalan, F. C., Breedveld, G. J., van Mil, S. E., Smith, R. S., Schimenti, J. C., Aguglia, U., van der Knaap, M. S., Heutink, P., & John, S. W. M. (2005) · Science · doi:10.1126/science.1109418 · Cited by 541 · cited 2× · see citing works
“The notion that defective type IV collagen deposition causes capillary hemorrhage in SVCT2−/− fetuses is also supported by a similar punctate pattern of hemorrhage and decrease in basement membrane type IV collagen seen in mice carrying a mutation of type IVa1 collagen, which is a cause of cortical damage and reabsorp…”
BackgroundA new recommended dietary allowance of vitamin C for healthy young women
Levine, M., Wang, Y., Padayatty, S. J., & Morrow, J. (2001) · Proceedings of the National Academy of Sciences · doi:10.1073/pnas.171318198 · Cited by 496 · see citing works
Formation of Isoprostane-like Compounds (Neuroprostanes) in Vivo from Docosahexaenoic Acid*
Roberts, L., Montine, T., Markesbery, W., Tapper, A. R., Hardy, P., Chemtob, S., Dettbarn, W., & Morrow, J. (1998) · Journal of Biological Chemistry · doi:10.1074/jbc.273.22.13605 · Cited by 430 · cited 1× · see citing works
“F4-neuroprostanes and F2-isoprostane levels were measured as described [18].”
MethodEldridge, C. F., Bunge, M. B., Bunge, R. P., & Wood, P. M. (1987) · The Journal of Cell Biology · doi:10.1083/jcb.105.2.1023 · Cited by 401 · cited 1× · see citing works
“Further, VC is necessary for proper myelination of neurons, a process considered to depend on collagen synthesis [8].”
BackgroundSotiriou, S., Gispert, S., Cheng, J., Wang, Y., Chen, A., Hoogstraten-Miller, S., Miller, G. F., Kwon, O., Levine, M., Guttentag, S. H., et al. (2002) · Nature Medicine · doi:10.1038/0502-514 · Cited by 367 · cited 10× · see citing works
“respiratory failure [6], the contribution of VC deficiency in the brain has not been further examined.”
BackgroundMethodResultInfluentialSVCT1 and SVCT2: Key proteins for vitamin C uptake
Savini, I., Rossi, A., Pierro, C., Avigliano, L., & Catani, M. V. (2008) · Amino Acids · doi:10.1007/s00726-007-0555-7 · Cited by 358 · cited 2× · see citing works
“the role of SVCT1 in VC uptake in lung must be minimal despite its reported presence in lung tissues [4,5].”
BackgroundRebec, G. V., & Pierce, R. C. (1994) · Progress in Neurobiology · doi:10.1016/0301-0082(94)90052-3 · Cited by 354 · cited 1× · see citing works
“Finally, VC levels in cerebrospinal fluid are increased in response to glutamate generated during neurotransmission [9,10], and VC in turn has been shown to have neuromodulatory effects on synaptic transmission [11,12].”
BackgroundProtection and Recycling of α-Tocopherol in Human Erythrocytes by Intracellular Ascorbic Acid
May, J. M., Qu, Z.-C., & Mendiratta, S. (1998) · Archives of Biochemistry and Biophysics · doi:10.1006/abbi.1997.0473 · Cited by 316 · cited 1× · see citing works
“VC was measured by HPLC as described [15,16].”
MethodSelf-citationGrünewald, R. A. (1993) · Brain Research Reviews · doi:10.1016/0165-0173(93)90010-w · Cited by 293 · cited 1× · see citing works
“Finally, VC levels in cerebrospinal fluid are increased in response to glutamate generated during neurotransmission [9,10], and VC in turn has been shown to have neuromodulatory effects on synaptic transmission [11,12].”
BackgroundAortic wall damage in mice unable to synthesize ascorbic acid
Maeda, N., Hagihara, H., Nakata, Y., Hiller, S., Wilder, J., & Reddick, R. (2000) · Proceedings of the National Academy of Sciences · doi:10.1073/pnas.97.2.841 · Cited by 260 · cited 1× · see citing works
“This is the standard supplement level that provides adult (nonpregnant) gulo−/− mice that cannot synthesize vitamin C with wild-type levels of the vitamin in tissues [13,14].”
BackgroundCorpe, C. P., Tu, H., Eck, P., Wang, J., Faulhaber-Walter, R., Schnermann, J., Margolis, S., Padayatty, S., Sun, H., Wang, Y., et al. (2010) · Journal of Clinical Investigation · doi:10.1172/jci39191 · Cited by 162 · cited 1× · see citing works
“Some VC may also have been due to transport by SVCT1, which has also been detected in placenta, although it is not necessary for VC transport [22].”
BackgroundRajan, D. P., Huang, W., Dutta, B., Devoe, L. D., Leibach, F. H., Ganapathy, V., & Prasad, P. D. (1999) · Biochemical and Biophysical Research Communications · doi:10.1006/bbrc.1999.1272 · Cited by 162 · cited 1× · see citing works
“SVCT2 is present in placenta [20,21] and is the likely source of VC transport.”
BackgroundThe Biochemistry of the Isoprostane, Neuroprostane, and Isofuran Pathways of Lipid Peroxidation
Roberts, L. J., Fessel, J. P., & Davies, S. S. (2006) · Brain Pathology · doi:10.1111/j.1750-3639.2005.tb00511.x · Cited by 131 · cited 1× · see citing works
“In contrast, both F2isoprostanes and F4-neuroprostanes, which are more specific markers of lipid peroxidation [31], were significantly greater in SVCT2−/− fetuses than in SVCT2 littermates.”
The biochemistry of the isoprostane, neuroprostane, and isofuran pathways of lipid peroxidation
Roberts, L. J., & Fessel, J. P. (2003) · Chemistry and Physics of Lipids · doi:10.1016/j.chemphyslip.2003.09.016 · Cited by 129 · see citing works
Lind, J. (1980) · The Classics of Medicine Library eBooks · Cited by 110 · see citing works
Cammack, J. N., Ghasemzadeh, B., & Adams, R. N. (1991) · Brain Research · doi:10.1016/0006-8993(91)91731-f · Cited by 106 · cited 1× · see citing works
“Finally, VC levels in cerebrospinal fluid are increased in response to glutamate generated during neurotransmission [9,10], and VC in turn has been shown to have neuromodulatory effects on synaptic transmission [11,12].”
BackgroundSodium vitamin C cotransporter SVCT2 is expressed in hypothalamic glial cells
García, M. D. L. Á., Salazar, K., Millán, C., Rodríguez, F., Montecinos, H., Caprile, T., Silva, C., Cortés‐Campos, C., Reinicke, K., Vera, J. C., et al. (2004) · Glia · doi:10.1002/glia.20133 · Cited by 102 · cited 1× · see citing works
“This in turn is due to the fact that brain capillary endothelial cells from normal mice do not express the SVCT2 [34,35], whereas it is prominently expressed in endothelial cells from other organs [36,37].”
BackgroundMiele, M., Boutelle, M. G., & Fillenz, M. (1994) · Neuroscience · doi:10.1016/0306-4522(94)90316-6 · Cited by 98 · cited 1× · see citing works
“Finally, VC levels in cerebrospinal fluid are increased in response to glutamate generated during neurotransmission [9,10], and VC in turn has been shown to have neuromodulatory effects on synaptic transmission [11,12].”
BackgroundHarrison, F. E., Yu, S. S., Bossche, K. L. V. D., Li, L., May, J. M., & McDonald, M. P. (2008) · Journal of Neurochemistry · doi:10.1111/j.1471-4159.2008.05469.x · Cited by 98 · cited 2× · see citing works
“We have previously reported sensorimotor deficits in gulo−/− mice that are unable to synthesize their own VC [13].”
Background[3] Analysis of ascorbic acid by liquid chromatography with amperometric detection
Pachla, L. A., & Kissinger, P. T. (1979) · Methods in enzymology on CD-ROM/Methods in enzymology · doi:10.1016/0076-6879(79)62183-3 · Cited by 97 · cited 1× · see citing works
“VC was measured by HPLC as described [15,16].”
MethodVitamin C controls the cystic fibrosis transmembrane conductance regulator chloride channel
Fischer, H., Schwarzer, C., & Illek, B. (2004) · Proceedings of the National Academy of Sciences · doi:10.1073/pnas.0308393100 · Cited by 95 · see citing works
The retention of ascorbic acid by guinea-pig tissues
Hughes, R. E., Hurley, R., & Jones, P. R. (1971) · British Journal Of Nutrition · doi:10.1079/bjn19710048 · Cited by 94 · cited 2× · see citing works
“Death typically occurs after several months of vitamin C (VC; ascorbate) deprivation in humans [1], although after only a month in guinea pigs [2], which, like humans, are unable to synthesize the vitamin.”
BackgroundVitamin C Status of an Outpatient Population
Johnston, C. S., & Thompson, L. L. (1998) · Journal of the American College of Nutrition · doi:10.1080/07315724.1998.10718777 · Cited by 92 · see citing works
Bornstein, S. R., Yoshida-Hiroi, M., Sotiriou, S., Levine, M., Hartwig, H.-G., Nussbaum, R. L., & Eisenhofer, G. (2003) · The FASEB Journal · doi:10.1096/fj.02-1167fje · Cited by 88 · cited 1× · see citing works
“For example, SVCT2 knockout mice have been shown to have decreases in catecholamine biosynthesis, although this was not considered the cause of death [7].”
BackgroundGender and Sodium-Ascorbate Transporter Isoforms Determine Ascorbate Concentrations in Mice
Kuo, S., MacLean, M. E., McCormick, K., & Wilson, J. X. (2004) · Journal of Nutrition · doi:10.1093/jn/134.9.2216 · Cited by 77 · cited 2× · see citing works
“0 μmol/g in the dam, which are within the range of other reports in adult SVCT2+/− and SVCT2 mice [28].”
BackgroundAscorbic acid attenuates scopolamine-induced spatial learning deficits in the water maze
Harrison, F. E., Hosseini, A. H., Dawes, S. M., Weaver, S. G., & May, J. M. (2009) · Behavioural Brain Research · doi:10.1016/j.bbr.2009.08.017 · Cited by 73 · see citing works
Isoketals: highly reactive γ-ketoaldehydes formed from the H2-isoprostane pathway
Davies, S. S., Amarnath, V., & Roberts, L. J. (2003) · Chemistry and Physics of Lipids · doi:10.1016/j.chemphyslip.2003.10.007 · Cited by 67 · see citing works
Biondi, C., Pavan, B., Dalpiaz, A., Medici, S., Lunghi, L., & Vesce, F. (2006) · Molecular Human Reproduction · doi:10.1093/molehr/gal092 · Cited by 57 · cited 1× · see citing works
“SVCT2 is present in placenta [20,21] and is the likely source of VC transport.”
BackgroundTransport and metabolism of ascorbic acid in human placenta
Choi, J. L., & Rose, R. C. (1989) · American Journal of Physiology-Cell Physiology · doi:10.1152/ajpcell.1989.257.1.c110 · Cited by 57 · cited 1× · see citing works
“The direct relationship between SVCT2 genotype and placental VC content demonstrated in this study strongly suggests that in vivo placental VC uptake requires the SVCT2 and thus does not involve dehydroascorbate as has previously been suggested [24,25].”
BackgroundAscorbic Acid in Fetal Rat Brain
Kratzing, C. C., Kelly, J. D., & Kratzing, J. E. (1985) · Journal of Neurochemistry · doi:10.1111/j.1471-4159.1985.tb08804.x · Cited by 55 · cited 2× · see citing works
“during development and in the first few postnatal days have previously been reported [29,30].”
BackgroundCombined deficiency of vitamins E and C causes paralysis and death in guinea pigs
Hill, K. E., Montine, T. J., Motley, A. K., Li, X., May, J. M., & Burk, R. F. (2003) · American Journal of Clinical Nutrition · doi:10.1093/ajcn/77.6.1484 · Cited by 55 · cited 1× · see citing works
“In support of this notion, we previously showed that sequential depletion of both vitamins E and C in guinea pigs caused an ascending paralysis and death [38].”
BackgroundVitamin C nutrition during prolonged lactation: optimal in infants while marginal in some mothers
Salmenperä, L. (1984) · American Journal of Clinical Nutrition · doi:10.1093/ajcn/40.5.1050 · Cited by 53 · see citing works
Steiling, H., Longet, K., Moodycliffe, A., Mansourian, R., Bertschy, E., Smola, H., Mauch, C., & Williamson, G. (2007) · Free Radical Biology and Medicine · doi:10.1016/j.freeradbiomed.2007.05.001 · Cited by 50 · cited 1× · see citing works
“This in turn is due to the fact that brain capillary endothelial cells from normal mice do not express the SVCT2 [34,35], whereas it is prominently expressed in endothelial cells from other organs [36,37].”
BackgroundRelations of Cigarette Smoking and Dietary Antioxidants with Placental Calcification
Klesges, L. M., Murray, D. M., Brown, J. E., Cliver, S., & Goldenberg, R. (1998) · American Journal of Epidemiology · doi:10.1093/oxfordjournals.aje.a009424 · Cited by 47 · cited 1× · see citing works
“Nonetheless, if combinedwith other oxidative stressors such as smoking, the resulting increased oxidative stress in the placenta may put the fetus at risk as it may lead to calcification of villi and inadequate nutrient transfer [23].”
BackgroundA Combined Deficiency of Vitamins E and C Causes Severe Central Nervous System Damage in Guinea Pigs
Burk, R. F., Christensen, J. M., Maguire, M. J., Austin, L. M., Whetsell, W. O., May, J. M., Hill, K. E., & Ebner, F. F. (2006) · Journal of Nutrition · doi:10.1093/jn/136.6.1576 · Cited by 41 · cited 1× · see citing works
“The cause of the neurologic deficits proved to be neuronal degeneration and fiber loss in the pons and upper spinal cord [39].”
BackgroundDevelopment of ascorbate transporters in brain cortical capillary endothelial cells in culture
Qiao, H., & May, J. M. (2008) · Brain Research · doi:10.1016/j.brainres.2008.02.102 · Cited by 38 · cited 1× · see citing works
“This in turn is due to the fact that brain capillary endothelial cells from normal mice do not express the SVCT2 [34,35], whereas it is prominently expressed in endothelial cells from other organs [36,37].”
BackgroundHarrison, F. E., May, J. M., & McDonald, M. P. (2009) · Pharmacology Biochemistry and Behavior · doi:10.1016/j.pbb.2009.11.009 · Cited by 34 · cited 1× · see citing works
“MDA was measured as previously described [17].”
Quantification of vitamin C in the rat brain in vivo using short echo‐time 1H MRS
Terpstra, M., Tkáč, I., Rao, R., & Rolf Gruetter, A. (2006) · Magnetic Resonance in Medicine · doi:10.1002/mrm.20854 · Cited by 27 · cited 1× · see citing works
“during development and in the first few postnatal days have previously been reported [29,30].”
BackgroundQiao, H., Li, L., Qu, Z., & May, J. M. (2009) · BioFactors · doi:10.1002/biof.43 · Cited by 21 · cited 1× · see citing works
“This in turn is due to the fact that brain capillary endothelial cells from normal mice do not express the SVCT2 [34,35], whereas it is prominently expressed in endothelial cells from other organs [36,37].”
BackgroundThe transport of vitamin C in the isolated human near-term placenta
Rybakowski, C., Mohar, B., Wohlers, S., Leichtweiß, H.-P., & Schröder, H. (1995) · European Journal of Obstetrics & Gynecology and Reproductive Biology · doi:10.1016/0301-2115(95)02117-p · Cited by 16 · cited 1× · see citing works
“The direct relationship between SVCT2 genotype and placental VC content demonstrated in this study strongly suggests that in vivo placental VC uptake requires the SVCT2 and thus does not involve dehydroascorbate as has previously been suggested [24,25].”
BackgroundAscorbic acid synthesis by the mammalian fetus.
Cc, K., & Jd, K. (1986) · PubMed · Cited by 10 · see citing works
Flagged first, then by citations
Cited by
Sorted by citations
Ascorbic acid metabolism and functions: A comparison of plants and mammals
Smirnoff, N. (2018) · Free Radical Biology and Medicine · doi:10.1016/j.freeradbiomed.2018.03.033 · Cited by 683 · see citing works
“This process allows concentration from the micromolar plasma concentrations to intracellular concentrations in the millimolar range [8,121].”
BackgroundVitamin C-Sources, Physiological Role, Kinetics, Deficiency, Use, Toxicity, and Determination
Doseděl, M., Jirkovský, E., Macáková, K., Krčmová, L., Javorská, L., Pourová, J., Mercolini, L., Remião, F., Nováková, L., Mladěnka, P., et al. (2021) · Nutrients · doi:10.3390/nu13020615 · Cited by 553 · see citing works
Neuroprotective Effect of Antioxidants in the Brain
Lee, K. H., Cha, M., & Lee, B. H. (2020) · International Journal of Molecular Sciences · doi:10.3390/ijms21197152 · Cited by 527 · see citing works
The sodium-dependent ascorbic acid transporter family SLC23
Bürzle, M., Suzuki, Y., Ackermann, D., Miyazaki, H., Maeda, N., Clémençon, B., Burrier, R., & Hediger, M. A. (2013) · Molecular Aspects of Medicine · doi:10.1016/j.mam.2012.12.002 · Cited by 158 · see citing works
Regulation of vitamin C homeostasis during deficiency
Lindblad, M., Tveden-Nyborg, P., & Lykkesfeldt, J. (2013) · Nutrients · doi:10.3390/nu5082860 · Cited by 151 · see citing works
“Moreover, vitC deficiency has also been associated with impaired brain development and reduced hippocampal function in experimental animal studies [7–10].”
Metabolism and Regulation of Ascorbic Acid in Fruits
Zheng, X., Gong, M., Zhang, Q., Tan, H., Li, L., Tang, Y., Li, Z., Peng, M., & Deng, W. (2022) · Plants · doi:10.3390/plants11121602 · Cited by 137 · see citing works
Dixit, S., Bernardo, A., Walker, J. M., Kennard, J. A., Kim, G. Y., Kessler, E. S., & Harrison, F. E. (2015) · ACS Chemical Neuroscience · doi:10.1021/cn500308h · Cited by 135 · see citing works
Oxidative Stress and Cognitive Decline: The Neuroprotective Role of Natural Antioxidants
Franzoni, F., Scarfò, G., Guidotti, S., Fusi, J., Асомов, М. И., & Pruneti, C. A. (2021) · Frontiers in Neuroscience · doi:10.3389/fnins.2021.729757 · Cited by 136 · see citing works
“Indeed, many studies suggest that AA has a neuroprotective role thanks to an antioxidant activity modulation (Harrison et al., 2010a,b).”
BackgroundMay, J. M. (2011) · British Journal of Pharmacology · doi:10.1111/j.1476-5381.2011.01350.x · Cited by 108 · see citing works
“Decreased placental ascorbate levels (Harrison et al., 2010) and inability to prevent death by supplementing the dam with ascorbate during pregnancy suggest that the SVCT2 is also crucial for placental ascorbate transport.”
BackgroundNeurobiology of vitamin C: Expanding the focus from antioxidant to endogenous neuromodulator
Ballaz, S., & Rebec, G. V. (2019) · Pharmacological Research · doi:10.1016/j.phrs.2019.104321 · Cited by 106 · see citing works
Does Vitamin C Deficiency Affect Cognitive Development and Function?
Hansen, S. L., Tveden‐Nyborg, P., & Lykkesfeldt, J. (2014) · Nutrients · doi:10.3390/nu6093818 · Cited by 105 · see citing works
Ferroptosis and traumatic brain injury
Geng, Z., Guo, Z., Guo, R., Ye, R., Zhu, W., & Yan, B. (2021) · Brain Research Bulletin · doi:10.1016/j.brainresbull.2021.04.023 · Cited by 100 · see citing works
Ascorbic Acid and the Brain: Rationale for the Use against Cognitive Decline
Harrison, F. E., Bowman, G. L., & Polidori, M. C. (2014) · Nutrients · doi:10.3390/nu6041752 · Cited by 99 · see citing works
The role of SLC transporters for brain health and disease
Nguyen, Y. T.-K., Ha, H. T. T., Nguyen, T. H., & Nguyen, L. N. (2021) · Cellular and Molecular Life Sciences · doi:10.1007/s00018-021-04074-4 · Cited by 98 · see citing works
“It can be explained that SVCT2 is obligatory for vitamin C maintenance in fetal tissues, and deficiency of SVCT2 resulted in low vitamin C levels, which subsequently leads to oxidative stress and fetal death [221].”
BackgroundTveden‐Nyborg, P., Vogt, L., Schjoldager, J. G., Jeannet, N., Hasselholt, S., Paidi, M. D., Christen, S., & Lykkesfeldt, J. (2012) · PLoS ONE · doi:10.1371/journal.pone.0048488 · Cited by 84 · see citing works
Portugal, C. C., Socodato, R., Canedo, T., Silva, C. M., Martins, T., Miya-Coreixas, V. S., Loiola, E. C., Gess, B., Röhr, D., Santiago, A. R., et al. (2017) · Science Signaling · doi:10.1126/scisignal.aal2005 · Cited by 74 · see citing works
Huang, X., Anderle, P., Hostettler, L., Baumann, M., Surbek, D., Ontsouka, E., & Albrecht, C. (2018) · BMC Genomics · doi:10.1186/s12864-018-4518-z · Cited by 72 · see citing works
Functional and Physiological Role of Vitamin C Transporters
Bürzle, M., & Hediger, M. A. (2012) · Current topics in membranes · doi:10.1016/b978-0-12-394316-3.00011-9 · Cited by 70 · see citing works
Hasselholt, S., Tveden‐Nyborg, P., & Lykkesfeldt, J. (2015) · British Journal Of Nutrition · doi:10.1017/s0007114515000690 · Cited by 55 · see citing works
“…of VitC compared with other organs during states of deficiency, suggesting a central role within the brain (10,11) , which has been supported by experimental studies indicating that reduced VitC levels in the brain may lead to reduced neuronal quantities and thus functional consequences (6,12) .”
The Epigenetic Role of Vitamin C in Neurodevelopment
Coker, S. J., Smith-Díaz, C. C., Dyson, R. M., Vissers, M. C. M., & Berry, M. J. (2022) · International Journal of Molecular Sciences · doi:10.3390/ijms23031208 · Cited by 56 · see citing works
“Depending on the experimental model, these issues include cardiovascular, pulmonary, hepatic and vertebral defects [88], impaired hippocampal development [12,13] or embryonic death [16,89].”
BackgroundZanón‐Moreno, V., Asensio, E. M., Ciancotti‐Oliver, L., García‐Medina, J. J., Sanz, P., Ortega‐Azorín, C., Pinazo-Duran, M. D., Ordovás, J. M., & Corella, D. (2013) · Europe PMC (PubMed Central) · Cited by 55 · see citing works
Meredith, M. E., Harrison, F. E., & May, J. M. (2011) · Biochemical and Biophysical Research Communications · doi:10.1016/j.bbrc.2011.09.146 · Cited by 53 · see citing works
“Previously we showed that even the SVCT2 knockout mouse with very low brain ASC had only modest and localized increases in OxS markers of lipid peroxidation [8].”
BackgroundKim, J. H., Kim, W.-K., Sung, Y. K., Kwack, M. H., Song, S. Y., Choi, J.-S., Park, S. G., Yi, T., Lee, H.-J., Kim, D.-D., et al. (2014) · Stem Cells and Development · doi:10.1089/scd.2013.0460 · Cited by 53 · see citing works
“As vitamin C is hydrophilic and has been reported to be transported into cells via membrane transporters [30–32], we attempted to determine the cellular uptake mechanism of vitamin C in ASCs.”
Gess, B., Röhr, D., Fledrich, R., Sereda, M. W., Kleffner, I., Humberg, A., Nowitzki, J., Strecker, J., Halfter, H., & Young, P. (2011) · Journal of Neuroscience · doi:10.1523/jneurosci.3457-11.2011 · Cited by 49 · see citing works
Expression Profiling of Solute Carrier Gene Families at the Blood-CSF Barrier
Ho, H. T. B., Dahlin, A., & Wang, J. (2012) · Frontiers in Pharmacology · doi:10.3389/fphar.2012.00154 · Cited by 46 · see citing works
“Meanwhile, Svct2 KO mice fetuses were shown to have significantly lower l-ascorbic acid levels in various tissues and they died perinatally (Harrison et al., 2010).”
BackgroundRegucalcin, a calcium-binding protein with a role in male reproduction?
Laurentino, S., Correia, S., Cavaco, J. E. B., Oliveira, P. F., Sousa, M., Barros, A., & Socorro, S. (2011) · Molecular Human Reproduction · doi:10.1093/molehr/gar075 · Cited by 45 · see citing works
“Ascorbic acid is a known powerful antioxidant (Arrigoni and De Tullio, 2002), and a role in the balance between cell survival and death has been indicated for this molecule (Harrison et al., 2010; Bonilla-Porras et al., 2011; Jin et al., 2011).”
BackgroundRegulation of embryonic neurotransmitter and tyrosine hydroxylase protein levels by ascorbic acid
Meredith, M. E., & May, J. M. (2013) · Brain Research · doi:10.1016/j.brainres.2013.09.040 · Cited by 41 · see citing works
“Homozygous SVCT2(-/-) mice survive the gestation period but do not survive past birth (Harrison et al., 2010; Sotiriou et al., 2002).”
Lykkesfeldt, J., Carr, A. C., & Tveden‐Nyborg, P. (2025) · Pharmacological Reviews · doi:10.1016/j.pharmr.2025.100043 · Cited by 44 · see citing works
Yu, R., & Schellhorn, H. E. (2012) · Journal of Nutrition · doi:10.3945/jn.112.168690 · Cited by 40 · see citing works
Tian, H., Ye, X., Hou, X., Yang, X., Yang, J., & Wu, C. (2016) · Free Radical Biology and Medicine · doi:10.1016/j.freeradbiomed.2016.03.039 · Cited by 39 · see citing works
Ünal, D., García‐Caparrós, P., Kumar, V., & Dietz, K. (2020) · Philosophical Transactions of the Royal Society B Biological Sciences · doi:10.1098/rstb.2019.0443 · Cited by 36 · see citing works
Mi, D. J., Dixit, S., Warner, T. A., Kennard, J. A., Scharf, D. A., Kessler, E. S., Moore, L. M., Consoli, D. C., Bown, C. W., Dukes, A. J., et al. (2018) · Neurobiology of Aging · doi:10.1016/j.neurobiolaging.2018.08.002 · Cited by 33 · see citing works
Schjoldager, J. G., Paidi, M. D., Lindblad, M. M., Birck, M. M., Kjærgaard, A. B., Dantzer, V., Lykkesfeldt, J., & Tveden-Nyborg, P. (2015) · European Journal of Nutrition · doi:10.1007/s00394-014-0809-6 · Cited by 30 · see citing works
Paidi, M. D., Schjoldager, J. G., Lykkesfeldt, J., & Tveden‐Nyborg, P. (2014) · Redox Biology · doi:10.1016/j.redox.2014.01.009 · Cited by 27 · see citing works
“Interruption of vitC transport to the brain in the svct2 / mouse is detrimental to perinatal survival [13,50], underlining the pivotal role of vitC in the developing central nervous system.”
BackgroundSchjoldager, J. G., Tveden‐Nyborg, P., & Lykkesfeldt, J. (2013) · British Journal Of Nutrition · doi:10.1017/s0007114513000913 · Cited by 25 · see citing works
“However, the present data combined with previously reported results((12,43)) suggest that an inadequate”
InfluentialHarrison, F. E., Best, J. L., Meredith, M. E., Gamlin, C. R., Borza, D., & May, J. M. (2012) · PLoS ONE · doi:10.1371/journal.pone.0035623 · Cited by 24 · see citing works
“SVCT2(2/2) do not survive past birth and show severe hemorrhage in brain accompanying almost undetectable ASC levels in SVCT2-dependent organs ([5,7].”
Aschner, M., Nguyen, T., Синицкий, А. И., Santamarı́a, A., Bornhorst, J., Ajsuvakova, O. P., da Rocha, J. B. T., Skalny, A. V., & Tinkov, A. A. (2020) · Free Radical Biology and Medicine · doi:10.1016/j.freeradbiomed.2020.10.024 · Cited by 22 · see citing works
A Cecal Slurry Mouse Model of Sepsis Leads to Acute Consumption of Vitamin C in the Brain
Consoli, D. C., Jesse, J. J., Klimo, K. R., Tienda, A. A., Putz, N. D., Bastarache, J. A., & Harrison, F. E. (2020) · Nutrients · doi:10.3390/nu12040911 · Cited by 21 · see citing works
Vitamin C: historical perspectives and heart failure
Malik, A., Bagchi, A. K., Vinayak, K., Akolkar, G., Slezák, J., Belló‐Klein, A., Jassal, D. S., & Singal, P. K. (2020) · Heart Failure Reviews · doi:10.1007/s10741-020-10036-y · Cited by 21 · see citing works
Vitamin C Deficiency in the Young Brain—Findings from Experimental Animal Models
Tveden‐Nyborg, P. (2021) · Nutrients · doi:10.3390/nu13051685 · Cited by 23 · see citing works
Oxidative stress in rat brain during experimental status epilepticus: effect of antioxidants
Fuchs, M., Viel, C., Lehto, A., Lau, H., & Klein, J. (2023) · Frontiers in Pharmacology · doi:10.3389/fphar.2023.1233184 · Cited by 20 · see citing works
“The prominent role of SVCT2 is evidenced by the fact that mice lacking SVCT2 show severely reduced levels of ascorbate in the cerebral cortex and increased levels of isoprostanes and MDA in the brain, which is associated with increased cell death (Harrison et al., 2010).”
BackgroundGess, B., Röhr, D., & Young, P. (2013) · Antioxidants and Redox Signaling · doi:10.1089/ars.2013.5380 · Cited by 20 · see citing works
“SVCT2 has been shown to be expressed and functionally active in brain, neuroendocrine tissue, lung, and other organs (5, 21, 46); while SVCT1 is largely expressed in epithelia controlling whole-body homeostasis of ascorbic acid (6, 27, 33).”
Søgaard, D., Lindblad, M. M., Paidi, M. D., Hasselholt, S., Lykkesfeldt, J., & Tveden‐Nyborg, P. (2014) · Nutrition Research · doi:10.1016/j.nutres.2014.07.004 · Cited by 19 · see citing works
“[10] Harrison FE, Dawes SM, Meredith ME, Babaev VR, Li L, May JM.”
BackgroundTruong, T. T. H., Harvey, A. J., & Gardner, D. K. (2021) · Reproductive BioMedicine Online · doi:10.1016/j.rbmo.2021.11.013 · Cited by 18 · see citing works
Chen, L., Zhu, H., Pan, Y., Tang, C., Mai, W., Ruan, H., Wang, Y., Wang, J., Yao, H.-Y., Iguchi, T., et al. (2012) · The Journal of Clinical Endocrinology & Metabolism · doi:10.1210/jc.2012-1753 · Cited by 17 · see citing works
“Antisense: GCGTCGTTCAAGACTGTCCTGATAAGTTCTCTATCAGGACAGTCTTGAACGACGAAAAAATA J Clin Endocrinol Metab, September 2012, 97(9):0000–0000 jcem.”
BackgroundInfluentialFiorani, M., Azzolini, C., Guidarelli, A., Cerioni, L., & Cantoni, O. (2014) · Pharmacological Research · doi:10.1016/j.phrs.2014.04.006 · Cited by 17 · see citing works
Han, Z., Zhang, Z., Guan, Y., Chen, B., Yu, M., Zhang, L., Fang, J., Gao, Y., & Guo, Z. (2021) · International Journal of Biological Macromolecules · doi:10.1016/j.ijbiomac.2021.01.120 · Cited by 17 · see citing works
Qiao, H., & May, J. M. (2011) · Free Radical Biology and Medicine · doi:10.1016/j.freeradbiomed.2011.02.006 · Cited by 16 · see citing works
“More recent results show modest, localized oxidative stress in the brain of SVCT2−/− fetuses and that capillary hemorrhage extends to the hindbrain and was associated with cell death [12].”
BackgroundChen, Q., & Vissers, M. C. M. (2020) · CRC Press eBooks · doi:10.1201/9780429442025 · Cited by 16 · see citing works
Grădinaru, A. C., & Popa, S. (2025) · Life · doi:10.3390/life15020238 · Cited by 14 · see citing works
“It is responsible for the transport of ASC into multiple organs from either the blood or the cerebrospinal fluid [140].”
Jara, N., Cifuentes, M., Martínez, F., González‐Chavarría, I., Salazar, K., Ferrada, L., & Nualart, F. (2022) · Antioxidants · doi:10.3390/antiox11102030 · Cited by 12 · see citing works
Hansen, S. N., Jørgensen, J. M. B., Nyengaard, J. R., Lykkesfeldt, J., & Tveden‐Nyborg, P. (2018) · Nutrients · doi:10.3390/nu10060749 · Cited by 12 · see citing works
“Furthermore, vitC transport to the brain is essential for perinatal survival in mice [23,24], and induced deficiency has been shown to reduce functional performance in the L-gulono-γ-lactone oxidase knockout mice (Gulo−/−) [25,26].”
BackgroundCombined vitamin C and E deficiency induces motor defects in gulo−/−/SVCT2+/−mice
Pierce, M. R., DiAsio, D. L., Rodrigues, L. M., Harrison, F. E., & May, J. M. (2013) · Nutritional Neuroscience · doi:10.1179/1476830512y.0000000042 · Cited by 12 · see citing works
Modulation of microglia activation by the ascorbic acid transporter SVCT2
Marino, A. L., Rex, T. S., & Harrison, F. E. (2024) · Brain Behavior and Immunity · doi:10.1016/j.bbi.2024.07.003 · Cited by 9 · see citing works
Jiang, C., Tsao, C.-Y., & Lee, Y. (2022) · Genes & Nutrition · doi:10.1186/s12263-022-00713-y · Cited by 10 · see citing works
Paidi, M. D., Schjoldager, J. G., Lykkesfeldt, J., & Tveden‐Nyborg, P. (2014) · Nutrients · doi:10.3390/nu6051809 · Cited by 9 · see citing works
Łukawski, M., Dałek, P., Witkiewicz, W., Przybyło, M., & Langner, M. (2020) · Chemistry and Physics of Lipids · doi:10.1016/j.chemphyslip.2020.104950 · Cited by 9 · see citing works
Coker, S. J., Berry, M. J., Vissers, M. C. M., & Dyson, R. M. (2024) · Nutrients · doi:10.3390/nu16030369 · Cited by 8 · see citing works
“Animal studies have revealed the severe consequences that can arise for offspring when the mother experiences extreme vitamin C deficiency, including growth, cardiovascular, pulmonary, hepatic, and vertebral defects [15–17], impaired brain development [18–21], and embryonic or foetal death [11,22].”
BackgroundActivation of adenosine A3 receptors regulates vitamin C transport and redox balance in neurons
Portugal, C. C., da Encarnação, T. G., Sagrillo, M. A., Pereira, M. R., Relvas, J. B., Socodato, R., & Paes‐de‐Carvalho, R. (2020) · Free Radical Biology and Medicine · doi:10.1016/j.freeradbiomed.2020.11.039 · Cited by 8 · see citing works
Qiao, H., & May, J. M. (2012) · PLoS ONE · doi:10.1371/journal.pone.0035746 · Cited by 8 · see citing works
“This is most evident in the cortex, but also occurs in areas of the lower brain crucial for control of body functions, including respiration [3].”
BackgroundWang, Y., Yang, X., Li, S., Wu, Q., Guo, H., Wang, H., Su, P., & Wang, J. (2023) · Poultry Science · doi:10.1016/j.psj.2023.102814 · Cited by 7 · see citing works
The Multifaceted Biological Roles of Vitamin C
Kuo, S. (2013) · Journal of Nutrition & Food Sciences · doi:10.4172/2155-9600.1000231 · Cited by 6 · see citing works
“In the absence of vitamin C in most tissues, SVCT2-/mice died perinatally from intraparenchymal brain hemorrhage [11, 22], a feature also found in mice and human with collagen, Col4a1, mutation [23-26].”
BackgroundZhou, C., Yang, M., Shi, P., Li, Z., Li, Y., Guo, Y., Zhang, T., & Song, H. (2025) · International Journal of Biological Macromolecules · doi:10.1016/j.ijbiomac.2025.139483 · Cited by 5 · see citing works
Vitamin C Levels in Different Organs of Bat Species from Different Food Groups
Canata, D. A. M., Benfato, M. S., Pereira, F. D., Pereira, M. J. R., & Rampelotto, P. H. (2022) · Life · doi:10.3390/life12122121 · Cited by 5 · see citing works
Ikeda, K., Tienda, A. A., Harrison, F. E., & Kawakami, K. (2021) · PLoS ONE · doi:10.1371/journal.pone.0246678 · Cited by 5 · see citing works
“Significant decrease in ASC content in the brains of Atp1a2/Atp1a3 double homozygous knockout mice We noticed that the extensive haemorrhage in the brains of α2N/α3-dKO and α2C/α3-dKO foetuses closely resembled the phenotype of newborns with homozygous knockout of the ASC transporter gene (solute carrier family 23 mem…”
BackgroundResultInfluentialVillarroel, F., Ramírez, E., Ponce, N., Nualart, F., & Salinas, P. (2025) · Antioxidants · doi:10.3390/antiox14091050 · Cited by 4 · see citing works
“These changes, possibly mediated by oxidative stress and hypoxia [22], provide insight into how PM2.”
InfluentialVitamin C alleviates hyperglycemic stress in retinal pigment epithelial cells
Alahmari, H., Liu, C.-C., Rubin, E., Lin, V. Y., Rodriguez, P., & Chang, K. (2024) · Molecular Biology Reports · doi:10.1007/s11033-024-09595-2 · Cited by 4 · see citing works
“Studies have shown that the inhibition or depletion of SVCT2 from the plasma membrane reduces the intracellular uptake of AA [ 30 ], and induces microglia activation [ 31] and oxidative stress [ 32] in the ocular cell system.”
Neuroprotection induced by ascorbic acid
Onaolapo, A. Y., & Onaolapo, O. J. (2024) · Elsevier eBooks · doi:10.1016/b978-0-443-23763-8.00026-9 · Cited by 4 · see citing works
Anti-Inflammatory Effects of Aptamin C in Pulmonary Fibrosis Induced by Bleomycin
Shin, S., Jo, H., Agura, T., Jeong, S., Ahn, H., Pang, S., Lee, J., Park, J.-H., Kim, Y., & Kang, J. S. (2024) · Pharmaceuticals · doi:10.3390/ph17121577 · Cited by 4 · see citing works
“The efficient intracellular transport of vitamin C via SVCT-2 strengthens the protective function against oxidative stress in lung cells and plays a crucial role in regulating inflammatory responses [33,56].”
Hayashi, K., Noguchi‐Shinohara, M., Sato, T. K., Hosomichi, K., Kannon, T., Abe, C., Domoto, C., Yuki-Nozaki, S., Mori, A., Horimoto, M., et al. (2021) · PLoS ONE · doi:10.1371/journal.pone.0259663 · Cited by 4 · see citing works
“Besides, compared with age-matched wild-type mice, newborn and adult mice with heterozygous knockout of SVCT2 have reduced ASC level in the brain and several other tissues [19, 20].”
Vitamins and Cognition: A Nutrigenomics Perspective
Anitha, A., Viswambharan, V., Thanseem, I., Iype, M., Parakkal, R., Surendran, S. P., & Vasu, M. M. (2020) · Current Nutrition & Food Science · doi:10.2174/1573401316999200901180443 · Cited by 4 · see citing works
Hansen, S. N., Schjoldager, J. G., Paidi, M. D., Lykkesfeldt, J., & Tveden‐Nyborg, P. (2016) · Nutrition Research · doi:10.1016/j.nutres.2016.03.004 · Cited by 4 · see citing works
“vitC depletion and deficiency have suggested vitC as playing a crucial role in the brain, particularly during development [10–14].”
BackgroundZhu, H., Luo, H., Wu, X., Bao, H., Shu, Y., Ji, X., Pan, Y., Pan, Y., Tang, C., Wu, X., et al. (2024) · Cellular and Molecular Life Sciences · doi:10.1007/s00018-024-05345-6 · Cited by 3 · see citing works
“Subsequent assessments indicate that SVCT2 -deficient pups encountered severe cortical hemorrhage, brain stem hemorrhage and cell loss, heightened apoptotic rates and disruption of the basement membrane in the fetal brain [12].”
Vitamin C and Its Role in Brain Development and Cognition
Hasselholt, S., Tveden‐Nyborg, P., & Lykkesfeldt, J. (2012) · doi:10.1007/978-1-137-00689-9_3 · Cited by 3 · see citing works
Impact of SLC23A1 and SLC23A2 Polymorphisms on the Risk for Preeclampsia in a Chinese Han Population
Hou, H., Zhang, Y., Hongjing, W. U., Huang, Z., Shiguo, L. I. U., Liang, H. Y., & Xu, Y. (2022) · Journal of Nutritional Science and Vitaminology · doi:10.3177/jnsv.68.368 · Cited by 3 · see citing works
Tienda, A. A., Harrison, F. E., & Wilcox, J. M. (2025) · Genes Brain & Behavior · doi:10.1111/gbb.70023 · Cited by 2 · see citing works
Yin, B., Xu, Y., & Lu, Y. (2025) · Frontiers in Pediatrics · doi:10.3389/fped.2025.1632778 · Cited by 2 · see citing works
He, X., Lin, Y.-J., Wu, X., Li, M., Zhong, T., Zhang, Y., & Weng, X. (2025) · Frontiers in Nutrition · doi:10.3389/fnut.2025.1585863 · Cited by 3 · see citing works
Yin, J., Song, Y., Zhang, N., Xu, T., & Wang, H. (2015) · Analytical Methods · doi:10.1039/c5ay01883h · Cited by 2 · see citing works
Feeding Vitamin C during Neonatal and Juvenile Growth Improves Learning and Memory of Rats
Hosseini, M., Beheshti, F., Sohrabi, F., Vafaee, F., Shafei, M. N., & Sadeghnia, H. R. (2017) · Journal of Dietary Supplements · doi:10.1080/19390211.2017.1386749 · Cited by 2 · see citing works
“This has additionally been upheld by in vivo discoveries that propose that Vit C transporting to the brain is a key for perinatal survival (Harrison et al., 2010).”
BackgroundInfluentialSerotonergic Regulation of Photic Signaling of Ascorbate in the Rat Thalamus
Miyamoto, H., & Hamada, K. (2025) · Molecular Neurobiology · doi:10.1007/s12035-025-05132-9 · Cited by 1 · see citing works
“Neuronal activity generates reactive oxygen species (ROS), which can harm neurons under oxidative stress [3]; thus, antioxidants such as ascorbate are essential to counteract this damage.”
Goncharova, P. S., Davydova, T. K., & Жукова, Н. Г. (2021) · Personalized Psychiatry and Neurology · doi:10.52667/2712-9179-2021-1-2-63-82 · Cited by 1 · see citing works
Devi, M. N. A. G. S. (2016)
Schellhorn, H. E. (2018) · Genomics & Gene Therapy International Journal · doi:10.23880/ggtij-16000108
Juhl, B. (2020) · Obstetrics and Gynecology Reports · doi:10.15761/ogr.1000147
Xue, X., Ren, C., Wang, L., Xu, M. X., Fan, C., Fang, F., Peng, M., Cheng, J., & Wang, J. (2021) · Research Square · doi:10.21203/rs.3.rs-936596/v1
The Antioxidant Vitamins A, C, and E and the Developing Brain
(2016) · CRC Press eBooks · doi:10.1201/9781315372402-5
Liu, J., Kumar, M., Guo, J., Huang, L., Zhang, Z., Wang, Y., Luo, R., chu, S., Chen, S., Liu, R., et al. (2023) · Research Square · doi:10.21203/rs.3.rs-3028525/v1
Yin, B., Li, M.-J., Sun, J., You, Y., Zhang, S.-D., Wan, Q.-X., Yao, M.-L., Yang, C., Sun, H., Lin, Z., et al. (2025) · Journal of Human Genetics · doi:10.1038/s10038-025-01352-y
“Given previous research indicating increased oxidative stress in Slc23a2 knockout mouse embryos [28], we examined ROS levels after SLC23A2 knockdown and found a signi fi cant increase in HEPM cells (Fig.”
Čapo, I., Andrijević, I., Čapo, N., Popović, M., Milenković, I., Ratajac, R., Vranješ, D., Milutinović, D., Simin, D., & Sekulić, S. (2025) · Nutrients · doi:10.3390/nu17213484
“Similar changes in the type of extensive haemorrhage in the cerebrum and brainstem, accompanied by neuronal loss with pronounced apoptosis, were observed in mice with a mutation in the SVCT2 gene, which encodes the sodium-dependent vitamin C transporter [28].”
A REVIEW ON ANTIOXIDANT VITAMIN C AND ITS IMPACT ON SKIN HEALTH
Behera, P., Sharma, A., BISWAL, S., MOHARANA, S., Biswal, P. K., & Panda, B. B. (2025) · Innovare Journal of Medical Sciences · doi:10.22159/ijms.2025v13i5.55899
Jiang, C.-L., Tsao, C.-Y., & Lee, Y.-C. (2022) · Figshare · doi:10.6084/m9.figshare.20329735
Lodhi, J., Singhal, A., Sadique, M. A., & Khan, R. (2026) · ChemistrySelect · doi:10.1002/slct.74537
- Authors
- Harrison, F. E., Dawes, S. M., Meredith, M. E., Babaev, V. R., Li, L., & May, J. M.
- Affiliations
- Vanderbilt University (US)
- Corresponding author
- Harrison, F.E.
- Venue
- Free Radical Biology and Medicine
- Publisher
- Elsevier BV
- Published
- 2010-09
- Volume
- 49
- Issue
- 5
- Pages
- 821-829
- ISSN
- 0891-5849 (ISSN-L)
- PMC
- PMC2916678
- OpenAlex
- W2059853747
- Cited by
- 94
- References
- 43
- Citations by year
- 2026: 1 · 2025: 11 · 2024: 6 · 2023: 3 · 2022: 7 · 2021: 11 · 2020: 10 · 2019: 1 · 2018: 5 · 2017: 3 · 2016: 4 · 2015: 3 · 2014: 8 · 2013: 8 · 2012: 8
- FWCI
- 6.37
- Type
- journal article
- Language
- en
- Open access
- green
- www.ncbi.nlm.nih.gov
- Locations
- Free Radical Biology and Medicine (publishedVersion)
- PubMed (publishedVersion)
- Europe PMC (PubMed Central) (acceptedVersion)
- PubMed Central (acceptedVersion)
- Funders
- Vanderbilt University
- National Institutes of Health
- National Institute of Diabetes and Digestive and Kidney Diseases (DK59637, U24DK059637)
- National Institute of Neurological Disorders and Stroke (NS057674-03, R01NS057674)
- Topics
- Health Sciences › Nursing › Nutrition and Dietetics › Vitamin C and Antioxidants Research
- Health Sciences › Medicine › Biochemistry › Antioxidant Activity and Oxidative Stress
- Health Sciences › Nursing › Nutrition and Dietetics › Trace Elements in Health
- Keywords
- sodium-dependent vitamin C transporters, SVCT2, scurvy, oxidative stress, apoptosis, neuroprostanes, F2-isoprostanes, basement membrane disruption, fetal lethality, vitamin C transport
- MeSH terms
- Animals, Ascorbic Acid, Brain, Female, Genotype, Male, Malondialdehyde, Mice, Inbred C57BL, Mice, Transgenic, Placenta, Pregnancy, Tissue Distribution, Down-Regulation, Up-Regulation, Cell Death, Oxidative Stress, Symporters, Organic Anion Transporters, Sodium-Dependent, Mice, Sodium-Coupled Vitamin C Transporters
About these checks
Registry, retraction, Cites and statistics results are computed, not judged, with one exception: a printed reference that no index lists is read once by a model before it counts as a citation error. Claims are extracted by a model and kept only when their quote appears verbatim in the text; each cited source is then checked, with a model’s help, for whether it says what the claim relies on. Those verdicts can be wrong — read the claim’s quote and the cited source before relying on one.
Statistics and arithmetic are recomputed, not judged.
Confidence bands are shown only for fields calibrated on our annotated test set. None is calibrated yet, so no band is shown.
What counts as a claim ›How we measure confidence ›How we check this ›
Are you an author, or do you see a problem with this page? Request a review
