The DOI matches its Crossref record; 175 of the 178 references it cites were found in a registry or an index.
Astrovirus Infections in Humans and Animals—Molecular Biology, Genetic Diversity, and Interspecies Transmissions
Open accessAbstract
Astroviruses are small, non-enveloped, positive sense, single-stranded RNA viruses first identified in 1975 in children suffering from diarrhea and then described in a wide variety of animals. To date, the list of animal species susceptible to astrovirus infection has expanded to 22 animal species or families, including domestic, synantropic and wild animals, avian, and mammalian species in the terrestrial and aquatic environments. Astrovirus infections are considered among the most common cause of gastroenteritis in children, second only to rotavirus infections, but in animals their association with enteric diseases is not well documented, with the exception of turkey and mink astrovirus infection. Genetic variability has been described in almost all astrovirus species sufficiently examined infecting mammals and birds; however, antigenic variability has been demonstrated for human astroviruses but is far less investigated in animal viruses. Interestingly, there is an increasing evidence of recombination events occurring in astroviruses, which contributes to increase the genetic variability of this group of viruses. A wide variety of species infected, the evident virus genetic diversity and the occurrence of recombination events indicate or imply either cross-species transmission and subsequent virus adaptation to new hosts or the co-infection of the same host with different astroviruses. This can also favor the emergence of novel astroviruses infecting animals or with a zoonotic potential. After more than 30 years from their first description in humans, there are many exciting streams of research to be explored and intriguing questions that remain to be answered about the relatively under-studied Astroviridae family. In the present work, we will review the existing knowledge concerning astrovirus infections in humans and animals, with particular focus on the molecular biology, interspecies transmission and zoonotic potential of this group of viruses.
Overview
The claims and statistics of this paper haven’t been checked yet.
Run the check — free, no account needed. It reads the open-access text and checks the sources it cites.
Integrity signals
Registry
Cites
Statistics
Verification
Claims the paper makes
The claims and statistics of this paper haven’t been checked yet.
Run the check — free, no account needed. It reads the open-access text and checks the sources it cites.
Claims other papers make about this one
Each is checked against this paper’s own text: does it say what the citing paper says it does?
The source backs part of the claim, not all of it — or backs it for a different population, condition or comparison.
In the citing paper
“Astroviruses have a broad host range (Donato and Vijaykrishna 2017) and are frequently detected in the faeces of mammals, birds, and humans with gastroenteritis (Finkbeiner et al. 2009; De Benedictis et al. 2011).”
From Red fox viromes in urban and rural landscapes (2020) · cites this paper as De Benedictis et al. 2011
Experimental — accuracy not yet measured
Self-check
Percentages, sums and reported differences re-computed from the paper’s own numbers.
The self-check needs the paper’s full text.
Citations
Cites
The alphaviruses: gene expression, replication, and evolution.
Strauss, J. H., & Strauss, E. G. (1994) · Microbiological Reviews · doi:10.1128/mmbr.58.3.491-562.1994 · Cited by 2,221
Virus Taxonomy: VIIIth Report of the International Committee on Taxonomy of Viruses.
Fauquet, C., Mayo, M. A., Maniloff, J., Desselberger, U., & Ball, L. A. (2005) · Cited by 798
28 nm PARTICLES IN FÆCES IN INFANTILE GASTROENTERITIS
Madeley, C. R., & Cosgrove, B. (1975) · The Lancet · doi:10.1016/s0140-6736(75)90858-2 · Cited by 385 · cited 1×
“Astroviruses are small, non-enveloped RNA viruses first identified in 1975 by electron microscopy (EM) in children suffering from diarrhea (Appleton and Higgins, 1975; Madeley and Cosgrove, 1975b; Matsui and Greenberg, 1996).”
BackgroundTyping of human astroviruses from clinical isolates by enzyme immunoassay and nucleotide sequencing
Noel, J. S., Lee, T. W., Kurtz, J. B., Glass, R. I., & Monroe, S. S. (1995) · Journal of Clinical Microbiology · doi:10.1128/jcm.33.4.797-801.1995 · Cited by 379 · cited 1×
“In several cases these genotypes were detected and initially differentiated using a set of conserved primers to the ORF1b termed Mon269 (50 CAACTCAGGAAACAGGGTGT) and Mon270 (50 TCAGATGCATTGTCATTGGT) (Noel et al., 1995).”
BackgroundMetagenomic Analysis of Human Diarrhea: Viral Detection and Discovery
Finkbeiner, S. R., Allred, A. F., Tarr, P. I., Klein, E. J., Kirkwood, C. D., & Wang, D. (2008) · PLoS Pathogens · doi:10.1371/journal.ppat.1000011 · Cited by 361 · cited 3×
“They termed the virus MLB1 (AstV-MLB1) and went onto characterize the genome, demonstrating that AstV-MLB1 was highly divergent from any of the known astroviruses (Finkbeiner et al., 2008b).”
BackgroundMethodAstrovirus Encephalitis in Boy with X-linked Agammaglobulinemia
Quan, P.-L., Wagner, T. A., Briese, T., Torgerson, T., Hornig, M., Tashmukhamedova, A., Firth, C., Palacios, G., Baisre-De-Leon, A., Paddock, C., et al. (2010) · Emerging Infectious Diseases · doi:10.3201/eid1606.091536 · Cited by 332 · cited 10×
“HastV-PS is also genetically related to AstV-VA1 (Finkbeiner et al., 2009b) and to a lesser extent to MiAstVs and OAstVs, thus falling within the proposed genocluster GII of Mamastroviruses (Bosch et al., 2010b; Quan et al., 2010) .”
BackgroundInfluentialVIRUSES AND GASTROENTERITIS IN INFANTS
Appleton, H., & Higgins, P. G. (1975) · The Lancet · doi:10.1016/s0140-6736(75)92581-7 · Cited by 307 · cited 1×
“Astroviruses are small, non-enveloped RNA viruses first identified in 1975 by electron microscopy (EM) in children suffering from diarrhea (Appleton and Higgins, 1975; Madeley and Cosgrove, 1975b; Matsui and Greenberg, 1996).”
BackgroundNovel Astroviruses in Insectivorous Bats
Chu, D. K. W., Poon, L. L. M., Guan, Y., & Peiris, M. J. S. (2008) · Journal of Virology · doi:10.1128/jvi.00857-08 · Cited by 292 · cited 15×
“Astroviruses do not easily grow in laboratory host systems and for this reason serological classification is difficult and is generally speculated based on percentage of nucleotide and amino acid similarity of the ORF2 encoding for the capsid protein (Chu et al., 2008; Koci et al., 2000; Reuter et al., 2011).”
BackgroundMethodResultInfluentialAhlquist, P. (2006) · Nature Reviews Microbiology · doi:10.1038/nrmicro1389 · Cited by 285 · cited 2×
“The transmembrane domains may localize nsp1a/2 to the endoplasmic reticulum (ER) membrane to facilitate replication (Guix et al., 2004) similar to other positivestrand RNA viruses (Ahlquist, 2006; Geigenmuller et al., 2002; Guix et al., 2004, 2005; Kiang and Matsui, 2002; Speroni et al., 2009).”
BackgroundIsolation of Small Viruses Resembling Astroviruses and Caliciviruses from Acute Enteritis Of Calves
Woode, G. N., & Bridger, J. C. (1978) · Journal of Medical Microbiology · doi:10.1099/00222615-11-4-441 · Cited by 262 · cited 3×
“The first isolate of bovine astrovirus was reported in England in 1978 (Woode and Bridger, 1978).”
Background
Flagged first, then by citations
3 of the 178 references couldn’t be matched to a known paper.
Research works printed but not linked: 2
- Henriksen, 1987, En oversigt over syndromet “Fedtede hvalpe” hos mink (A review of “sticky kit” syndrome in mink), Dansk. VetTidskr, 70, 580
- Svennekjaer, 1954, Minksyngdomme og aktuelle problemer i minkavlen (Mink diseases and current problems in mink farming), Dansk. Pelsdyravl., 12, 384
Cited by
Sorted by citations
Items 101–200 of 484
Kumthip, K., Khamrin, P., Ushijima, H., & Maneekarn, N. (2018) · Infection, Genetics and Evolution · doi:10.1016/j.meegid.2018.08.024 · Cited by 32
Enteric viruses in turkey enteritis
Jindal, N., Mor, S. K., & Goyal, S. M. (2014) · VirusDisease · doi:10.1007/s13337-014-0198-8 · Cited by 31
“Cross-species transmission and virus adaptation to new hosts or co-infection of the same host with different astroviruses may lead to the emergence of novel astroviruses that infect animals or that have a zoonotic potential [24].”
BackgroundGuix, S., Bosch, A., & Pintó, R. M. (2012) · Springer eBooks · doi:10.1007/978-1-4614-4735-1_6 · Cited by 31
Xia, M., Wei, C., Wang, L., Cao, D., Meng, X., Jiang, X., & Tan, M. (2016) · Scientific Reports · doi:10.1038/srep25735 · Cited by 30
Zaraket, H., Abou‐El‐Hassan, H., Kreidieh, K., Soudani, N., Ali, Z., Hammadi, M., Reslan, L., Ghanem, S., Hajar, F., Inati, A. C., et al. (2017) · Infection Genetics and Evolution · doi:10.1016/j.meegid.2017.05.016 · Cited by 30
A Review of the Emerging Poultry Visceral Gout Disease Linked to Avian Astrovirus Infection
Li, L., Sun, M., Zhang, Y., & Liao, M. (2022) · International Journal of Molecular Sciences · doi:10.3390/ijms231810429 · Cited by 30
“This recombination between different strains of astroviruses has aggravated the prevention of astrovirus infection [4,11,16].”
BackgroundIsolation of chicken astrovirus from specific pathogen-free chicken embryonated eggs
Núñez, L., Santander-Parra, S., Mettifogo, E., Catroxo, M. H. B., Astolfi‐Ferreira, C. S., & Ferreira, A. J. P. (2015) · Poultry Science · doi:10.3382/ps/pev086 · Cited by 30
Theuns, S., Conceição‐Neto, N., Zeller, M., Heylen, E., Roukaerts, I. D. M., Desmarets, L. M. B., Ranst, M. A. V., Nauwynck, H., & Matthijnssens, J. (2016) · Infection Genetics and Evolution · doi:10.1016/j.meegid.2016.05.018 · Cited by 30
“Nowadays, classification is more often performed using genetic analysis of ORF2, which is the most variable astrovirus gene (De Benedictis et al., 2011; Lee and Kurtz, 1982) .”
BackgroundResultInfluentialNúñez, L., Santander-Parra, S., Carranza, C., Astolfi‐Ferreira, C. S., Buim, M. R., & Ferreira, A. J. P. (2016) · Poultry Science · doi:10.3382/ps/pew062 · Cited by 29
“And, more recently, in Brazil (Mettifogo et al., 2014), which demonstrates a worldwide distribution (De Benedictis et al., 2011).”
BackgroundNeurotropic Astroviruses in Animals
Wildi, N., & Seuberlich, T. (2021) · Viruses · doi:10.3390/v13071201 · Cited by 25
Mechanisms involved in controlling RNA virus-induced intestinal inflammation
Zhang, E., Fang, M., Jones, C., Minze, L. J., Xing, J., & Zhang, Z. (2022) · Cellular and Molecular Life Sciences · doi:10.1007/s00018-022-04332-z · Cited by 29
Detection of canine astrovirus in dogs with diarrhea in Japan
Takano, T., Takashina, M., Doki, T., & Hohdatsu, T. (2015) · Archives of Virology · doi:10.1007/s00705-015-2405-3 · Cited by 29
“AstV infection has been reported in mammals and birds [3, 7, 8], with the main clinical symptom being diarrhea.”
BackgroundAstroviruses in bats, Madagascar
Lebarbenchon, C., Ramasindrazana, B., Joffrin, L., Bos, S., Lagadec, E., Minter, G. L., Gomard, Y., Tortosa, P., Wilkinson, D. A., Goodman, S. M., et al. (2017) · Emerging Microbes & Infections · doi:10.1038/emi.2017.47 · Cited by 29
Detection of Diverse Novel Bat Astrovirus Sequences in the Czech Republic
Dufková, L., Straková, P., Širmarová, J., Salát, J., Moutelíková, R., Chrudimský, T., Bartonička, T., Nowotny, N. R., & Růžek, D. (2015) · Vector-Borne and Zoonotic Diseases · doi:10.1089/vbz.2015.1813 · Cited by 28
“AstVs seem to be highly prevalent in bats without causing overt clinical disease (De Benedictis et al. 2011).”
Coinfection of parvovirus and astrovirus in gout‐affected goslings
Liu, H., Hu, D., Zhu, Y., Xiong, H., Lv, X., Wei, C., Liu, M., Yin, D., He, C., Qi, K., et al. (2020) · Transboundary and Emerging Diseases · doi:10.1111/tbed.13652 · Cited by 28
OASL Triggered by Novel Goose Astrovirus via ORF2 Restricts Its Replication
Ren, D., Li, T., Zhang, X., Yao, X., Gao, W., Xie, Q., Zhang, J., Shao, H., Wan, Z., Qin, A., et al. (2020) · Journal of Virology · doi:10.1128/jvi.01767-20 · Cited by 28
“pose risks for cross-transmission and zoonotic infection (2, 3).”
BackgroundSurveillance and genetic diversity analysis of avian astrovirus in China
Zhang, F., Li, Y., Jiang, W., Yu, X., Zhuang, Q., Wang, S., Yuan, L., Wang, K., Sun, S., & Liu, H. (2022) · PLoS ONE · doi:10.1371/journal.pone.0264308 · Cited by 28
Complete Genome Sequence of a Novel Feline Astrovirus from a Domestic Cat in Hong Kong
Lau, S. K. P., Woo, P. C. Y., Yip, C. C., Bai, R., Wu, Y., Tse, H., & Yuen, K. (2013) · Genome Announcements · doi:10.1128/genomea.00708-13 · Cited by 28
“Because of their genetic diversity and recombination ability, astroviruses have the potential for zoonosis (5).”
BackgroundMalasao, R., Khamrin, P., Chaimongkol, N., Ushijima, H., & Maneekarn, N. (2012) · Journal of Medical Virology · doi:10.1002/jmv.23396 · Cited by 27
“In contrast, HAstV-6 and -7 are detected opportunistically and HAstV-8 is relatively rare [De Benedictis et al., 2011].”
BackgroundInfluentialMolecular epidemiology and viremia of porcine astrovirus in pigs from Guangxi province of China
Qin, Y., Fang, Q., Li, X., Li, F., Liu, H., Wei, Z., Ouyang, K., Chen, Y., & Huang, W. (2019) · BMC Veterinary Research · doi:10.1186/s12917-019-2217-x · Cited by 27
Recombination analysis based on the HAstV-2 and HAstV-4 complete genomes
Babkin, I. V., Tikunov, A. Y., Sedelnikova, D. A., Жираковская, Е. В., & Викторовна, Т. Н. (2014) · Infection Genetics and Evolution · doi:10.1016/j.meegid.2014.01.010 · Cited by 27
Environmental Surveillance for Human Astrovirus in Shandong Province, China in 2013
Zhou, N., Lin, X., Wang, S., Wang, H., Li, W., Tao, Z., & Xu, A. (2014) · Scientific Reports · doi:10.1038/srep07539 · Cited by 27
Stenglein, M. D., Velazquez, E. M., Greenacre, C. B., Wilkes, R. P., Ruby, J. G., Lankton, J. S., Ganem, D. E., Kennedy, M. A., & DeRisi, J. L. (2012) · Virology Journal · doi:10.1186/1743-422x-9-216 · Cited by 27
“The astroviruses form a family of small, non-enveloped, positive strand RNA viruses that infect a variety of mammalian and avian hosts [1-22].”
BackgroundYu, Z., Zhang, D., Yang, K., Bai, C., Li, Y.-D., Li, J., Jiang, S., & Wang, Y. (2019) · 3 Biotech · doi:10.1007/s13205-019-2006-z · Cited by 27
Molecular survey of parvovirus, astrovirus, coronavirus, and calicivirus in symptomatic dogs
Zobba, R., Visco, S., Sotgiu, F. D., Parpaglia, M. L. P., Pittau, M., & Alberti, A. (2021) · Veterinary Research Communications · doi:10.1007/s11259-020-09785-w · Cited by 26
Structural Insights into the Human Astrovirus Capsid
Ykema, M., & Tao, Y. J. (2021) · Viruses · doi:10.3390/v13050821 · Cited by 26
“This reduction in size is found throughout the ORF2 sequence, but the majority of the variability occurs in the C-terminal 200–300 amino acids out of the ~700 amino acid sequence that are mapped to the spike domain [31,32].”
BackgroundBovine Astrovirus—A Comprehensive Review
Zhu, Q., Li, B., & Sun, D. (2022) · Viruses · doi:10.3390/v14061217 · Cited by 26
Detection and genetic characterization of canine astroviruses in pet dogs in Guangxi, China
Zhou, H., Liu, L., Li, R., Qin, Y., Fang, Q., Balasubramaniam, V. R. M. T., Wang, G., Wei, Z., Ouyang, K., Huang, W., et al. (2017) · Virology Journal · doi:10.1186/s12985-017-0823-4 · Cited by 26
“Generally, the majority of AstVs naturally infect only related host species, or more than one lineage could transmit in a single host [23, 28].”
BackgroundYuan, X.-Y., Meng, K., Zhang, Y.-X., Qi, L.-H., Ai, W., & Wang, Y.-L. (2018) · Msphere · doi:10.1128/msphere.00380-18 · Cited by 23
Murine Astrovirus Infection and Transmission in Neonatal CD1 Mice.
Compton, S. R., Booth, C. J., & Macy, J. D. (2017) · PubMed Central · Cited by 26
Molecular characterisation of calicivirus and astrovirus in puppies with enteritis
de Castro, T. X., Garcia, R. D. C. N. C., Costa, E. M., Leal, R. M. C., Xavier, M. D. P. T. P., & Leite, J. P. G. (2013) · Veterinary Record · doi:10.1136/vr.101566 · Cited by 26
Ricemeyer, L., Aguilar-Hernández, N., López, T., Espinosa, R., Lanning, S. B., Mukherjee, S., Cuellar, C., López, S., Arias, C. F., & DuBois, R. M. (2021) · Journal of Virology · doi:10.1128/jvi.01415-21 · Cited by 25
An Insight into the Molecular Characteristics and Associated Pathology of Chicken Astroviruses
Raji, A. A., & Omar, A. R. (2022) · Viruses · doi:10.3390/v14040722 · Cited by 25
Chhabra, P., Samoilovich, E., Yermalovich, M. A., Chernyshova, L. I., Gheorghița, S., Cojocaru, R., Shugayev, N., Sahakyan, G., Lashkarashvili, M., Chubinidze, M., et al. (2014) · Infection Genetics and Evolution · doi:10.1016/j.meegid.2014.10.013 · Cited by 25
Logue, C. M., Barbieri, N. L., & Nielsen, D. W. (2017) · Advances in food and nutrition research · doi:10.1016/bs.afnr.2016.12.009 · Cited by 25
Construction of a reverse genetic system for porcine astrovirus
Qin, Y.-F., Fang, Q., Liu, H.-D., Ji, C., Chen, Y., Ouyang, K., Wei, Z.-Z., & Huang, W.-J. (2018) · Archives of Virology · doi:10.1007/s00705-018-3771-4 · Cited by 23
Aboubakr, H. A., & Goyal, S. M. (2019) · Food and Environmental Virology · doi:10.1007/s12560-019-09406-z · Cited by 25
Mendenhall, I., Skiles, M., Neves, E. S., Borthwick, S., Low, D. H. W., Liang, B., Lee, B., Su, Y. C. F., & Smith, G. J. D. (2017) · One Health · doi:10.1016/j.onehlt.2017.10.001 · Cited by 25
“In addition, the phylogeny of the astrovirus RdRp segment indicates that cross-species transmission has driven the evolution of this virus family [12].”
Emerging Foodborne and Agriculture-Related Viruses
Kingsley, D. H. (2018) · ASM Press eBooks · doi:10.1128/9781555819644.ch11 · Cited by 23
Detection and Cellular Tropism of Porcine Astrovirus Type 3 on Breeding Farms
Rawal, G., Ferreyra, F. M., de Macêdo, N. R., Bradner, L. K., Harmon, K. M., Mueller, A., Allison, G., Linhares, D. C. L., & Arruda, B. L. (2019) · Viruses · doi:10.3390/v11111051 · Cited by 23
“Porcine astroviruses (PoAstVs) are genetically diverse and are distributed worldwide [10] with five genetic lineages (PoAstV1-5), reflecting different origins, interspecies transmission and recombination events [9, 11, 12] .”
BackgroundZhang, F., Li, H., Wei, Q., Xie, Q., Zeng, Y., Wu, C., Yang, Q., Tan, J., Tan, M., & Kang, Z. (2022) · Poultry Science · doi:10.1016/j.psj.2022.101800 · Cited by 23
Qiu, M., Li, S.-B., Xiao, Y., Li, J., Zhang, Y.-Z., Li, X., Feng, B., Li, C., Lin, H., Zhu, J.-Z., et al. (2022) · Microbial Pathogenesis · doi:10.1016/j.micpath.2022.105703 · Cited by 18
Lv, S.-L., Zhang, H., Li, J.-Y., Hu, W.-Q., Song, Y., Opriessnig, T., & Xiao, C. (2019) · Virus Genes · doi:10.1007/s11262-019-01692-w · Cited by 23
Emerging Infectious Diseases in Water Buffalo: An Economic and Public Health Concern
Villanueva, M. A., Mingala, C. N., Tubalinal, G. A. S., Gaban, P. B. V., Nakajima, C., & Suzuki, Y. (2018) · InTech eBooks · doi:10.5772/intechopen.73395 · Cited by 23
Novel human astroviruses: challenges for developing countries
Krishnan, T. (2014) · VirusDisease · doi:10.1007/s13337-014-0202-3 · Cited by 19
“Astroviruses have been recognized as another leading cause of infantile gastroenteritis and in a variety of other host species [5].”
BackgroundMethodZhu, J., Qi, M., Jiang, C., Peng, Y., Peng, Q., Chen, Y., Hu, C., Chen, J., Chen, X., Chen, H., et al. (2021) · Journal of General Virology · doi:10.1099/jgv.0.001640 · Cited by 22
“DISCUSSION Co-Infection BoAstV/BRV/BKoV increases the risk of calf diarrhoea Diarrhoea in animals and humans has been reported to be associated with intestinal AstV infection [11, 39], but whether BoAstV is the causative agent of bovine diarrhoea is controversial [2, 40].”
BackgroundNeonatal Fc receptor is a functional receptor for classical human astrovirus
Haga, K., Tokui, T., Miyamoto, K., Takai‐Todaka, R., Kudo, S., Ishikawa, A., Ishiyama, R., Kato, A., Yokoyama, M., Katayama, K., et al. (2024) · Genes to Cells · doi:10.1111/gtc.13160 · Cited by 24
The first serological investigation of Chicken astrovirus infection in China
Xue, J., Han, T., Xu, M., Zhao, J., & Zhang, G. (2017) · Biologicals · doi:10.1016/j.biologicals.2017.03.005 · Cited by 22
Saif, Y. Μ., Guy, J. S., Day, J. M., Cattoli, G., & Hayhow, C. S. (2019) · doi:10.1002/9781119371199.ch12 · Cited by 22
Self-citationWang, Y., Bai, C., Zhang, D., Yang, K., Yu, Z., Jiang, S., Ge, K., & Li, Y. (2020) · Gene · doi:10.1016/j.gene.2020.144898 · Cited by 21
Ren, D., Li, T., Zhang, W., Zhang, X., Zhang, X., Xie, Q., Zhang, J. J., Shao, H., Wan, Z., Qin, A., et al. (2021) · Applied Microbiology and Biotechnology · doi:10.1007/s00253-021-11711-2 · Cited by 21
Diversity of bat astroviruses in Lao PDR and Cambodia
Lacroix, A., Duong, V., Hul, V., Sorn, S., Holl, D., Keo, O., Chea, S., Hassanin, A., Theppangna, W., Silithammavong, S., et al. (2016) · Infection Genetics and Evolution · doi:10.1016/j.meegid.2016.11.013 · Cited by 21
“To date, this technique has remained unsuccessful for bat astVs (De Benedictis et al., 2011) , which may explain the limited number of available ORF2 references for bat astVs in GenBank.”
InfluentialMolecular epidemiology of astrovirus in children with gastroenteritis in southwestern Nigeria
Arowolo, K. O., Ayolabi, C. I., Adeleye, I., Lapinski, B., Santos, J. S., & Raboni, S. M. (2020) · Archives of Virology · doi:10.1007/s00705-020-04741-0 · Cited by 22
Characterization and phylogenetic analysis of new bat astroviruses detected in Gabon, Central Africa
Rougeron, V., Suquet, E., Maganga, G. D., Jiolle, D., Mombo, I. M., Bourgarel, M., Motsch, P., Arnathau, C., Durand, P., Drexler, J. F., et al. (2016) · Acta Virologica · doi:10.4149/av_2016_04_386 · Cited by 21
“Several reports showed that astroviruses are present worldwide and represent the second most important cause of gastroenteritis in children, after rotaviruses (Herrmann et al., 1991; Matsui et al., 2001; Moser and Schultz-Cherry 2005; De Benedictis et al., 2011).”
BackgroundInfluentialGenomic characterization of a novel recombinant porcine astrovirus isolated in northeastern China
Zhao, C., Chen, C., Li, Y., Dong, S., Tan, K., Tian, Y., Zhang, L., Huang, J., & Zhang, L. (2019) · Archives of Virology · doi:10.1007/s00705-019-04162-8 · Cited by 21
Xu, J., Gao, L., Zhu, P., Chen, S., Chen, Z., Yan, Z., Lin, W., Yin, L., Javed, M. T., Tang, Z., et al. (2023) · Frontiers in Microbiology · doi:10.3389/fmicb.2023.1112245 · Cited by 20
Pathogenicity of goose astrovirus genotype 2 in chickens
He, D., Jiang, X., Tian, M., Niu, X., Wei, F., Wu, B., Gao, L., Tang, Y., & Diao, Y. (2023) · Poultry Science · doi:10.1016/j.psj.2023.102808 · Cited by 20
“Although astrovirus infections are thought to be species specific (De Benedictis et al., 2011), the wide variety of species infected, the genetic diversity of the family, and the occurrence of recombination suggests that cross-species transmission of astroviruses could occur.”
BackgroundThe Ubiquitin-Proteasome System Is Necessary for Efficient Replication of Human Astrovirus
Casorla-Perez, L. A., López, T., López, S., & Arias, C. F. (2017) · Journal of Virology · doi:10.1128/jvi.01809-17 · Cited by 20
“that include two clades, MLB and VA (1).”
BackgroundEmerging and Novel Viruses in Passerine Birds
Williams, R., Sánchez-Llatas, C. J., Doménech, A., Madrid, R., Fandiño, S., Cea-Callejo, P., Gómez‐Lucía, E., & Benı́tez, L. (2023) · Microorganisms · doi:10.3390/microorganisms11092355 · Cited by 18
Amoroso, M. G., Russo, D., Lanave, G., Cistrone, L., Pratelli, A., Martella, V., Galiero, G., Decaro, N., & Fusco, G. (2018) · Zoonoses and Public Health · doi:10.1111/zph.12484 · Cited by 14
Quintero-Ochoa, G., Romero-Argüelles, R., Aviles-Hernández, A., Cejudo-Flores, M., Calleja-García, P., Domínguez-Gámez, M., Cantú-Bernal, S. H., Icedo-García, R., Soñanez‐Organis, J. G., Rosas‐Rodríguez, J. A., et al. (2019) · Infection Genetics and Evolution · doi:10.1016/j.meegid.2019.05.002 · Cited by 19
Molecular characterisation and phylogenetic analysis of feline astrovirus in Korean cats
Cho, Y.-Y., Lim, S.-I., Kim, Y. K., Song, J., Lee, J., & An, D.-J. (2013) · Journal of Feline Medicine and Surgery · doi:10.1177/1098612x13511812 · Cited by 19
Xue, J., Han, T., Zhao, Y., Yang, H., & Zhang, G. (2020) · Virus Research · doi:10.1016/j.virusres.2020.197858 · Cited by 19
Medina, J. E., Castañeda, S., Páez-Triana, L., Camargo, M., García-Corredor, D. J., Gómez, M., Luna, N., Ramírez, A., Pulido-Medellín, M. O., Muñoz, M., et al. (2023) · Infection Genetics and Evolution · doi:10.1016/j.meegid.2023.105543 · Cited by 19
“Amino acid identity > 75% is used for Astrovirus classification as the same species (De Benedictis et al., 2011).”
Lüthi, R., Boujon, C. L., Kauer, R. V., Koch, M. C., Bouzalas, I. G., & Seuberlich, T. (2018) · Scientific Reports · doi:10.1038/s41598-018-27533-8 · Cited by 18
Epidemiology, genetic diversity and evolution of canine astrovirus
Zhang, W., Wang, R., Liang, J., Zhao, N., Li, G., Gao, Q., & Su, S. (2020) · Transboundary and Emerging Diseases · doi:10.1111/tbed.13663 · Cited by 18
Bhatta, T., Chamings, A., & Alexandersen, S. (2021) · Viruses · doi:10.3390/v13081608 · Cited by 14
“The ORF2 capsid region of AstV is the most genetically variable region of the genome [74] as it contains neutralizing epitopes that form the capsid protein including the spike domain [75,76].”
BackgroundWerid, G. M., Ibrahim, Y. M., Chen, H., Fu, L., & Wang, Y. (2022) · Pathogens · doi:10.3390/pathogens11040417 · Cited by 19
Grimaldi, W. W., Hall, R. J., White, D. J., Wang, J., Massaro, M., & Tompkins, D. M. (2015) · Emu - Austral Ornithology · doi:10.1071/mu14068 · Cited by 18
“Astroviruses (family Astroviridae) are small, non-enveloped, single-stranded RNA viruses (de Benedictis et al. 2011), infecting birds and mammals in both terrestrial and aquatic habitats (de Benedictis et al. 2011).”
BackgroundHirashima, Y., Okada, D., Shibata, S., Yoshida, S., Fujisono, S., Omatsu, T., Mizutani, T., & Nagai, M. (2018) · Archives of Virology · doi:10.1007/s00705-018-3898-3 · Cited by 18
Diversity of Astroviruses Circulating in Humans, Bats, and Wild Birds in Egypt
Taweel, A. E., Kandeil, A., Barakat, A., Alfarouk, O. R., Kayali, G., & Ali, M. A. (2020) · Viruses · doi:10.3390/v12050485 · Cited by 18
Current Situation of Goose Astrovirus in China: A Review
Ren, D., Zhang, H., Ye, X., Jia, X., Chen, R., Tang, T., Ye, J., & Wu, S. (2025) · Viruses · doi:10.3390/v17010084 · Cited by 17
“AstVs are currently classified into two genera, Mamastroviruses ( MAstVs ) and Avastroviruses ( AAstVs ), whose members are known to contain 19 and 3 types, respectively [4,9].”
Gopalkrishna, V., Joshi, M. S., Chavan, N. A., Shinde, M. S., Walimbe, A. M., Sawant, P. M., Kalrao, V., Dhongade, R. K., & Bavdekar, A. (2021) · Journal of Medical Virology · doi:10.1002/jmv.27085 · Cited by 17
“Globally, the genotype AstV‐1 has been reported as the most common, AstV2–5 as less common, and AstV‐6 and 8 as very rare.(47,48) Further studies on full gene/genome characterization will be necessary to know about the possibility of a recombinant event in a study strain (HAstrovirus/IND/NIV1850156/2018) classified as…”
BackgroundSchuele, L., Lizarazo, E., Strutzberg‐Minder, K., Schütze, S., Loebert, S., Lambrecht, C., Harlizius, J., Friedrich, A. W., Peter, S., Rossen, J. W. A., et al. (2021) · Transboundary and Emerging Diseases · doi:10.1111/tbed.14249 · Cited by 17
Scoping review on the epidemiology, diagnostics and clinical significance of porcine astroviruses
Rawal, G., & Linhares, D. C. L. (2021) · Transboundary and Emerging Diseases · doi:10.1111/tbed.14123 · Cited by 17
Shen, Q., Zhuang, Z., Lü, J., Qian, L., Li, G., Kanton, A. G., Yang, S., Wang, X., Wang, H., Yin, J., et al. (2022) · Frontiers in Veterinary Science · doi:10.3389/fvets.2022.878441 · Cited by 17
“Astroviruses (AstVs) are non-enveloped single-stranded, plus-sense RNA viruses with a genome of ∼6,800 to over 7,700 nucleotides (nt) in size (1).”
BackgroundA Novel Coronavirus and a Broad Range of Viruses in Kenyan Cave Bats
Kamau, J., Ergünay, K., Webala, P. W., Justi, S. A., Bourke, B. P., Kamau, M. W., Hassell, J. M., Chege, M. N., Mwaura, D. K., Simiyu, C., et al. (2022) · Viruses · doi:10.3390/v14122820 · Cited by 16
Pathogenicity of a goose astrovirus 2 strain causing fatal gout in goslings
Wang, A., Xie, J., Wu, Z. Q., Liu, L., Wu, S., Feng, Q., Dong, H., & Zhu, S. (2023) · Microbial Pathogenesis · doi:10.1016/j.micpath.2023.106341 · Cited by 17
Complete Genome Sequence of a Newly Identified Porcine Astrovirus Genotype 3 Strain US-MO123
Xiao, C.-T., Halbur, P., & Opriessnig, T. (2012) · Journal of Virology · doi:10.1128/jvi.02426-12 · Cited by 15
“Since the first porcine astrovirus (PAstV) was detected in pigs in the 1980s (4), five genotypes of PAstV have been identified (6, 7, 9), but an association with clinical disease still remains unclear.”
BackgroundYang, K., Xu, L., Liang, Y.-Q., Yin, D., Tu, J., Song, X., Shao, Y., Liu, H., & Qi, K. (2020) · Molecular and Cellular Probes · doi:10.1016/j.mcp.2020.101561 · Cited by 17
Sewage surveillance reveals the presence of canine GVII norovirus and canine astrovirus in Uruguay
Lizasoain, A., Tort, L. F. L., García, M., Gómez, M. M., Leite, J. P. G., Miagostovich, M. P., Cristina, J., Berois, M., Colina, R., & Victoria, M. (2015) · Archives of Virology · doi:10.1007/s00705-015-2571-3 · Cited by 17
Hoarau, F., Minter, G. L., Joffrin, L., Schoeman, M. C., Lagadec, E., Ramasindrazana, B., Santos, A. D., Goodman, S. M., Gudo, E. S., Mavingui, P., et al. (2018) · Virology Journal · doi:10.1186/s12985-018-1011-x · Cited by 17
“Worldwide, AstVs account for 2 to 9% of all acute non-bacterial gastroenteritis in children [2] ; they are also responsible for diseases in livestock, poultry and domestic pets [3] .”
Körner, C., Miller, M., & Brielmeier, M. (2019) · PLoS ONE · doi:10.1371/journal.pone.0221118 · Cited by 17
Nausea, Vomiting, and Noninflammatory Diarrhea
Bobak, D. A., & Guerrant, R. L. (2015) · Elsevier eBooks · doi:10.1016/b978-1-4557-4801-3.00100-4 · Cited by 17
Identification of Novel Astroviruses in the Gastrointestinal Tract of Domestic Cats
van Brussel, K., Wang, X., Shi, M., Carrai, M., Li, J., Martella, V., Beatty, J., Holmes, E., & Barrs, V. (2020) · Viruses · doi:10.3390/v12111301 · Cited by 16
“The astrovirus genome comprises three open reading frames (ORFs): ORF1a and ORF1b encode the non-structural proteins involved in viral replication, including the RNA-dependent RNA polymerase (RdRp), while ORF2 encodes the capsid precursor [2].”
BackgroundWei, H., Khamrin, P., Kumthip, K., Yodmeeklin, A., & Maneekarn, N. (2021) · Scientific Reports · doi:10.1038/s41598-021-02745-7 · Cited by 16
Leblanc, D., Inglis, G., Boras, V. F., Brassard, J., & Houde, A. (2016) · Archives of Virology · doi:10.1007/s00705-016-3063-9 · Cited by 14
Discovery of novel astrovirus genotype species in small ruminants
Kauer, R., Koch, M., Hierweger, M. M., Werder, S., Boujon, C. L., & Seuberlich, T. (2019) · PeerJ · doi:10.7717/peerj.7338 · Cited by 16
“In humans, AstV are best known as a major source of outbreaks of gastroenteritis, especially in infants, young children and immunocompromised people (De Benedictis et al., 2011; Fischer, Pinho Dos Reis & Balkema-Buschmann, 2017) .”
BackgroundEmerging Infectious Diseases in Water Buffalo - An Economic and Public Health Concern
Villanueva, M. A., Mingala, C. N., Tubalinal, G. A. S., Gaban, P. B. V., Nakajima, C., & Suzuki, Y. (2018) · InTech eBooks · doi:10.5772/intechopen.73136 · Cited by 15
Amimo, J. O., Machuka, E., Abworo, E. O., Vlasova, A. N., & Pellé, R. (2020) · Viruses · doi:10.3390/v12111262 · Cited by 15
“Emergence of porcine–human AstV recombinants has been reported in regions where pigs and humans live closely, such as our study region, with suspected human to pig transmission, although the reverse has not been reported [12].”
BackgroundAstrovirus-Associated Polioencephalomyelitis in an Alpaca
Küchler, L., Rüfli, I., Koch, M. C., Hierweger, M. M., Kauer, R. V., Boujon, C. L., Hilbe, M., Oevermann, A., Zanolari, P., Seuberlich, T., et al. (2020) · Viruses · doi:10.3390/v13010050 · Cited by 15
“However, to this day, apart from immunosuppression, which seems to play an important role in humans, little is known about the factors contributing to the neuroinvasion of astroviruses in other species [1,2,9,17].”
BackgroundHammerschmitt, M. E., de Almeida, P. R., de Cecco, B. S., Lorenzett, M. P., Schwertz, C. I., da Cruz, R. A. S., Caprioli, R. A., Schuh, D. T., Demoliner, M., Eisen, A. K. A., et al. (2021) · Brazilian Journal of Microbiology · doi:10.1007/s42770-021-00509-z · Cited by 15
“These viruses are implicated in cases of encephalomyelitis in humans, pigs, sheep, and cattle [23].”
BackgroundKour, R., Kumar, P., Jindal, N., Minhas, S. K., Kumar, R., Gupta, A. K., & Malik, A. (2021) · Archives of Virology · doi:10.1007/s00705-021-05195-8 · Cited by 15
The isolation and characterization of Duck astrovirus type‐1 remerging in China
Wei, F., Wang, Y., Wang, Q., Yang, J., Jiang, X., He, D., Diao, Y., & Tang, Y. (2021) · Transboundary and Emerging Diseases · doi:10.1111/tbed.14444 · Cited by 15
Luis Luna, E., Beserra, L. A. R., Soares, R. M., & Gregori, F. (2016) · Archives of Virology · doi:10.1007/s00705-016-3057-7 · Cited by 15
“It can present challenges for epidemiological studies including studies of zoonotic potential [29].”
BackgroundHalczok, T. K., Fischer, K., Gierke, R., Zeus, V. M., Meier, F., Treß, C., Balkema‐Buschmann, A., Puechmaille, S. J., & Kerth, G. (2017) · BMC Evolutionary Biology · doi:10.1186/s12862-016-0856-0 · Cited by 15
“The high prevalence and diversity of astroviruses harbored by bats is remarkable [18, 21, 23] and their capability to cross species barriers and become adapted to new hosts, including spill-over to other taxa, has been suggested [24].”
BackgroundSawant, P. M., Waghchaure, R., Shinde, P. A., Palikondawar, A. P., & Lavania, M. (2023) · Viruses · doi:10.3390/v15081679 · Cited by 14
“Five genotypes of PAstV (PAstV1-5) have been identified with varying prevalences from both healthy and diarrheic pigs, including in the Czech Republic, Canada, Columbia, USA, Hungary, China, South Korea and Thailand (De Benedictis et al., 2011; Kumthip et al., 2018; Rawal and Linhares 2022).”
BackgroundZhou, Q., Cui, Y., Wang, C., Wu, H., Xiong, H., Qi, K., & Liu, H. (2023) · Avian Pathology · doi:10.1080/03079457.2023.2295341 · Cited by 14
Identification of astroviruses in bovine and buffalo calves with enteritis
Martella, V., Catella, C., Capozza, P., Diakoudi, G., Camero, M., Lanave, G., Galante, D., Cafiero, M. A., Lavazza, A., Bànyai, K., et al. (2020) · Research in Veterinary Science · doi:10.1016/j.rvsc.2020.04.010 · Cited by 14
“Since the first description of human AstV in children with diarrhea in 1975 (Appleton and Higgins, 1975) , a wide variety of AstVs have been reported in multiple animals including cattle, pigs, sheep, minks, dogs, cats, mice, sea lions, bats, whales, chickens, and turkeys (De Benedictis et al., 2011) .”
Experimental porcine astrovirus type 3-associated polioencephalomyelitis in swine
Ferreyra, F. M., Arruda, P., Bradner, L. K., Harmon, K. M., Zhang, M., Gimenez-Lirola, L. G., & Arruda, B. L. (2021) · Veterinary Pathology · doi:10.1177/03009858211025794 · Cited by 14
“Frequently, these neurotropic strains cluster within the VA/HMO clade originating from humans, mink, sheep, cattle, and pigs including PoAstV3, suggesting the presence of common genetic determinants and the potential for cross-species transmission.(17,25,26,60,71) The pathogenesis and histologic lesions of neurotropic…”
Background
Metadata
- Authors
- De Benedictis, P., Schultz-Cherry, S., Burnham, A., & Cattoli, G.
- Affiliations
- St. Jude Children's Research Hospital (US)
- Istituto Zooprofilattico Sperimentale delle Venezie (IT)
- Corresponding author
- Cattoli, Giovanni
- Venue
- Infection, Genetics and Evolution
- Publisher
- Elsevier BV
- Published
- 2011-10
- Volume
- 11
- Issue
- 7
- Pages
- 1529-1544
- ISSN
- 1567-1348 (ISSN-L)
- PMC
- PMC7185765
- OpenAlex
- W1980783855
- Cited by
- 479
- References
- 178
- Citations by year
- 2026: 27 · 2025: 35 · 2024: 35 · 2023: 38 · 2022: 33 · 2021: 50 · 2020: 41 · 2019: 32 · 2018: 37 · 2017: 31 · 2016: 33 · 2015: 32 · 2014: 19 · 2013: 19 · 2012: 15
- FWCI
- 2.11
- Type
- journal article
- Language
- en
- Open access
- green
- www.ncbi.nlm.nih.gov
- Locations
- Infection Genetics and Evolution (publishedVersion)
- PubMed Central (publishedVersion)
- PubMed (publishedVersion)
- Topics
- Health Sciences › Medicine › Infectious Diseases › Viral gastroenteritis research and epidemiology
- Life Sciences › Agricultural and Biological Sciences › Animal Science and Zoology › Animal Virus Infections Studies
- Health Sciences › Medicine › Public Health, Environmental and Occupational Health › Zoonotic diseases and public health
- Keywords
- astrovirus, Astroviridae, human astrovirus, gastroenteritis, genetic diversity, viral recombination, interspecies transmission, zoonotic potential, antigenic variation, molecular biology
- MeSH terms
- Animals, Base Sequence, DNA, Viral, Humans, Phylogeny, Species Specificity, Genetic Variation, Zoonoses, Astroviridae, Astroviridae Infections
About these checks
Registry, retraction, Cites and statistics results are computed, not judged, with one exception: a printed reference that no index lists is read once by a model before it counts as a citation error. Claims are extracted by a model and kept only when their quote appears verbatim in the text; each cited source is then checked, with a model’s help, for whether it says what the claim relies on. Those verdicts can be wrong — read the claim’s quote and the cited source before relying on one.
Statistics and arithmetic are recomputed, not judged.
Confidence bands are shown only for fields calibrated on our annotated test set. None is calibrated yet, so no band is shown.
What counts as a claim ›How we measure confidence ›How we check this ›
Are you an author, or do you see a problem with this page? Request a review
