The DOI matches its Crossref record; 175 of the 178 references it cites were found in a registry or an index.
Astrovirus Infections in Humans and Animals—Molecular Biology, Genetic Diversity, and Interspecies Transmissions
Open accessAbstract
Astroviruses are small, non-enveloped, positive sense, single-stranded RNA viruses first identified in 1975 in children suffering from diarrhea and then described in a wide variety of animals. To date, the list of animal species susceptible to astrovirus infection has expanded to 22 animal species or families, including domestic, synantropic and wild animals, avian, and mammalian species in the terrestrial and aquatic environments. Astrovirus infections are considered among the most common cause of gastroenteritis in children, second only to rotavirus infections, but in animals their association with enteric diseases is not well documented, with the exception of turkey and mink astrovirus infection. Genetic variability has been described in almost all astrovirus species sufficiently examined infecting mammals and birds; however, antigenic variability has been demonstrated for human astroviruses but is far less investigated in animal viruses. Interestingly, there is an increasing evidence of recombination events occurring in astroviruses, which contributes to increase the genetic variability of this group of viruses. A wide variety of species infected, the evident virus genetic diversity and the occurrence of recombination events indicate or imply either cross-species transmission and subsequent virus adaptation to new hosts or the co-infection of the same host with different astroviruses. This can also favor the emergence of novel astroviruses infecting animals or with a zoonotic potential. After more than 30 years from their first description in humans, there are many exciting streams of research to be explored and intriguing questions that remain to be answered about the relatively under-studied Astroviridae family. In the present work, we will review the existing knowledge concerning astrovirus infections in humans and animals, with particular focus on the molecular biology, interspecies transmission and zoonotic potential of this group of viruses.
Overview
The claims and statistics of this paper haven’t been checked yet.
Run the check — free, no account needed. It reads the open-access text and checks the sources it cites.
Integrity signals
Registry
Cites
Statistics
Verification
Claims the paper makes
The claims and statistics of this paper haven’t been checked yet.
Run the check — free, no account needed. It reads the open-access text and checks the sources it cites.
Claims other papers make about this one
Each is checked against this paper’s own text: does it say what the citing paper says it does?
The source backs part of the claim, not all of it — or backs it for a different population, condition or comparison.
In the citing paper
“Astroviruses have a broad host range (Donato and Vijaykrishna 2017) and are frequently detected in the faeces of mammals, birds, and humans with gastroenteritis (Finkbeiner et al. 2009; De Benedictis et al. 2011).”
From Red fox viromes in urban and rural landscapes (2020) · cites this paper as De Benedictis et al. 2011
Experimental — accuracy not yet measured
Self-check
Percentages, sums and reported differences re-computed from the paper’s own numbers.
The self-check needs the paper’s full text.
Citations
Cites
The alphaviruses: gene expression, replication, and evolution.
Strauss, J. H., & Strauss, E. G. (1994) · Microbiological Reviews · doi:10.1128/mmbr.58.3.491-562.1994 · Cited by 2,221
Virus Taxonomy: VIIIth Report of the International Committee on Taxonomy of Viruses.
Fauquet, C., Mayo, M. A., Maniloff, J., Desselberger, U., & Ball, L. A. (2005) · Cited by 798
28 nm PARTICLES IN FÆCES IN INFANTILE GASTROENTERITIS
Madeley, C. R., & Cosgrove, B. (1975) · The Lancet · doi:10.1016/s0140-6736(75)90858-2 · Cited by 385 · cited 1×
“Astroviruses are small, non-enveloped RNA viruses first identified in 1975 by electron microscopy (EM) in children suffering from diarrhea (Appleton and Higgins, 1975; Madeley and Cosgrove, 1975b; Matsui and Greenberg, 1996).”
BackgroundTyping of human astroviruses from clinical isolates by enzyme immunoassay and nucleotide sequencing
Noel, J. S., Lee, T. W., Kurtz, J. B., Glass, R. I., & Monroe, S. S. (1995) · Journal of Clinical Microbiology · doi:10.1128/jcm.33.4.797-801.1995 · Cited by 379 · cited 1×
“In several cases these genotypes were detected and initially differentiated using a set of conserved primers to the ORF1b termed Mon269 (50 CAACTCAGGAAACAGGGTGT) and Mon270 (50 TCAGATGCATTGTCATTGGT) (Noel et al., 1995).”
BackgroundMetagenomic Analysis of Human Diarrhea: Viral Detection and Discovery
Finkbeiner, S. R., Allred, A. F., Tarr, P. I., Klein, E. J., Kirkwood, C. D., & Wang, D. (2008) · PLoS Pathogens · doi:10.1371/journal.ppat.1000011 · Cited by 361 · cited 3×
“They termed the virus MLB1 (AstV-MLB1) and went onto characterize the genome, demonstrating that AstV-MLB1 was highly divergent from any of the known astroviruses (Finkbeiner et al., 2008b).”
BackgroundMethodAstrovirus Encephalitis in Boy with X-linked Agammaglobulinemia
Quan, P.-L., Wagner, T. A., Briese, T., Torgerson, T., Hornig, M., Tashmukhamedova, A., Firth, C., Palacios, G., Baisre-De-Leon, A., Paddock, C., et al. (2010) · Emerging Infectious Diseases · doi:10.3201/eid1606.091536 · Cited by 332 · cited 10×
“HastV-PS is also genetically related to AstV-VA1 (Finkbeiner et al., 2009b) and to a lesser extent to MiAstVs and OAstVs, thus falling within the proposed genocluster GII of Mamastroviruses (Bosch et al., 2010b; Quan et al., 2010) .”
BackgroundInfluentialVIRUSES AND GASTROENTERITIS IN INFANTS
Appleton, H., & Higgins, P. G. (1975) · The Lancet · doi:10.1016/s0140-6736(75)92581-7 · Cited by 307 · cited 1×
“Astroviruses are small, non-enveloped RNA viruses first identified in 1975 by electron microscopy (EM) in children suffering from diarrhea (Appleton and Higgins, 1975; Madeley and Cosgrove, 1975b; Matsui and Greenberg, 1996).”
BackgroundNovel Astroviruses in Insectivorous Bats
Chu, D. K. W., Poon, L. L. M., Guan, Y., & Peiris, M. J. S. (2008) · Journal of Virology · doi:10.1128/jvi.00857-08 · Cited by 292 · cited 15×
“Astroviruses do not easily grow in laboratory host systems and for this reason serological classification is difficult and is generally speculated based on percentage of nucleotide and amino acid similarity of the ORF2 encoding for the capsid protein (Chu et al., 2008; Koci et al., 2000; Reuter et al., 2011).”
BackgroundMethodResultInfluentialAhlquist, P. (2006) · Nature Reviews Microbiology · doi:10.1038/nrmicro1389 · Cited by 285 · cited 2×
“The transmembrane domains may localize nsp1a/2 to the endoplasmic reticulum (ER) membrane to facilitate replication (Guix et al., 2004) similar to other positivestrand RNA viruses (Ahlquist, 2006; Geigenmuller et al., 2002; Guix et al., 2004, 2005; Kiang and Matsui, 2002; Speroni et al., 2009).”
BackgroundIsolation of Small Viruses Resembling Astroviruses and Caliciviruses from Acute Enteritis Of Calves
Woode, G. N., & Bridger, J. C. (1978) · Journal of Medical Microbiology · doi:10.1099/00222615-11-4-441 · Cited by 262 · cited 3×
“The first isolate of bovine astrovirus was reported in England in 1978 (Woode and Bridger, 1978).”
Background
Research works printed but not linked: 2
- Henriksen, 1987, En oversigt over syndromet “Fedtede hvalpe” hos mink (A review of “sticky kit” syndrome in mink), Dansk. VetTidskr, 70, 580
- Svennekjaer, 1954, Minksyngdomme og aktuelle problemer i minkavlen (Mink diseases and current problems in mink farming), Dansk. Pelsdyravl., 12, 384
Cited by
Sorted by citations
Items 201–300 of 484
Detection of a novel astrovirus from a black-naped monarch (Hypothymis azurea) in Cambodia
Mendenhall, I. H., Yaung, K. N., Joyner, P. H., Keatts, L., Borthwick, S. A., Neves, E. S., Sorn, S., Gilbert, M., & Smith, G. J. D. (2015) · Virology Journal · doi:10.1186/s12985-015-0413-2 · Cited by 14
“Astroviruses are a genetically diverse group with a wide host range [12].”
BackgroundLopez, F., Lizasoain, A., Victoria, M., Papalardo, C., Castro, S., Arreseigor, E., López, P., & Colina, R. (2017) · Journal of Medical Virology · doi:10.1002/jmv.24854 · Cited by 14
“Classic HAstV has been described predominately affecting children under the age of 2 years.(2,18) However, in this study, the group of children between 2 and 5 years old presents the higher percentage of infections, which is in concordance with a recent report of Ref.”
ResultSchmidt, K., Butt, J., Mauter, P., Vogel, K. A., Erles-Kemna, A., Pawlita, M., & Nicklas, W. (2017) · PLoS ONE · doi:10.1371/journal.pone.0187174 · Cited by 14
Complete genome sequence of a porcine astrovirus from South Korea
Lee, S., Jang, G., & Lee, C. (2015) · Archives of Virology · doi:10.1007/s00705-015-2436-9 · Cited by 13
Viral Agents of Gastroenteritis
Parra, G. I., & Green, K. (2016) · ASM Press eBooks · doi:10.1128/9781555818722.ch66 · Cited by 3
Jiang, X., Liu, J., Yuan, X., Zhang, Q., Wang, Y., Zhao, M., Lü, X., Wu, H., Shan, T., Ni, B., et al. (2023) · mSphere · doi:10.1128/msphere.00345-23 · Cited by 13
“Astroviruses can infect a wide range of mammals and birds (39).”
BackgroundPrevalence of Astroviruses in Different Animal Species in Poland
Kuczera, K., Orłowska, A., Smreczak, M., Frant, M., Trębas, P., & Rola, J. (2024) · Viruses · doi:10.3390/v16010080 · Cited by 12
Wei, F., He, D., Wu, B., Diao, Y., & Tang, Y. (2024) · Viruses · doi:10.3390/v16040541 · Cited by 13
Environmental Assessment of Classical Human Astrovirus in Uruguay
Lizasoain, A., Tort, L., García, M., Gómez, M. M., Cristina, J., Leite, J. P. G., Miagostovich, M., Victoria, M., & Colina, R. (2015) · Food and Environmnetal Virology · doi:10.1007/s12560-015-9186-4 · Cited by 11
“…by a single strand RNA molecule with positive sense of approximately 7.0 kb that presents three open reading frames (ORF) which encode nonstructural proteins as the serine protease and the RNA dependent RNA polymerase (ORF1a and ORF1b) and structural proteins (ORF2) (De Benedictis et al. 2011).”
BackgroundInfluentialXie, X., Macdonald, R. E., Tapscott, B., Nagy, É., & Turner, P. V. (2018) · Frontiers in Veterinary Science · doi:10.3389/fvets.2018.00132 · Cited by 13
“Mink astrovirus (MiAstV) has been suggested to play a major role in mink pre-weaning diarrhea (14, 15).”
BackgroundImmunogenicity and Efficacy Evaluation of Subunit Astrovirus Vaccines
Bidokhti, M., Ullman, K., Hammer, A., Jensen, T. H., Chriel, M., Byrareddy, S., & Baule, C. (2019) · Vaccines · doi:10.3390/vaccines7030079 · Cited by 11
“Despite remarkably growing studies on AstV epidemiology and molecular biology [41,42], little is known about its immunogenicity and vaccine development.”
BackgroundAstrovirus Outbreak in an Animal Shelter Associated With Feline Vomiting
Li, Y., Gordon, E. W., Idle, A., Hui, A. J., Chan, R., Seguin, M. A., & Delwart, E. (2021) · Frontiers in Veterinary Science · doi:10.3389/fvets.2021.628082 · Cited by 13
Identification of a novel astrovirus in goats in China
Wang, J., Xu, C., Zeng, M., Yue, H., & Tang, C. (2021) · Infection Genetics and Evolution · doi:10.1016/j.meegid.2021.105105 · Cited by 13
Stamelou, E., Giantsis, I. A., Papageorgiou, K., Petridou, E., Davidson, I., Polizopoulou, Z., Papa, A., & Kritas, S. (2022) · Porcine Health Management · doi:10.1186/s40813-021-00245-8 · Cited by 13
“The family Astroviridae is divided into two genera, Mamastrovirus (19 species) and Avastrovirus (3 species) [45].”
BackgroundAstrovirus in Reunion Free-Tailed Bat (Mormopterus francoismoutoui)
Joffrin, L., Hoarau, A. O. G., Lagadec, E., Köster, M., Ramanantsalama, R. V., Mavingui, P., & Lebarbenchon, C. (2021) · Viruses · doi:10.3390/v13081524 · Cited by 13
Zhou, N., Lin, X., Wang, S., Wang, H., Bi, Z., Wang, P., Chen, P., Tao, Z., Song, L., Song, Y., et al. (2016) · Journal of Applied Microbiology · doi:10.1111/jam.13109 · Cited by 12
“Classic HAstVs infection is seasonal and shows a peak in cold seasons (De Benedictis et al. 2011).”
BackgroundDiseases of the Alimentary Tract
(2017) · Elsevier eBooks · doi:10.1016/b978-0-7020-5246-0.00007-3 · Cited by 13
Complete Genome Sequences of Two Astrovirus MLB1 Strains from Bhutanese Children with Diarrhea
Matsumoto, T., Wangchuk, S., Tshering, K., Yahiro, T., Zangmo, S., Dorji, T., Tshering, K., Mitui, M. T., Nishizono, A., & Ahmed, K. (2013) · Genome Announcements · doi:10.1128/genomea.00485-13 · Cited by 12
Zhou, N., Zhou, L., & Wang, B. (2019) · Viruses · doi:10.3390/v11080707 · Cited by 12
Wei, H., Khamrin, P., Kumthip, K., Yodmeeklin, A., & Maneekarn, N. (2021) · Frontiers in Microbiology · doi:10.3389/fmicb.2021.789636 · Cited by 12
“…of recombinant strains, and the ORF1b/ORF2 junction of the HAstV genome has been reported as the predominant location at which recombination events occur (Walter et al., 2001; Wolfaardt et al., 2011; De Grazia et al., 2012; Martella et al., 2013; Babkin et al., 2014; Wohlgemuth et al., 2019).”
BackgroundInfluentialMyotis fimbriatus Virome, a Window to Virus Diversity and Evolution in the Genus Myotis
Armero, A. A., Li, R., Bienes, K. M., Chen, X., Jihao, L., Xu, S., Chen, Y., Hughes, A. C., Berthet, N., & Wong, G. (2022) · Viruses · doi:10.3390/v14091899 · Cited by 11
“These viruses are responsible for gastroenteritis, respiratory illness, and encephalitis in their hosts [97].”
BackgroundWei, H., Kumthip, K., Khamrin, P., Yodmeeklin, A., Jampanil, N., Phengma, P., Xie, Z., D, N. U. M., Ushijima, H., & Maneekarn, N. (2023) · Microbiology Spectrum · doi:10.1128/spectrum.04888-22 · Cited by 12
Attenuation hotspots in neurotropic human astroviruses
Ali, H., Lulla, A., Nicholson, A. S., Hankinson, J., Wignall-Fleming, E. B., O’Connor, R. L., Vu, D., Graham, S. C., Deane, J. E., Guix, S., et al. (2023) · PLoS Biology · doi:10.1371/journal.pbio.3001815 · Cited by 12
Highly diverse RNA viruses and phage sequences concealed within birds
Lü, X., Ji, L., Wang, H., Zhang, Q., Wang, X., Liu, Y., Shen, Q., Yang, S., Ma, X., Zhang, W., et al. (2024) · Microbiology Spectrum · doi:10.1128/spectrum.00802-24 · Cited by 12
“An astrovirus (BluePeacock205_contig_12951) from Pavo cristatus formed a distinct branch outside the astroviruses of unknown hosts detected from water and soil and shared 26% identity with the RdRp protein sequences of these astroviruses.”
BackgroundChirinda, P., Manjate, F., Garrine, M., Messa, A., Nobela, N., Vubil, D. C., Nhampossa, T., Acácio, S., Bassat, Q., Kotloff, K. L., et al. (2024) · Viruses · doi:10.3390/v16071159 · Cited by 12
“Human astroviruses are also single-stranded RNA viruses of the family Astroviridae , genus Mamastovirus , with four species (MAstV-1, MAstV-6, MAstV-8, and MAstV-9) identified in humans, where MAstV-1 includes the human pathogenic genotypes (HAstV 1–8) [6].”
BackgroundBi, Z., Lv, X., Zhang, Z., Cai, L., Zhang, M., Li, W., Ding, Y., Liu, H., Yang, K., Zhu, Y., et al. (2024) · Frontiers in Cellular and Infection Microbiology · doi:10.3389/fcimb.2024.1470808 · Cited by 12
Ali, S. L., Ali, A., Ullah, W., Khan, A., Khatrawi, E. M., Malik, A., Abduldayeva, A., Baiduissenova, A., Althagafi, H. J., & Fallatah, D. I. (2024) · Molecular Systems Design & Engineering · doi:10.1039/d3me00192j · Cited by 12
Nijhuis, R., Sidorov, I., Chung, P., Wessels, E., Gulyaeva, A., de Vries, J. D., Claas, E., & Gorbalenya, A. (2018) · Journal of Clinical Virology · doi:10.1016/j.jcv.2018.09.007 · Cited by 12
Birch, J. M., Ullman, K., Struve, T., Agger, J. F. G., Hammer, A. S., Leijon, M., & Jensen, H. E. (2018) · PLoS ONE · doi:10.1371/journal.pone.0205890 · Cited by 11
A novel method to rescue and culture duck Astrovirus type 1 in vitro
Zhang, R., Lan, J., Li, H., Chen, J., Yang, Y., Lin, S., Xie, Z., & Jiang, S. (2019) · Virology Journal · doi:10.1186/s12985-019-1218-5 · Cited by 12
Comparison of gut viral communities in diarrhoea and healthy dairy calves
Lü, X., Hua, X., Wang, Y., Zhang, D., Jiang, S., Yang, S., Wang, X., Shen, Q., Zhou, T., Lin, Z., et al. (2021) · Journal of General Virology · doi:10.1099/jgv.0.001663 · Cited by 11
Stamelou, E., Giantsis, I. Α., Papageorgiou, K. V., Petridou, E., Davidson, I., Polizopοulou, Z. S., Papa, A., & Kritas, S. K. (2022) · Virology Journal · doi:10.1186/s12985-022-01787-1 · Cited by 12
“The family Astroviridae is divided into two genera, namely Mamastrovirus, that includes 19 species, and Avastrovirus that includes 3 species [7].”
BackgroundEpidemiology of Human Astroviruses
Bosch, A., Guix, S., & Pintó, R. (2012) · Springer eBooks · doi:10.1007/978-1-4614-4735-1_1 · Cited by 12
Lachapelle, V., Letellier, A., Fravalo, P., Brassard, J., & L’Homme, Y. (2016) · Applied and Environmental Microbiology · doi:10.1128/aem.03187-16 · Cited by 12
Detection and genetic characterization of Mamastrovirus 5 from Brazilian dogs
Alves, C. B. D. T., Budaszewski, R. F., Torikachvili, M., Streck, A. F., Weber, M. N., Cibulski, S., Ravazzolo, A. P., Lunge, V., & Canal, C. (2018) · Brazilian Journal of Microbiology · doi:10.1016/j.bjm.2017.09.008 · Cited by 12
Orłowska, A., Smreczak, M., Potyrało, P., Bomba, A., Trębas, P., & Rola, J. (2021) · Viruses · doi:10.3390/v13020158 · Cited by 12
Wang, X., Wang, J., Zhou, C., Yang, S., Shen, Q., Zhang, W., & Qi, D. (2016) · Gut Pathogens · doi:10.1186/s13099-016-0140-2 · Cited by 12
“AstVs cause gastroenteritis in the young children, but in animals their association with enteric diseases is not well documented, with the exception of turkey and mink AstV infections [1].”
BackgroundA peptide-based ELISA for detection of antibodies against novel goose astrovirus type 1
Ren, D., Zhang, X., Zhang, W., Lian, M., Meng, X.-C., Li, T., Xie, Q., Shao, H., Wan, Z., Qin, A., et al. (2022) · Journal of Virological Methods · doi:10.1016/j.jviromet.2022.114646 · Cited by 11
Localization and distribution of goose astrovirus 2 antigens in different tissues at different times
Wei, F., Jiang, X., He, D., Diao, Y., & Tang, Y. (2023) · BMC Veterinary Research · doi:10.1186/s12917-023-03688-z · Cited by 11
“9 kb that belong to the Astroviridae family [1].”
BackgroundEpidemiological Investigation of Goose Astrovirus in Hebei Province, China, 2019–2021
Chen, L., Cui, H. Y., Li, J., Zhang, Y., Wang, H., Yang, Y., Wang, X., Zhang, C., & Liu, J. (2024) · Microorganisms · doi:10.3390/microorganisms12050990 · Cited by 11
“The Mamastroviruses genus is further subdivided into six categories, encompassing astroviruses from humans, pigs, cats, minks, sheep, and dogs [8].”
BackgroundArbona, R. J. R., Kelly, S. P., Wang, C., Dhawan, R. K., Henderson, K. S., Shek, W. R., Williams, S. H., Altan, E., Delwart, E., Wolf, F. R., et al. (2020) · Comparative Medicine · doi:10.30802/aalas-cm-19-000106 · Cited by 11
Interface between Bats and Pigs in Heavy Pig Production
Leopardi, S., Priori, P., Zecchin, B., Zamperin, G., Milani, A., Tonon, F., Giorgiutti, M., Beato, M. S., & Benedictis, P. D. (2020) · Viruses · doi:10.3390/v13010004 · Cited by 11
Identification of a novel protein in porcine astrovirus that is important for virus replication.
Du, Y., Ji, C., Liu, T., Zhang, W., Fang, Q., Dong, Q., Li, M.-Y., Wang, H., Chen, Y., Ouyang, K., et al. (2021) · Veterinary Microbiology · doi:10.1016/j.vetmic.2021.108984 · Cited by 9
Adebiyi, A. I., McIlwaine, K., Oluwayelu, D. O., & Smyth, V. J. (2021) · Archives of Virology · doi:10.1007/s00705-021-05034-w · Cited by 11
Case Report: First Report and Phylogenetic Analysis of Porcine Astroviruses in Chile
Flores, C., Ariyama, N., Bennett, B., Mena, J., Verdugo, C., Mor, S. K., Brito, B. P., Ramírez‐Toloza, G., & Neira, V. (2021) · Frontiers in Veterinary Science · doi:10.3389/fvets.2021.764837 · Cited by 11
“Genetic and evolutionary studies support the idea that both cross-species transmission and recombination events among AstV of human, porcine, and other species origin, may have occurred (11, 16).”
BackgroundPativada, M., Bhattacharya, R., & Krishnan, T. (2013) · Infection, Genetics and Evolution · doi:10.1016/j.meegid.2013.09.017 · Cited by 11
Detection of novel astroviruses among rodents of Gabon, Central Africa.
Mombo, I., Suquet, E., Boundenga, L., Mveang-Nzoghe, A., Maganga-Mboga, C., Arnathau, C., Sidobre, C., Leroy, E., & Rougeron, V. (2019) · Infection, Genetics and Evolution · doi:10.1016/j.meegid.2018.12.003 · Cited by 10
Jakubczak, A., Kowalczyk, M., Mazurkiewicz, I., & Kondracki, M. (2021) · Virus Genes · doi:10.1007/s11262-021-01834-z · Cited by 11
“Today, alongside rotaviruses, it is one of the main causes of viral gastrointestinal infections [3].”
BackgroundInfluentialPotential zoonotic swine enteric viruses: The risk ignored for public health
Ibrahim, Y. M., Werid, G. M., Zhang, H., Fu, L., Wang, W., Chen, H., & Wang, Y. (2022) · Virus Research · doi:10.1016/j.virusres.2022.198767 · Cited by 13
Detection and Genetic Characterization of Astroviruses in Brain Tissues of Wild Raccoon Dogs
Chae, S.-B., Jeong, C., Park, J.-S., Na, E., & Oem, J. (2023) · Viruses · doi:10.3390/v15071488 · Cited by 10
Riller, Q., Schmutz, M., Fourgeaud, J., Fischer, A., & Neven, B. (2024) · Immunological Reviews · doi:10.1111/imr.13402 · Cited by 10
Lanning, S., Aguilar-Hernández, N., Serrão, V. H. B., López, T., O’Rourke, S. M., Lentz, A., Ricemeyer, L., Espinosa, R., López, S., Arias, C. F., et al. (2025) · Journal of Virology · doi:10.1128/jvi.01619-24 · Cited by 10
“We previously generated a panel of IgG1 monoclonal antibodies (mAbs), three of which were found to neutralize either HAstV1 (mAbs 3B4 and 3H4) or HAstV2 (mAb 4B6) in Caco-2 cells, the gold standard cell line used for HAstV propagation and infectivity studies (43).”
Global prevalence of Porcine Astrovirus: A systematic review and meta-analysis
Ge, X., Li, Y., Zhao, F., Ma, X., Li, J., Yanping, J., Cui, W., Wang, X., & Tang, L. (2025) · Preventive Veterinary Medicine · doi:10.1016/j.prevetmed.2025.106465 · Cited by 10
Zhang, M., Lv, X., Wang, B., Yu, S., Lü, Q., Kan, Y., Wang, X., Jia, B., Bi, Z., Wáng, Q., et al. (2021) · Poultry Science · doi:10.1016/j.psj.2021.101680 · Cited by 10
Pathogenesis of Chicken Astrovirus Related Illnesses
Raji, A. A., & Omar, A. R. (2022) · Frontiers in Veterinary Science · doi:10.3389/fvets.2022.899901 · Cited by 10
“Shortly after the discovery of astrovirus in 1975, small round virus particles with astrovirus morphology were recorded in domestic animals, particularly calves and lambs with gastroenteritis (32, 33) and ducks with viral hepatitis in the early 1980s leading to acute mortality (34), which conceivably served as the ear…”
BackgroundEmerging Foodborne and Agriculture-Related Viruses
Kingsley, D. (2016) · Microbiology spectrum · doi:10.1128/microbiolspec.pfs-0007-2014 · Cited by 10
“Sequence analysis of multiple astroviruses indicates a high level of diversity and recombination, suggesting a propensity for cross-species infection and subsequent adaptation to the new host and/or coinfection of the same host with different astroviruses (66).”
BackgroundInfluentialGenetic diversity and phylogenetic analysis of newly discovered bat astroviruses in Korea
Lee, S., Son, K., Kim, Y.-S., Wang, S.-J., Kim, Y.-K., Jheong, W., & Oem, J. (2018) · Archives of Virology · doi:10.1007/s00705-018-3992-6 · Cited by 10
“Mamastrovirus viruses have been identified in numerous mammalian species such as human, pig, mink, sheep, and bat [4, 5] .”
BackgroundAlves, C. D. B. T., Budaszewski, R. D. F., Cibulski, S. P., Weber, M. N., Mayer, F. Q., Bianchi, M. V., da Silva, B. Z., Konradt, G., Slaviero, M., Sonne, L., et al. (2018) · Comparative Immunology Microbiology and Infectious Diseases · doi:10.1016/j.cimid.2018.08.002 · Cited by 10
“In general, it ranges from 672 to 851 amino acids among the Astroviridae family members [1] .”
BackgroundInfluentialDetection of Astrovirus in a Cow with Neurological Signs by Nanopore Technology, Italy
Zaccaria, G., Lorusso, A., Hierweger, M. M., Malatesta, D., Defourny, S. V. P., Ruggeri, F., Camma', C., Ricci, P., Domenico, M. D., Rinaldi, A. M., et al. (2020) · Viruses · doi:10.3390/v12050530 · Cited by 10
Casado-Martín, L., Hernández, M., Yéramian, N., González-Peña, M. J., Bouza, J. M. E., & Rodrı́guez-Làzaro, D. (2025) · Frontiers in Microbiology · doi:10.3389/fmicb.2025.1586478 · Cited by 9
da Silva, M. F., Victoria, M., & Miagostovich, M. (2019) · Water and Sanitation for the 21st Century: Health and Microbiological Aspects of Excreta and Wastewater Management (Global Water Pathogen Project) · doi:10.14321/waterpathogens.18 · Cited by 13
“HAstV causes gastroenteritis mainly in children, usually less than 2 years, although immunocompromised persons and the elderly are also a group at high risk (De Benedictis et al. 2011).”
BackgroundGenetic diversity and expanded host range of astroviruses detected in small mammals in Singapore
Neves, E. S., Mendenhall, I. H., Borthwick, S. A., Su, Y. C. F., & Smith, G. J. D. (2021) · One Health · doi:10.1016/j.onehlt.2021.100218 · Cited by 9
“Astroviruses are highly prevalent with a global distribution and are found in a wide variety of host species [5].”
BackgroundBiology and Cellular Tropism of a Unique Astrovirus Strain: Murine Astrovirus 2
Kelly, S. P., Arbona, R. J. R., Michel, A. O., Wang, C., Henderson, K. S., & Lipman, N. S. (2021) · Comparative Medicine · doi:10.30802/aalas-cm-21-000039 · Cited by 9
Brussel, K. V., Mahar, J. E., Hall, J., Bender, H. S., Ortiz-Báez, A. S., Chang, W.-S., Holmes, E. C., & Rose, K. A. (2023) · Virology · doi:10.1016/j.virol.2023.07.011 · Cited by 9
Experimental infection of poults and guinea fowl with genetically distinct avian astroviruses
Toffan, A., Catania, S., Salviato, A., Battisti, C. D., Vascellari, M., Toson, M., Capua, I., & Cattoli, G. (2012) · Avian Pathology · doi:10.1080/03079457.2012.704980 · Cited by 9
Self-citationOyinloye, S. O., Aminu, M., Ella, E. E., & Jatau, E. D. (2016) · Journal of Public Health and Epidemiology · doi:10.5897/jphe2016.0840 · Cited by 9
“The astrovirus taxonomy is mainly based on the species of origin and the serotypes within each species are defined on the basis of twenty-fold or greater cross-neutralization titers (De-Benedictis et al., 2011).”
BackgroundTao, J., Li, B., Cheng, J., Shi, Y., Qiao, C., Lin, Z., & Liu, H. (2022) · Viruses · doi:10.3390/v14071383 · Cited by 9
“Some studies indicate that genome recombination exists among different serotypes or species, which means that there may be inter-species transmission between animals and between animals and humans [4].”
BackgroundTao, Z., Wang, H., Zhang, W., & Xu, A. (2019) · Journal of Clinical Virology · doi:10.1016/j.jcv.2019.05.005 · Cited by 9
Swayne, D. E. (2013) · doi:10.1002/9781119421481.ch12 · Cited by 9
Maniah, K., Nour, I., Hanif, A., Yassin, M. T., Alkathiri, A., Alharbi, Y., Alotaibi, R., Al-Anazi, A. E., & Eifan, S. A. (2022) · Water · doi:10.3390/w14244033 · Cited by 8
Aleshina, Y. A., & Lukashev, A. N. (2025) · Virus Evolution · doi:10.1093/ve/veaf006 · Cited by 8
“Mink astroviruses are the risk factor of preweaning diarrhea in farm-raised mink kits (De Benedictis et al. 2011).”
The First Detection and Phylogenetic Analysis of Bovine Astrovirus from Diarrheic Calves in Turkey
Turan, T., & Işıdan, H. (2018) · Etlik Veteriner Mikrobiyoloji Dergisi · doi:10.35864/evmd.513442 · Cited by 9
“They have been classified into two genera, namely Mamastroviruses (MAstVs) and Avastroviruses (AAstVs), are known to infect mammalian and avian species, respectively [4].”
BackgroundMolecular study of human astrovirus in Egyptian children with acute gastroenteritis
Zaki, M. E. S., Mashaly, G. E.-S., Alsayed, M. A. L., & Nomir, M. (2020) · GERMS · doi:10.18683/germs.2020.1202 · Cited by 8
“HAstV genotype 1 was detected as the most prevalent genotype with occasional occurrence of HAstV-6, and HAstV-7 in acute gastroenteritis.(7) There are infections attributed to HAstV-8 in some geographical regions.”
BackgroundCo-circulation of canine chaphamaparvovirus and canine parvovirus 2 in dogs with diarrhea in Turkey
Dinçer, E., Timurkan, M. Ö., Polat, P., & Aydın, H. (2020) · The Thai Journal of Veterinary Medicine · doi:10.56808/2985-1130.3054 · Cited by 8
Astrovirus Infection in Cattle with Nonsuppurative Meningoencephalitis in South Korea
Lee, S., Kim, J., Kim, Y.-J., Kim, Y., Roh, S. G., Lee, K., Kim, H.-J., Shin, J., & Oem, J. (2021) · Viruses · doi:10.3390/v13101941 · Cited by 8
Diverse novel astroviruses identified in wild Himalayan marmots
Ao, Y., Yu, J., Li, L., Cao, J., Deng, H., Xin, Y.-Y., Liu, M., Lin, L., Lu, S., Xu, J., et al. (2017) · Journal of General Virology · doi:10.1099/jgv.0.000709 · Cited by 8
Dubois, H., Loo, G., & Wullaert, A. (2018) · International review of cytology · doi:10.1016/bs.ircmb.2018.08.003 · Cited by 8
“After rotavirus, astrovirus is thought to be the second most common instigator of viral gastroenteritis in children (De Benedictis et al., 2011) .”
Chen, X., He, Y., Li, W., Ullah, K., Xiao, Y., Yang, J., WANG, X., Yang, S., & Zhang, W. (2020) · Polish Journal of Microbiology · doi:10.33073/pjm-2020-051 · Cited by 8
Horigan, S., Kettenburg, G., Kistler, A. L., Ranaivoson, H., Andrianiaina, A. F., Andry, S., Raharinosy, V., Randriambolamanantsoa, T. H., Tato, C., Lacoste, V., et al. (2024) · Virology Journal · doi:10.1186/s12985-024-02471-2 · Cited by 10
Porcine Astrovirus Infection in Brains of Pigs in Korea
Park, J.-S., Jeong, C., Chae, S.-B., Yang, M., Oh, B., Lee, S., & Oem, J. (2024) · Viruses · doi:10.3390/v16091372 · Cited by 7
Of Ducks and Men: Ecology and Evolution of a Zoonotic Pathogen in a Wild Reservoir Host
Wille, M., Latorre‐Margalef, N., & Waldenström, J. (2017) · Advances in environmental microbiology · doi:10.1007/978-3-319-60616-3_9 · Cited by 7
Comparative Analysis of Novel Strains of Porcine Astrovirus Type 3 in the USA
Ferreyra, F. M., Harmon, K. M., Bradner, L. K., Burrough, E. R., Derscheid, R. J., Magstadt, D. R., Michael, A., de Almeida, M. N., Schumacher, L. L., Siepker, C. L., et al. (2021) · Viruses · doi:10.3390/v13091859 · Cited by 7
Insights into Gastrointestinal Virome: Etiology and Public Exposure
Nour, I., Hanif, A., Ryan, M. D., & Eifan, S. A. (2021) · Water · doi:10.3390/w13192794 · Cited by 7
Ren, K., Wang, R., Liu, X., Liu, Y., Zhang, J., Bi, J., Zhao, L., Guo, Z., Liu, J., & Yin, G. (2021) · Archives of Virology · doi:10.1007/s00705-021-05311-8 · Cited by 7
Nguyen, T. V., Piewbang, C., & Techangamsuwan, S. (2023) · Frontiers in Veterinary Science · doi:10.3389/fvets.2023.1278417 · Cited by 7
“Similar to our investigation that found CaAstV in older dogs, there are previous reports of AstV detection in adult dogs (3) and humans who are elderly and immunocompromised (50).”
ResultSerotype Diversity of Astroviruses in Rawalpindi, Pakistan during 2009–2010
Alam, M., Khurshid, A., Rana, M. S., Shaukat, S., Sharif, S., Angez, M., Naeem, M., & Zaidi, S. S. (2013) · PLoS ONE · doi:10.1371/journal.pone.0061667 · Cited by 7
“The poor adaptation of astroviruses to laboratory growth systems led to the formation of genome based classification, based on the percentage similarity of nucleotide and amino acid sequence of ORF2 capsid protein [8].”
BackgroundIndigenous house mice dominate small mammal communities in northern Afghan military bases
Gertler, C., Schlegel, M., Linnenbrink, M., Hutterer, R., König, P., Ehlers, B., Fischer, K., Ryll, R., Lewitzki, J., Sauer, S., et al. (2017) · BMC Zoology · doi:10.1186/s40850-017-0024-z · Cited by 7
“In addition, these viruses are also capable of genomic recombination which has already been described for human astroviruses [50, 51].”
BackgroundLi, H., Huang, H., Lin, C., Zhang, F., Tan, J., Li, N., Wu, C., Huang, J.-N., Wei, Q., Wang, S., et al. (2025) · BMC Veterinary Research · doi:10.1186/s12917-025-04687-y · Cited by 6
Wei, F., Jiang, X., He, D., Wang, Q., Diao, Y., & Tang, Y. (2023) · Transboundary and Emerging Diseases · doi:10.1155/2023/8515116 · Cited by 6
Regulation of host/pathogen interactions in the gastrointestinal tract by type I and III interferons
Kalugotla, G., Marmerstein, V., & Baldridge, M. T. (2024) · Current Opinion in Immunology · doi:10.1016/j.coi.2024.102425 · Cited by 6
Development of a label-free photoelectrochemical immunosensor for novel astrovirus detection
Shen, Q., Qian, L., Chen, Y., Bao, Y., Wang, J., Wang, X., Liu, Y., Yang, S., Ji, L., Shan, T., et al. (2024) · Microchimica Acta · doi:10.1007/s00604-024-06514-x · Cited by 6
Xu, J., Yin, L., Guo, Y., Yan, Z., Yu, S., Jiang, T., Liao, X., Lin, W., & Chen, F. (2024) · Poultry Science · doi:10.1016/j.psj.2024.104076 · Cited by 6
Pathogenesis of murine astrovirus in experimentally infected mice
Morita, H., Yasuda, M., Yamamoto, M., Tomiyama, Y., Uchida, R., Ka, Y., Ogura, T., Kawai, K., Suemizu, H., & Hayashimoto, N. (2021) · EXPERIMENTAL ANIMALS · doi:10.1538/expanim.20-0162 · Cited by 6
Schultz‐Cherry, S. (2014) · Elsevier eBooks · doi:10.1016/b978-0-12-801238-3.02539-3 · Cited by 6
Self-citationLeshem, E., & Lopman, B. A. (2022) · Elsevier eBooks · doi:10.1016/b978-0-323-75608-2.00056-2 · Cited by 6
A molecular survey, whole genome sequencing and phylogenetic analysis of astroviruses from roe deer
Jamnikar-Ciglenečki, U., Civnik, V., Kirbis, A., & Kuhar, U. (2020) · BMC Veterinary Research · doi:10.1186/s12917-020-02289-4 · Cited by 6
An outbreak of neonatal enteritis in buffalo calves associated with astrovirus
Capozza, P., Martella, V., Lanave, G., Catella, C., Diakoudi, G., Beikpour, F., Camero, M., Martino, B. D., Fusco, G., Balestrieri, A., et al. (2021) · Journal of Veterinary Science · doi:10.4142/jvs.2021.22.e84 · Cited by 6
“Recent discoveries of new AstVs and genetic and evolutionary studies have suggested their potential ability to cross species barriers and eventually adapt to new host species [11,28].”
BackgroundInfluentialWang, J., Xu, C., Zeng, M., & Tang, C. (2022) · Microbiology Spectrum · doi:10.1128/spectrum.01218-22 · Cited by 6
Diversity and Genetic Characteristics of Astroviruses from Animals in Yunnan Province
Xingyu, H., Zhou, J., Hou, Y., Wang, R., Li, Q., Wang, Y., RuiLing, Y., Chen, P., Wang, B., & Xia, X. (2022) · Viruses · doi:10.3390/v14102234 · Cited by 6
“In the past half of the century, AstVs have caused severe epidemic diseases in many different hosts [11].”
BackgroundQureshi, M. I., Worthington, B. M., Liu, Y., Cheung, W. Y.-M., Su, S., Zheng, Z., Li, L., Lam, T. T., Guan, Y., & Zhu, H. (2023) · Virus Evolution · doi:10.1093/ve/veac125 · Cited by 6
Metadata
- Authors
- De Benedictis, P., Schultz-Cherry, S., Burnham, A., & Cattoli, G.
- Affiliations
- St. Jude Children's Research Hospital (US)
- Istituto Zooprofilattico Sperimentale delle Venezie (IT)
- Corresponding author
- Cattoli, Giovanni
- Venue
- Infection, Genetics and Evolution
- Publisher
- Elsevier BV
- Published
- 2011-10
- Volume
- 11
- Issue
- 7
- Pages
- 1529-1544
- ISSN
- 1567-1348 (ISSN-L)
- PMC
- PMC7185765
- OpenAlex
- W1980783855
- Cited by
- 479
- References
- 178
- Citations by year
- 2026: 27 · 2025: 35 · 2024: 35 · 2023: 38 · 2022: 33 · 2021: 50 · 2020: 41 · 2019: 32 · 2018: 37 · 2017: 31 · 2016: 33 · 2015: 32 · 2014: 19 · 2013: 19 · 2012: 15
- FWCI
- 2.11
- Type
- journal article
- Language
- en
- Open access
- green
- www.ncbi.nlm.nih.gov
- Locations
- Infection Genetics and Evolution (publishedVersion)
- PubMed Central (publishedVersion)
- PubMed (publishedVersion)
- Topics
- Health Sciences › Medicine › Infectious Diseases › Viral gastroenteritis research and epidemiology
- Life Sciences › Agricultural and Biological Sciences › Animal Science and Zoology › Animal Virus Infections Studies
- Health Sciences › Medicine › Public Health, Environmental and Occupational Health › Zoonotic diseases and public health
- Keywords
- astrovirus, Astroviridae, human astrovirus, gastroenteritis, genetic diversity, viral recombination, interspecies transmission, zoonotic potential, antigenic variation, molecular biology
- MeSH terms
- Animals, Base Sequence, DNA, Viral, Humans, Phylogeny, Species Specificity, Genetic Variation, Zoonoses, Astroviridae, Astroviridae Infections
About these checks
Registry, retraction, Cites and statistics results are computed, not judged, with one exception: a printed reference that no index lists is read once by a model before it counts as a citation error. Claims are extracted by a model and kept only when their quote appears verbatim in the text; each cited source is then checked, with a model’s help, for whether it says what the claim relies on. Those verdicts can be wrong — read the claim’s quote and the cited source before relying on one.
Statistics and arithmetic are recomputed, not judged.
Confidence bands are shown only for fields calibrated on our annotated test set. None is calibrated yet, so no band is shown.
What counts as a claim ›How we measure confidence ›How we check this ›
Are you an author, or do you see a problem with this page? Request a review
