The DOI matches its Crossref record; 175 of the 178 references it cites were found in a registry or an index.
Astrovirus Infections in Humans and Animals—Molecular Biology, Genetic Diversity, and Interspecies Transmissions
Open accessAbstract
Astroviruses are small, non-enveloped, positive sense, single-stranded RNA viruses first identified in 1975 in children suffering from diarrhea and then described in a wide variety of animals. To date, the list of animal species susceptible to astrovirus infection has expanded to 22 animal species or families, including domestic, synantropic and wild animals, avian, and mammalian species in the terrestrial and aquatic environments. Astrovirus infections are considered among the most common cause of gastroenteritis in children, second only to rotavirus infections, but in animals their association with enteric diseases is not well documented, with the exception of turkey and mink astrovirus infection. Genetic variability has been described in almost all astrovirus species sufficiently examined infecting mammals and birds; however, antigenic variability has been demonstrated for human astroviruses but is far less investigated in animal viruses. Interestingly, there is an increasing evidence of recombination events occurring in astroviruses, which contributes to increase the genetic variability of this group of viruses. A wide variety of species infected, the evident virus genetic diversity and the occurrence of recombination events indicate or imply either cross-species transmission and subsequent virus adaptation to new hosts or the co-infection of the same host with different astroviruses. This can also favor the emergence of novel astroviruses infecting animals or with a zoonotic potential. After more than 30 years from their first description in humans, there are many exciting streams of research to be explored and intriguing questions that remain to be answered about the relatively under-studied Astroviridae family. In the present work, we will review the existing knowledge concerning astrovirus infections in humans and animals, with particular focus on the molecular biology, interspecies transmission and zoonotic potential of this group of viruses.
Overview
The claims and statistics of this paper haven’t been checked yet.
Run the check — free, no account needed. It reads the open-access text and checks the sources it cites.
Integrity signals
Registry
Cites
Statistics
Verification
Claims the paper makes
The claims and statistics of this paper haven’t been checked yet.
Run the check — free, no account needed. It reads the open-access text and checks the sources it cites.
Claims other papers make about this one
Each is checked against this paper’s own text: does it say what the citing paper says it does?
The source backs part of the claim, not all of it — or backs it for a different population, condition or comparison.
In the citing paper
“Astroviruses have a broad host range (Donato and Vijaykrishna 2017) and are frequently detected in the faeces of mammals, birds, and humans with gastroenteritis (Finkbeiner et al. 2009; De Benedictis et al. 2011).”
From Red fox viromes in urban and rural landscapes (2020) · cites this paper as De Benedictis et al. 2011
Experimental — accuracy not yet measured
Self-check
Percentages, sums and reported differences re-computed from the paper’s own numbers.
The self-check needs the paper’s full text.
Citations
Cites
The alphaviruses: gene expression, replication, and evolution.
Strauss, J. H., & Strauss, E. G. (1994) · Microbiological Reviews · doi:10.1128/mmbr.58.3.491-562.1994 · Cited by 2,221
Virus Taxonomy: VIIIth Report of the International Committee on Taxonomy of Viruses.
Fauquet, C., Mayo, M. A., Maniloff, J., Desselberger, U., & Ball, L. A. (2005) · Cited by 798
28 nm PARTICLES IN FÆCES IN INFANTILE GASTROENTERITIS
Madeley, C. R., & Cosgrove, B. (1975) · The Lancet · doi:10.1016/s0140-6736(75)90858-2 · Cited by 385 · cited 1×
“Astroviruses are small, non-enveloped RNA viruses first identified in 1975 by electron microscopy (EM) in children suffering from diarrhea (Appleton and Higgins, 1975; Madeley and Cosgrove, 1975b; Matsui and Greenberg, 1996).”
BackgroundTyping of human astroviruses from clinical isolates by enzyme immunoassay and nucleotide sequencing
Noel, J. S., Lee, T. W., Kurtz, J. B., Glass, R. I., & Monroe, S. S. (1995) · Journal of Clinical Microbiology · doi:10.1128/jcm.33.4.797-801.1995 · Cited by 379 · cited 1×
“In several cases these genotypes were detected and initially differentiated using a set of conserved primers to the ORF1b termed Mon269 (50 CAACTCAGGAAACAGGGTGT) and Mon270 (50 TCAGATGCATTGTCATTGGT) (Noel et al., 1995).”
BackgroundMetagenomic Analysis of Human Diarrhea: Viral Detection and Discovery
Finkbeiner, S. R., Allred, A. F., Tarr, P. I., Klein, E. J., Kirkwood, C. D., & Wang, D. (2008) · PLoS Pathogens · doi:10.1371/journal.ppat.1000011 · Cited by 361 · cited 3×
“They termed the virus MLB1 (AstV-MLB1) and went onto characterize the genome, demonstrating that AstV-MLB1 was highly divergent from any of the known astroviruses (Finkbeiner et al., 2008b).”
BackgroundMethodAstrovirus Encephalitis in Boy with X-linked Agammaglobulinemia
Quan, P.-L., Wagner, T. A., Briese, T., Torgerson, T., Hornig, M., Tashmukhamedova, A., Firth, C., Palacios, G., Baisre-De-Leon, A., Paddock, C., et al. (2010) · Emerging Infectious Diseases · doi:10.3201/eid1606.091536 · Cited by 332 · cited 10×
“HastV-PS is also genetically related to AstV-VA1 (Finkbeiner et al., 2009b) and to a lesser extent to MiAstVs and OAstVs, thus falling within the proposed genocluster GII of Mamastroviruses (Bosch et al., 2010b; Quan et al., 2010) .”
BackgroundInfluentialVIRUSES AND GASTROENTERITIS IN INFANTS
Appleton, H., & Higgins, P. G. (1975) · The Lancet · doi:10.1016/s0140-6736(75)92581-7 · Cited by 307 · cited 1×
“Astroviruses are small, non-enveloped RNA viruses first identified in 1975 by electron microscopy (EM) in children suffering from diarrhea (Appleton and Higgins, 1975; Madeley and Cosgrove, 1975b; Matsui and Greenberg, 1996).”
BackgroundNovel Astroviruses in Insectivorous Bats
Chu, D. K. W., Poon, L. L. M., Guan, Y., & Peiris, M. J. S. (2008) · Journal of Virology · doi:10.1128/jvi.00857-08 · Cited by 292 · cited 15×
“Astroviruses do not easily grow in laboratory host systems and for this reason serological classification is difficult and is generally speculated based on percentage of nucleotide and amino acid similarity of the ORF2 encoding for the capsid protein (Chu et al., 2008; Koci et al., 2000; Reuter et al., 2011).”
BackgroundMethodResultInfluentialAhlquist, P. (2006) · Nature Reviews Microbiology · doi:10.1038/nrmicro1389 · Cited by 285 · cited 2×
“The transmembrane domains may localize nsp1a/2 to the endoplasmic reticulum (ER) membrane to facilitate replication (Guix et al., 2004) similar to other positivestrand RNA viruses (Ahlquist, 2006; Geigenmuller et al., 2002; Guix et al., 2004, 2005; Kiang and Matsui, 2002; Speroni et al., 2009).”
BackgroundIsolation of Small Viruses Resembling Astroviruses and Caliciviruses from Acute Enteritis Of Calves
Woode, G. N., & Bridger, J. C. (1978) · Journal of Medical Microbiology · doi:10.1099/00222615-11-4-441 · Cited by 262 · cited 3×
“The first isolate of bovine astrovirus was reported in England in 1978 (Woode and Bridger, 1978).”
Background
Flagged first, then by citations
3 of the 178 references couldn’t be matched to a known paper.
Research works printed but not linked: 2
- Henriksen, 1987, En oversigt over syndromet “Fedtede hvalpe” hos mink (A review of “sticky kit” syndrome in mink), Dansk. VetTidskr, 70, 580
- Svennekjaer, 1954, Minksyngdomme og aktuelle problemer i minkavlen (Mink diseases and current problems in mink farming), Dansk. Pelsdyravl., 12, 384
Cited by
Sorted by citations
Items 301–400 of 484
Li, H., Zhu, Y., Wan, C., Wang, Z., Liu, L., Tan, M., Zhang, F., Zeng, Y., Huang, J., Wu, C., et al. (2023) · BMC Veterinary Research · doi:10.1186/s12917-023-03790-2 · Cited by 6
Bidokhti, M., Ullman, K., Jensen, T. H., Chriel, M., Mottahedin, A., Munir, M., Andersson, A. M., Detournay, O., Hammer, A., & Baule, C. (2013) · PLoS ONE · doi:10.1371/journal.pone.0082978 · Cited by 8
Leong, R., Hoarau, A. O. G., Carcauzon, V., Köster, M., Dietrich, M., Tortosa, P., & Lebarbenchon, C. (2025) · Journal of Virology · doi:10.1128/jvi.01357-24 · Cited by 5
“Astroviruses have also been identified in numerous livestock, including chickens, ducks, pigs, and cows (8), and in wild animals, such as bats (10) and birds (11).”
Virome diversity and potential sharing of wild mammals in a biodiversity hotspot, Yunnan, China
Guo, Y., Su, C., Liang, H., Jiang, X., Yang, R., Ye, J., Gillespie, T. R., Gao, Z., & Xu, L. (2025) · Virology Journal · doi:10.1186/s12985-025-02702-0 · Cited by 5
“The family Astroviridae comprise non-enveloped, positive sense, single-stranded RNA viruses, which have been classified into two genera, namely Mamastrovi-ruses (MAstVs) and Avastroviruses (AAstVs) known to infect mammalian and avian species, respectively [55, 56].”
Mombo, I., Boundenga, L., Suquet, E., Ngoubangoye, B., Maganga, G., Leroy, E., Charpentier, M. J. E., & Rougeron, V. (2020) · Microbial Pathogenesis · doi:10.1016/j.micpath.2020.104659 · Cited by 4
Wang, A., Wu, Z. Q., Zhou, Q., Zhang, X., Zhu, Y., Xie, J., Feng, Q., Dong, H., Cheng, Y., Jia, W., et al. (2025) · Microbial Pathogenesis · doi:10.1016/j.micpath.2025.107324 · Cited by 5
ENTERIC VIRUSES AS CONTAMINANTS AND BIOINDICATORS IN ENVIRONMENTAL SAMPLES: A REVIEW
Fongaro, G., Silva, H. D., Elmahdy, E. M., Magri, M. E., Schissi, C. D., Moreira, M., Lanna, M. C. D. S., Silveira-Lacerda, E. D. P., & Barardi, C. R. M. (2015) · VIRUS Reviews & Research · doi:10.17525/vrrjournal.v20i2.255 · Cited by 5
Comparison of three molecular assays for detection of enteric viruses in stool samples
Moudjahed, H., Pinçon, C., Alidjinou, E. K., Dewilde, A., & Goffard, A. (2017) · Journal of Virological Methods · doi:10.1016/j.jviromet.2017.09.026 · Cited by 5
Rotaviruses, astroviruses, and sapoviruses as foodborne infections
Mattison, C. P., Vinjé, J., Parashar, U., & Hall, A. (2021) · Foodborne Infections and Intoxications · doi:10.1016/b978-0-12-819519-2.00033-5 · Cited by 4
Fang, Q., Li, M., Liu, H., Chen, K., Du, Y., Wen, C., Wei, Y., Ouyang, K., Wei, Z., Chen, Y., et al. (2021) · Frontiers in Veterinary Science · doi:10.3389/fvets.2021.692193 · Cited by 5
“AstVs have a broad range of hosts and are classified with different genotypes according to the similarity of amino acid sequence of the capsid precursor protein encoded by ORF2 (4).”
BackgroundDevelopment of a TaqMan-based real-time assay for the specific detection of canine astrovirus
Wang, Y., Cui, Y., Tong, X., Pan, Y., Guo, X., Xu, F., Li, Y.-D., & Wang, Y. (2021) · Journal of Virological Methods · doi:10.1016/j.jviromet.2021.114247 · Cited by 5
Diversity of astroviruses in wild animals in Yunnan province, China
Xingyu, H., Hou, J., Le, X., Hou, Y., Yang, L., Li, Q., Wang, B., & Xia, X. (2024) · Virology Journal · doi:10.1186/s12985-024-02314-0 · Cited by 5
Compton, S. R., Booth, C. J., & Macy, J. D. (2017) · PubMed Central · Cited by 5
Quantitative Delineation of Herpesviruses in Bats for use in Ecological StudiesPreprint
Sjodin, A. R., Willig, M. R., & Anthony, S. J. (2019) · bioRxiv (Cold Spring Harbor Laboratory) · doi:10.1101/856518 · Cited by 5
Sjodin, A. R., Anthony, S. J., Willig, M. R., & Tingley, M. W. (2020) · bioRxiv (Cold Spring Harbor Laboratory) · doi:10.1101/2020.06.29.178798 · Cited by 5
Molecular characteristics and pathogenicity of a novel chicken astrovirus variant
Bi, X., Song, Z., Meng, F., Sun, S., Du, X., Yang, M., Zhou, D., Cheng, X., Ding, L., Shi, H., et al. (2023) · Veterinary Research · doi:10.1186/s13567-023-01250-1 · Cited by 4
Molecular Epidemiology of Astroviruses
Khamrin, P., Maneekarn, N., & Ushijima, H. (2016) · Elsevier eBooks · doi:10.1016/b978-0-12-802241-2.00024-9 · Cited by 4
Zeus, V. M., Köhler, A., Reusch, C., Fischer, K., Balkema‐Buschmann, A., & Kerth, G. (2020) · Behavioral Ecology and Sociobiology · doi:10.1007/s00265-020-02932-y · Cited by 4
Genomic features of first bovine astrovirus detected in Egypt
Mansour, S. M. G., Mohamed, F. F., Abdallah, F., El-Araby, I. E., Mor, S. K., & Goyal, S. M. (2021) · VirusDisease · doi:10.1007/s13337-021-00668-5 · Cited by 4
Meta-Transcriptomic Analysis Reveals Novel RNA Viruses in Hippocampus erectus
Zhang, F., Ren, Z., Guo, X., Wang, Y., Meng, F., Shi, W., Wang, X., & Dong, X. (2023) · Viruses · doi:10.3390/v15030772 · Cited by 4
Identification of new astroviruses in synanthropic squamates
Diakoudi, G., Buonavoglia, A., Pellegrini, F., Capozza, P., Vasinioti, V. I., Cardone, R., Catella, C., Camero, M., Parisi, A., Capozzi, L., et al. (2023) · Research in Veterinary Science · doi:10.1016/j.rvsc.2023.06.009 · Cited by 4
Leveraging machine learning for taxonomic classification of emerging astroviruses
Alipour, F., Holmes, C., Lu, Y., Hill, K. A., & Lila Kari, A. (2024) · Frontiers in Molecular Biosciences · doi:10.3389/fmolb.2023.1305506 · Cited by 4
Mbou-Boutambe, C., Mombo, I. M., Rougeron, V., Degrugillier, F., Gauthier, P., Makanga, B. K., Ngoubangoye, B., Leroy, E. M., Prugnolle, F., & Boundenga, L. (2024) · Infection Genetics and Evolution · doi:10.1016/j.meegid.2024.105607 · Cited by 4
Dawson, K. L. D., Seuberlich, T., & Pesavento, P. A. (2025) · Veterinary Pathology · doi:10.1177/03009858251334347 · Cited by 4
Astroviruses and Picobirnaviruses
Dolin, R., & Treanor, J. J. (2015) · Mandell, Douglas, and Bennett's Principles and Practice of Infectious Diseases · doi:10.1016/b978-1-4557-4801-3.00179-x · Cited by 4
Nagai, M., Okabayashi, T., Akagami, M., Matsuu, A., Fujimoto, Y., Hashem, M. A., Mekata, H., Nakao, R., Matsuno, K., Katayama, Y., et al. (2020) · Infection Genetics and Evolution · doi:10.1016/j.meegid.2020.104664 · Cited by 4
Characterization and pathogenicity of a novel avian nephritis virus isolated in China
Yin, L., Zhou, Q., Huang, J., Mai, K., Yan, Z., Wei, X., Shen, H., Li, Q., Chen, L., & Zhou, Q. (2021) · Avian Pathology · doi:10.1080/03079457.2021.2006605 · Cited by 4
“Avian astroviruses, belonging to the Avastrovirus genus in the Astroviridae family, can be divided into four species: turkey astrovirus (TAstV), duck astrovirus (DAstV), chicken astrovirus (CAstV), and avian nephritis virus (ANV) (De Benedictis et al., 2011).”
BackgroundInsertion of exogenous genes within the ORF1b coding region of porcine astrovirus
Liu, T., Liao, Y., Du, Y., Dong, Q., Zhang, W., Qiao, C., Chen, Y., Ouyang, K., Wei, Z., Qin, Y., et al. (2023) · Veterinary Microbiology · doi:10.1016/j.vetmic.2023.109675 · Cited by 4
Outbreak of human astrovirus 1 lineage 1d in a childcare center in China
Hou, M., Liang, X., Tan, L., Liu, P., & Zhao, W. (2016) · Virologica Sinica · doi:10.1007/s12250-015-3701-5 · Cited by 4
Astroviruses as Foodborne Infections
Karlsson, E., & Schultz-Cherry, S. (2013) · Elsevier eBooks · doi:10.1016/b978-0-12-416041-5.00020-2 · Cited by 3
Self-citationENTERIC VIRAL ZOONOSES: COUNTERACTING THROUGH ONE HEALTH APPROACH
Verma, A., Bhat, S., Sircar, S., Dhama, K., & Malik, Y. (2018) · Journal of Experimental Biology and Agricultural Sciences · doi:10.18006/2018.6(1).42.52 · Cited by 3
Ji, J., Chen, Q., Yu, Z., Xu, X., Mu, X., Tian, X., Fu, X., Yao, L., Bi, Y., & Xie, Q. (2020) · Frontiers in Veterinary Science · doi:10.3389/fvets.2020.579432 · Cited by 4
Ortiz‐Quintero, J., Cabrera, Y., Bourdett-Stanziola, L., & Ferrera, A. (2024) · Intervirology · doi:10.1159/000540253 · Cited by 3
Wang, Z., Jiang, L., Chen, L., Cun, J., Zhou, X., Zhou, Y., Gu, W., & Cao, Y. (2025) · BMC Infectious Diseases · doi:10.1186/s12879-025-10708-w · Cited by 3
Molecular detection and identification of goose astrovirus in GuangDong Province, China
Liu, H., Sun, R., Wu, Y., Feng, J., Fan, G., Chen, S., & Li, L. (2025) · Infection Genetics and Evolution · doi:10.1016/j.meegid.2025.105745 · Cited by 3
Dong, Q., Luo, Y., Pan, Y., Liu, Y., Qin, L., Ouyang, K., Chen, Y., Wei, Z., Qin, Y., & Huang, W. (2025) · Veterinary Microbiology · doi:10.1016/j.vetmic.2025.110530 · Cited by 3
Thaw, Y. N., Charoenkul, K., Nasamran, C., Chamsai, E., Jairak, W., Phyu, E. M., Phyu, H. W., Chaiyawong, S., & Amonsin, A. (2025) · Scientific Reports · doi:10.1038/s41598-025-03037-0 · Cited by 3
Mehtani, R., Kumar, P., Minhas, S. K., Panghal, R., Lather, A., Kumar, R. R., Singh, P. K., Sheoran, D., Gupta, A., Chhabra, R., et al. (2025) · Archives of Virology · doi:10.1007/s00705-025-06385-4 · Cited by 3
“Bovine astrovirus (BoAstV) is a member of the family Astroviridae , which consists of two genera– Mamastrovi-rus and Avastrovirus – whose members infect mammalian and avian species, respectively [1].”
Whole genome sequencing and molecular characterization of porcine astrovirus from Haryana, India
Panghal, R., Kumar, P., Minhas, S. K., Mehtani, R., Kalonia, S., Sheoran, D., Kumar, P., Gupta, A. K., Chhabra, R., & Jindal, N. (2025) · Infection Genetics and Evolution · doi:10.1016/j.meegid.2025.105816 · Cited by 3
Bengert, B., Mehri, S., Holliday, M., & Lennemann, N. J. (2025) · PLoS Pathogens · doi:10.1371/journal.ppat.1013538 · Cited by 3
Haq, I. U., Ullah, N., Rahiyab, M., Sartaj, R., Khan, I., Ali, S. S., Akbar, F., & Iqbal, A. (2025) · In Silico Pharmacology · doi:10.1007/s40203-025-00428-z · Cited by 3
“This is because molecular research has shown a broader variety of HAstV s (Bosch et al. 2014; De Benedictis et al. 2011).”
Comparison of gut viral communities between autism spectrum disorder and healthy children
Yuan, M., Wang, Q., Lu, Y., Xu, P., Pan, C., Zhang, W., & Lu, H. (2025) · Frontiers in Cellular and Infection Microbiology · doi:10.3389/fcimb.2025.1660970 · Cited by 4
Kumar, P., Panghal, R., Minhas, S. K., Yadav, R., Mehtani, R., Kumar, V., Lather, A., Raj, S., Wani, M., Kattoor, J. J., et al. (2026) · Archives of Virology · doi:10.1007/s00705-026-06535-2 · Cited by 3
Insertion of Exogenous Genes within the ORF1a Coding Region of Porcine Astrovirus
Du, Y., Liu, T., Qin, Y., Dong, Q., Chen, Y., Ouyang, K., Wei, Z., & Huang, W. (2021) · Viruses · doi:10.3390/v13112119 · Cited by 3
“ORF1a is situated at the 5′ end of the genome and encodes a nonstructural polyprotein, nsP1a, which can be proteolytically cleaved into serine proteases; a viral genome-linked protein (VPg); and other uncharacterized proteins [4,5].”
BackgroundIdentification of viral protease-dependent cleavage sites within the human astrovirus polyprotein
Mehri, S., Bengert, B., Holliday, M., Corliss, L., Prevelige, P., & Lennemann, N. J. (2024) · Journal of Virology · doi:10.1128/jvi.01321-24 · Cited by 3
Wang, A., Liu, L., Zhou, Q., Zhang, X., Wu, Z., & Zhu, S. (2025) · Poultry Science · doi:10.1016/j.psj.2025.105674 · Cited by 3
Ibrahim, C., Hammami, S., & Hassen, A. (2019) · Elsevier eBooks · doi:10.1016/b978-0-12-819400-3.00020-x · Cited by 3
Dong, G., Wang, Q., Niu, J., Cai, Y., Guo, Y., Zhao, H., Zhang, S., Wang, K., Hu, G., & Yi, S. (2021) · Molecular and Cellular Probes · doi:10.1016/j.mcp.2021.101729 · Cited by 3
RT-qPCR assay for detection of mink astrovirus in outbreaks of diarrhea on Danish mink farms
Barsøe, S., Ullman, K., Leijon, M., Hedlund, K. O., Klingström, J., Krarup, L., Andresen, L. O., Quaade, M. L., & Hammer, A. S. (2021) · PLoS ONE · doi:10.1371/journal.pone.0252022 · Cited by 3
“Astrovirus are small (28–30 nm) non-enveloped positive stranded RNA viruses known from other species where it, either as a primary agent or a co-factor, is associated with neonatal diarrhea [9, 10].”
BackgroundHamad, A. Y., Mohammed, N., & Hasan, A.-R. S. (2022) · Journal of Pharmaceutical Negative Results · doi:10.47750/pnr.2022.13.s01.42 · Cited by 3
“Probably one reason behind the thigh detection rates of HAVs in sewage water is the high genetic diversity of Astrovirus potentiating infection of a large spectrum of mammals and birds (De Benedictis et al., 2011).”
BackgroundLemos, E. R. S. D., Villar, L. M., Leon, L. A. A., Guimarães, M. L., Teixeira, S. L. M., & Paula, V. S. D. (2023) · Editora FIOCRUZ eBooks · doi:10.7476/9786557082119 · Cited by 4
Li, Y., Luo, J., Zhang, F., Shang, J., Deng, C., Feng, Y., Meng, G., Jiang, W., Yu, X., Liu, G., et al. (2024) · Frontiers in Microbiology · doi:10.3389/fmicb.2024.1328243 · Cited by 3
Fadhil, H. Y. (2020) · IRAQI JOURNAL OF AGRICULTURAL SCIENCES · doi:10.36103/ijas.v51ispecial.897 · Cited by 3
Novel enteric viruses in fatal enteritis of grey squirrels.
Dastjerdi, A., Benfield, C., Everest, D., Stidworthy, M., & Zell, R. (2020) · Journal of General Virology · doi:10.1099/jgv.0.001431 · Cited by 2
Yildirim, I. B., & Knackstedt, E. D. (2020) · Elsevier eBooks · doi:10.1016/b978-0-323-64198-2.00042-7 · Cited by 2
Structure and Antigenicity of the Porcine Astrovirus 4 Capsid Spike
Haley, D. J., Lanning, S., Henricson, K. E., Mardirossian, A., Cirillo, I., Rahe, M. C., & DuBois, R. M. (2024) · Viruses · doi:10.3390/v16101596 · Cited by 2
“Multiple studies have connected PoAstV to a range of disease manifestations, with the virus frequently detected in the feces of pigs displaying diarrheal symptoms as well as asymptomatic pigs [7,17,21].”
BackgroundInfluentialScreening and identification of protein interacting with goose astrovirus
Qian, L., Liu, Y., Wang, X., Yang, S., Ji, L., Sun, X., Wang, J., Shan, T., Zhang, W., & Shen, Q. (2025) · Frontiers in Cellular and Infection Microbiology · doi:10.3389/fcimb.2025.1595736 · Cited by 2
“…infects humans but also a broad spectrum of mammals and birds, exhibiting a propensity for genetic mutation and recombination, thereby demonstrating interspecies transmission capabilities and causing an array of diseases (De Benedictis et al., 2011; Pantin-Jackwood et al., 2011; Kang et al., 2012).”
Paoli, J. E., Thongthum, T., Bassett, M., Beardsley, J., Tagliamonte, M. S., Cash, M. N., Newman, J. F. E., Smith, L. M., Anderson, B. D., Salemi, M., et al. (2025) · Microorganisms · doi:10.3390/microorganisms13112625 · Cited by 2
“Although we cannot determine whether the bats with evidence of AlphaCoV and AstV infection were sick, previous reports of AlphaCoV [88–90] and AstV [74,91] in bats did not describe clinical signs of disease, consistent with the asymptomatic presentation commonly observed in reservoir hosts [92–94].”
Lapshina, V. K., Guskova, N. I., Стеценко, И. Ф., Luong, T. M., Tran, T. V., Дмитриевна, М. А., Shipulin, G. A., Yudin, S. M., & Skvortsova, V. I. (2025) · Viruses · doi:10.3390/v17121532 · Cited by 2
Raji, A. A., Ideris, A., Bejo, M. H., & Omar, A. R. (2022) · Pertanika journal of science & technology · doi:10.47836/pjst.30.2.43 · Cited by 2
Genetic diversity of astroviruses detected in wild aquatic birds in Hong Kong
Ng, D. Y. M., Sun, W., Sit, T. H. C., Brackman, C. J., Tse, A. C. N., Bui, C. H. T., Tang, A. W., Wong, A. N. C., Tsang, A. T. L., Koo, J. C. T., et al. (2024) · Virology Journal · doi:10.1186/s12985-024-02423-w · Cited by 2
Shi, K., He, M., Long, F., He, J., Yin, Y., Feng, S., & Li, Z. (2024) · Microbiology Research · doi:10.3390/microbiolres15040143 · Cited by 2
“A high number of infected species increases the likelihood of the virus spreading across hosts, leading to the emergence of new astroviruses that infect animals or have zoonotic potential [49].”
Wang, Y., Guo, X., Chang, S., Zhao, L., Li, A., Liu, X.-B., Ma, H., & Li, Y.-D. (2024) · International Journal of Biological Macromolecules · doi:10.1016/j.ijbiomac.2024.137366 · Cited by 2
Guo, K., Li, L., Zhang, Q., Yu, J., & Yan, Y. (2019) · Evolutionary Bioinformatics · doi:10.1177/1176934319864922 · Cited by 2
Xia, J.-Y., Liao, J.-Y., Liu, C.-X., Xiong, W.-J., & Xiao, C. (2023) · Archives of Virology · doi:10.1007/s00705-022-05659-5 · Cited by 2
Production of polyclonal antibody to a recombinant non-structural protein Nsp1a of human astrovirus.
Liu, C., Liu, W.-H., Kan, L.-L., Li, X., Li, Y.-G., & Zhao, W. (2014) · Journal of Virological Methods · doi:10.1016/j.jviromet.2014.09.007 · Cited by 3
Astrovirus Replication and Reverse Genetics
Arias, C. F., López, T., & Murillo, A. (2016) · Elsevier eBooks · doi:10.1016/b978-0-12-802241-2.00023-7 · Cited by 2
Leshem, E., & Lopman, B. A. (2017) · Elsevier eBooks · doi:10.1016/b978-0-323-40181-4.00056-6 · Cited by 2
“HAstV genotype 1 is most commonly detected, followed by types 2 to 5; however, more than a single serotype usually circulates in communities during each season.(23) Non–type 1 viruses can predominate in a season, and greater serotype diversity can be found in developing countries.”
The origin and past demography of murine astrovirus 1 in laboratory mice
Su, C.-M., Cheng, Y.-C., Wang, H., Hsieh, C., & Wan, C. (2020) · Journal of General Virology · doi:10.1099/jgv.0.001520 · Cited by 2
Zhao, W., Tao, X.-L., Liu, N.-Q., Lu, H., Zheng, C.-H., Li, X.-Y., Yu, M., & Li, Y.-G. (2019) · Journal of General Virology · doi:10.1099/jgv.0.001231 · Cited by 2
RetractedBacterial, Viral, and Toxic Causes of Diarrhea, Gastroenteritis, and Anorectal Infections
Cohen, M. B. (2015) · Wiley eBooks · doi:10.1002/9781118512074.ch62 · Cited by 2
Reuter, G., & Knowles, N. (2019) · Diseases of Swine · doi:10.1002/9781119350927.ch27
Astroviruses; Pathogenesis and Diagnosis: A Review
Piryaei, M. R., Bagheri, S., Riahi, A., & Razmyar, J. (2023) · Journal of Poultry Sciences and Avian Diseases · doi:10.61838/kman.jpsad.1.3.1 · Cited by 1
Eröksüz, Y., Timurkan, M. Ö., Shams, F., Seuberlich, T., Karabulut, B., İncili, C. A., Kara, E., & Eröksüz, H. (2024) · Veterinary Medicine and Science · doi:10.1002/vms3.1499 · Cited by 1
“Within the Astroviridae family, there are two genera: Mamastrovirus ,comprisingvirusesthatpredominantlyinfectmammals, and Avastrovirus , comprising viruses that are found in avian species (De Benedictis et al., 2011).”
BackgroundAstroviruses: Overview and Emerging Disease
Manglic, S., Mavi, A. K., Kumar, N., Singh, D. K., Kumar, U., Nayak, A., & Garima, G. (2024) · Springer eBooks · doi:10.1007/978-981-97-4480-0_12 · Cited by 1
Conserved spike protein in Avastroviruses: A potential factor in cross-species transmission
Wang, Y., Li, A., Ma, H., Lan, Y., Wang, J., Wang, X., Zhao, L., Wu, Q., & Guo, X. (2025) · Poultry Science · doi:10.1016/j.psj.2025.104988 · Cited by 1
“A particular region of ORF2, known as the spike domain located at its C-terminal, has garnered attention due to its critical role in mediating virus entry into host cells (De Benedictis et al., 2011).”
Pankovics, P., Takáts, K., Urban, P. P., Mátics, R., Reuter, G., & Boros, Á. (2025) · PLoS ONE · doi:10.1371/journal.pone.0317400 · Cited by 1
Isolation and preliminary pathogenicity of a recent feline astrovirus strain in China
Wang, W., Zhang, Y., Wang, X.-X., Zhu, X., Gong, L., Jing, Z., Meng, T., Shen, J., Tan, Y.-P., Qin, T., et al. (2025) · Frontiers in Veterinary Science · doi:10.3389/fvets.2025.1614686 · Cited by 2
El-mayet, F. S., Moharam, I., El-Nahas, E. M., El-Habbaa, A. S., Najar, F. Z., Stayton, E., El-Nagar, E. M. S., Radi, M., Khalil, N. W., & Abaza, M. (2025) · Avian Pathology · doi:10.1080/03079457.2025.2581279 · Cited by 1
“Meanwhile, ORF2 encodes the capsid protein, which determines the antigenic structure, immunological recognition, and infectivity of the virus (De Benedictis et al ., 2011).”
Li, J., Baumgartner, W. A., & Wang, L. (2026) · Viruses · doi:10.3390/v18010120 · Cited by 1
Panghal, R., Kumar, P., Minhas, S. K., Yadav, R., Mehtani, R., Sheoran, D., Kalonia, S., Gupta, A. K., Singh, M. K. N. R., Chhabra, R., et al. (2026) · Tropical Animal Health and Production · doi:10.1007/s11250-026-04875-4 · Cited by 1
Meng, F.-R., Li, R., Ding, L.-Y., Wang, Z., Liu, X., Song, Y.-C., Lang, F., Yang, L.-Y., & Cheng, Z.-Q. (2026) · Veterinary Research · doi:10.1186/s13567-025-01667-w
“In recent years, reports of cross-species transmission have demonstrated the potential of AstV to adapt to new hosts, highlighting its importance in both public health and veterinary medicine [3, 4].”
Evolutionary and phylogenetic insights from global canine astrovirus genomes
Qiu, Y., Lai, L., Wang, M., Yuan, H., Wu, J., Wang, P., & Li, M. (2026) · Archives of Virology · doi:10.1007/s00705-026-06620-6 · Cited by 1
Kitashin, I., & Nakagawa, K. (2026) · Archives of Virology · doi:10.1007/s00705-026-06650-0 · Cited by 1
Genetic diversity and pathogenicity of goose astrovirus genotype 2 in geese, ducks and chickens
Liu, L., Xu, H., Xie, Y., Li, W., Guan, M., Wang, M. Q., Yang, X., Liu, M., Li, Z., Ren, A., et al. (2026) · Poultry Science · doi:10.1016/j.psj.2026.107320 · Cited by 1
Shayo, M. J., Kuchaka, D. J., Beti, M., Kimu, P., Wadugu, B. D., Jensen, E. E. B., Kumburu, H. H., Kazyoba, P., Ali, M., Clausen, P. T. L. C., et al. (2026) · Virology · doi:10.1016/j.virol.2026.111024 · Cited by 1
Detection and molecular characterization of astro and bocaviruses in dogs in Minnesota
Sobhy, N. M., Armién, A. G., Pilot, J., Singh, V. K., Padhi, S. K., Muldoon, D. M., Goyal, S. M., & Mor, S. K. (2021) · Comparative Immunology Microbiology and Infectious Diseases · doi:10.1016/j.cimid.2021.101740 · Cited by 1
Leshem, E., & Parashar, U. D. (2016) · ASM Press eBooks · doi:10.1128/9781555819439.ch4 · Cited by 1
Faeco-prevalence of enteric viruses in children under five in Ogun State, Nigeria; a one-year study
Ogunbiyi, T. S., Ayolabi, C. I., Olukoya, D. K., Obi, C., Ayolabi, D. I., Onabade, A. E., Olawale, E. A., & Unachukwu, A. E. (2023) · Babcock University Medical Journal · doi:10.38029/babcockuniv.med.j..v6i2.258 · Cited by 1
“Human astrovirus infections are caused by eight closely related viral genotypes known as HAstV 1–8 (classic human astrovirus) (16).”
BackgroundFirst Report on Detection and Molecular Characterization of Astroviruses in Mongooses
Kulberg, J. L., Becker, A. A. M. J., Malik, Y. S., & Ghosh, S. (2024) · Viruses · doi:10.3390/v16081269 · Cited by 1
“Although AstVs were speculated Astroviruses have been primarily associated with gastroenteritis in mammals, especially in humans, although AstVs have also been detected in the gut of apparently healthy animals [1–3,16 ].”
BackgroundMethodInfluentialProspects for the use of viral proteins for the construction of chimeric toxins
Новиков, Д. В., Vasilchikova, E. A., & Vasilchikov, P. I. (2024) · Archives of Virology · doi:10.1007/s00705-024-06139-8 · Cited by 1
Astrovirus infection in animals (literature review)
Mishchenko, V. A., Mischenko, A. V., Борисовна, Н. Т., & Petrova, O. N. (2024) · Veterinary Science Today · doi:10.29326/2304-196x-2024-13-4-322-329 · Cited by 1
Shaheen, M. N. F., Ahmed, N. I., & Elmahdy, E. M. (2025) · Journal of Water and Health · doi:10.2166/wh.2025.324 · Cited by 1
Murine astrovirus infection course and antibody response in different mouse strains
Seib, J., Höfler, D., Hornetz, L., Ohl, N., Götz, K., Vogel, K. A., Butt, J., & Schmidt, K. (2025) · Lab Animal · doi:10.1038/s41684-025-01573-w · Cited by 1
“As a result of advances in next-generation sequencing and pathogen discovery, astro-viruses have also been isolated from a large and still growing variety of animal species 7–9 .”
Williams, H. G., Cook, K. A., Lawler, P. E., Archer, L. L., Schaedel, K. E., Isaza, N. M., & Wellehan, J. F. X. (2018) · Journal of Veterinary Diagnostic Investigation · doi:10.1177/1040638717753963 · Cited by 1
“Since that time, astroviruses have been found in numerous other mammalian and avian species, thus prompting further classification into 2 genera: Avastrovirus and Mamastrovirus, found within avian and mammalian hosts, respectively.(6) The best known clinical manifestation of astroviral infection in mammals is diarrhea…”
BackgroundTaweel, A. E., Kandeil, A., Barakat, A., Faroq, O. E., Kayali, G., & Ali, M. A. (2020) · Novel Research in Microbiology Journal · doi:10.21608/nrmj.2020.73445 · Cited by 1
“The lengths of the ORFs are variable, depending on the species tropism of the virus, the virus subtype, and whether the virus has been adapted for cell culture (Willcocks et al., 1994; De Benedictis et al., 2011; Medici et al., 2014).”
BackgroundFilho, A. F. D. S., Bernabé, M., Coelho, E. C., Binda, R. M., de Oliveira, S. F. C., Moscon, L. A., Cota, J. M., & Pereira, C. M. (2020) · PubVet · doi:10.31533/pubvet.v14n8a635.1-4 · Cited by 1
“Os vírus representam de 40% a 60% dos diagnósticos de gastroenterite nessa espécie em diversos estudos (Alves et al., 2018; Decaro et al., 2011; Mendes et al., 2011).”
BackgroundAlles neu?! – Typische und untypische Infektionserreger beim Kaninchen
Liebscher, J., & Hein, J. (2021) · kleintier konkret · doi:10.1055/a-1348-5140 · Cited by 1
“Bei Kindern ist die AstrovirusInfektion die dritthäufigste Ursache für Durchfall nach Rotavirus-Infektionen [26,30].”
BackgroundTate, J. E. (2017) · Elsevier eBooks · doi:10.1016/b978-0-323-40181-4.00240-1 · Cited by 1
de Azevedo, L. S., França, Y., Viana, E., Medeiros, R., Morillo, S., Guiducci, R., Ribeiro, C. D., Vieira, H. R., Barrio-Nuevo, K. M., Cunha, M. S., et al. (2022) · Brazilian Journal of Microbiology · doi:10.1007/s42770-022-00859-2 · Cited by 1
Metadata
- Authors
- De Benedictis, P., Schultz-Cherry, S., Burnham, A., & Cattoli, G.
- Affiliations
- St. Jude Children's Research Hospital (US)
- Istituto Zooprofilattico Sperimentale delle Venezie (IT)
- Corresponding author
- Cattoli, Giovanni
- Venue
- Infection, Genetics and Evolution
- Publisher
- Elsevier BV
- Published
- 2011-10
- Volume
- 11
- Issue
- 7
- Pages
- 1529-1544
- ISSN
- 1567-1348 (ISSN-L)
- PMC
- PMC7185765
- OpenAlex
- W1980783855
- Cited by
- 479
- References
- 178
- Citations by year
- 2026: 27 · 2025: 35 · 2024: 35 · 2023: 38 · 2022: 33 · 2021: 50 · 2020: 41 · 2019: 32 · 2018: 37 · 2017: 31 · 2016: 33 · 2015: 32 · 2014: 19 · 2013: 19 · 2012: 15
- FWCI
- 2.11
- Type
- journal article
- Language
- en
- Open access
- green
- www.ncbi.nlm.nih.gov
- Locations
- Infection Genetics and Evolution (publishedVersion)
- PubMed Central (publishedVersion)
- PubMed (publishedVersion)
- Topics
- Health Sciences › Medicine › Infectious Diseases › Viral gastroenteritis research and epidemiology
- Life Sciences › Agricultural and Biological Sciences › Animal Science and Zoology › Animal Virus Infections Studies
- Health Sciences › Medicine › Public Health, Environmental and Occupational Health › Zoonotic diseases and public health
- Keywords
- astrovirus, Astroviridae, human astrovirus, gastroenteritis, genetic diversity, viral recombination, interspecies transmission, zoonotic potential, antigenic variation, molecular biology
- MeSH terms
- Animals, Base Sequence, DNA, Viral, Humans, Phylogeny, Species Specificity, Genetic Variation, Zoonoses, Astroviridae, Astroviridae Infections
About these checks
Registry, retraction, Cites and statistics results are computed, not judged, with one exception: a printed reference that no index lists is read once by a model before it counts as a citation error. Claims are extracted by a model and kept only when their quote appears verbatim in the text; each cited source is then checked, with a model’s help, for whether it says what the claim relies on. Those verdicts can be wrong — read the claim’s quote and the cited source before relying on one.
Statistics and arithmetic are recomputed, not judged.
Confidence bands are shown only for fields calibrated on our annotated test set. None is calibrated yet, so no band is shown.
What counts as a claim ›How we measure confidence ›How we check this ›
Are you an author, or do you see a problem with this page? Request a review
