The DOI matches its Crossref record; 175 of the 178 references it cites were found in a registry or an index.
Astrovirus Infections in Humans and Animals—Molecular Biology, Genetic Diversity, and Interspecies Transmissions
Open accessAbstract
Astroviruses are small, non-enveloped, positive sense, single-stranded RNA viruses first identified in 1975 in children suffering from diarrhea and then described in a wide variety of animals. To date, the list of animal species susceptible to astrovirus infection has expanded to 22 animal species or families, including domestic, synantropic and wild animals, avian, and mammalian species in the terrestrial and aquatic environments. Astrovirus infections are considered among the most common cause of gastroenteritis in children, second only to rotavirus infections, but in animals their association with enteric diseases is not well documented, with the exception of turkey and mink astrovirus infection. Genetic variability has been described in almost all astrovirus species sufficiently examined infecting mammals and birds; however, antigenic variability has been demonstrated for human astroviruses but is far less investigated in animal viruses. Interestingly, there is an increasing evidence of recombination events occurring in astroviruses, which contributes to increase the genetic variability of this group of viruses. A wide variety of species infected, the evident virus genetic diversity and the occurrence of recombination events indicate or imply either cross-species transmission and subsequent virus adaptation to new hosts or the co-infection of the same host with different astroviruses. This can also favor the emergence of novel astroviruses infecting animals or with a zoonotic potential. After more than 30 years from their first description in humans, there are many exciting streams of research to be explored and intriguing questions that remain to be answered about the relatively under-studied Astroviridae family. In the present work, we will review the existing knowledge concerning astrovirus infections in humans and animals, with particular focus on the molecular biology, interspecies transmission and zoonotic potential of this group of viruses.
Overview
The claims and statistics of this paper haven’t been checked yet.
Run the check — free, no account needed. It reads the open-access text and checks the sources it cites.
Integrity signals
Registry
Cites
Statistics
Verification
Claims the paper makes
The claims and statistics of this paper haven’t been checked yet.
Run the check — free, no account needed. It reads the open-access text and checks the sources it cites.
Claims other papers make about this one
Each is checked against this paper’s own text: does it say what the citing paper says it does?
The source backs part of the claim, not all of it — or backs it for a different population, condition or comparison.
In the citing paper
“Astroviruses have a broad host range (Donato and Vijaykrishna 2017) and are frequently detected in the faeces of mammals, birds, and humans with gastroenteritis (Finkbeiner et al. 2009; De Benedictis et al. 2011).”
From Red fox viromes in urban and rural landscapes (2020) · cites this paper as De Benedictis et al. 2011
Experimental — accuracy not yet measured
Self-check
Percentages, sums and reported differences re-computed from the paper’s own numbers.
The self-check needs the paper’s full text.
Citations
Cites
The alphaviruses: gene expression, replication, and evolution.
Strauss, J. H., & Strauss, E. G. (1994) · Microbiological Reviews · doi:10.1128/mmbr.58.3.491-562.1994 · Cited by 2,221
Virus Taxonomy: VIIIth Report of the International Committee on Taxonomy of Viruses.
Fauquet, C., Mayo, M. A., Maniloff, J., Desselberger, U., & Ball, L. A. (2005) · Cited by 798
28 nm PARTICLES IN FÆCES IN INFANTILE GASTROENTERITIS
Madeley, C. R., & Cosgrove, B. (1975) · The Lancet · doi:10.1016/s0140-6736(75)90858-2 · Cited by 385 · cited 1×
“Astroviruses are small, non-enveloped RNA viruses first identified in 1975 by electron microscopy (EM) in children suffering from diarrhea (Appleton and Higgins, 1975; Madeley and Cosgrove, 1975b; Matsui and Greenberg, 1996).”
BackgroundTyping of human astroviruses from clinical isolates by enzyme immunoassay and nucleotide sequencing
Noel, J. S., Lee, T. W., Kurtz, J. B., Glass, R. I., & Monroe, S. S. (1995) · Journal of Clinical Microbiology · doi:10.1128/jcm.33.4.797-801.1995 · Cited by 379 · cited 1×
“In several cases these genotypes were detected and initially differentiated using a set of conserved primers to the ORF1b termed Mon269 (50 CAACTCAGGAAACAGGGTGT) and Mon270 (50 TCAGATGCATTGTCATTGGT) (Noel et al., 1995).”
BackgroundMetagenomic Analysis of Human Diarrhea: Viral Detection and Discovery
Finkbeiner, S. R., Allred, A. F., Tarr, P. I., Klein, E. J., Kirkwood, C. D., & Wang, D. (2008) · PLoS Pathogens · doi:10.1371/journal.ppat.1000011 · Cited by 361 · cited 3×
“They termed the virus MLB1 (AstV-MLB1) and went onto characterize the genome, demonstrating that AstV-MLB1 was highly divergent from any of the known astroviruses (Finkbeiner et al., 2008b).”
BackgroundMethodAstrovirus Encephalitis in Boy with X-linked Agammaglobulinemia
Quan, P.-L., Wagner, T. A., Briese, T., Torgerson, T., Hornig, M., Tashmukhamedova, A., Firth, C., Palacios, G., Baisre-De-Leon, A., Paddock, C., et al. (2010) · Emerging Infectious Diseases · doi:10.3201/eid1606.091536 · Cited by 332 · cited 10×
“HastV-PS is also genetically related to AstV-VA1 (Finkbeiner et al., 2009b) and to a lesser extent to MiAstVs and OAstVs, thus falling within the proposed genocluster GII of Mamastroviruses (Bosch et al., 2010b; Quan et al., 2010) .”
BackgroundInfluentialVIRUSES AND GASTROENTERITIS IN INFANTS
Appleton, H., & Higgins, P. G. (1975) · The Lancet · doi:10.1016/s0140-6736(75)92581-7 · Cited by 307 · cited 1×
“Astroviruses are small, non-enveloped RNA viruses first identified in 1975 by electron microscopy (EM) in children suffering from diarrhea (Appleton and Higgins, 1975; Madeley and Cosgrove, 1975b; Matsui and Greenberg, 1996).”
BackgroundNovel Astroviruses in Insectivorous Bats
Chu, D. K. W., Poon, L. L. M., Guan, Y., & Peiris, M. J. S. (2008) · Journal of Virology · doi:10.1128/jvi.00857-08 · Cited by 292 · cited 15×
“Astroviruses do not easily grow in laboratory host systems and for this reason serological classification is difficult and is generally speculated based on percentage of nucleotide and amino acid similarity of the ORF2 encoding for the capsid protein (Chu et al., 2008; Koci et al., 2000; Reuter et al., 2011).”
BackgroundMethodResultInfluentialAhlquist, P. (2006) · Nature Reviews Microbiology · doi:10.1038/nrmicro1389 · Cited by 285 · cited 2×
“The transmembrane domains may localize nsp1a/2 to the endoplasmic reticulum (ER) membrane to facilitate replication (Guix et al., 2004) similar to other positivestrand RNA viruses (Ahlquist, 2006; Geigenmuller et al., 2002; Guix et al., 2004, 2005; Kiang and Matsui, 2002; Speroni et al., 2009).”
BackgroundIsolation of Small Viruses Resembling Astroviruses and Caliciviruses from Acute Enteritis Of Calves
Woode, G. N., & Bridger, J. C. (1978) · Journal of Medical Microbiology · doi:10.1099/00222615-11-4-441 · Cited by 262 · cited 3×
“The first isolate of bovine astrovirus was reported in England in 1978 (Woode and Bridger, 1978).”
Background
Flagged first, then by citations
3 of the 178 references couldn’t be matched to a known paper.
Research works printed but not linked: 2
- Henriksen, 1987, En oversigt over syndromet “Fedtede hvalpe” hos mink (A review of “sticky kit” syndrome in mink), Dansk. VetTidskr, 70, 580
- Svennekjaer, 1954, Minksyngdomme og aktuelle problemer i minkavlen (Mink diseases and current problems in mink farming), Dansk. Pelsdyravl., 12, 384
Cited by
Sorted by citations
Items 401–484 of 484
Red fox viromes across an urban-rural gradientPreprint
Campbell, S. J., Ashley, W., Gil-Fernández, M., Newsome, T., Giallonardo, F. D., Ortiz-Baez, A., Mahar, J., Towerton, A. L., Gillings, M., Holmes, E., et al. (2020) · bioRxiv · doi:10.1101/2020.06.15.153858 · Cited by 1
“Astroviruses have a broad host range (52) and 301 are frequently detected in the faeces of mammals, birds and humans with gastroenteritis (53, 54).”
BackgroundGenetic Polymorphism of the Mink Astrovirus Isolated in Continental EuropePreprint
Jakubczak, A., Kowalczyk, M., Mazurkiewicz, I., & Kondracki, M. (2020) · Preprints.org · doi:10.20944/preprints202009.0005.v1 · Cited by 1
Understanding Human Astrovirus from Pathogenesis to Treatment
Hargest, V. (2020) · doi:10.21007/etd.cghs.2020.0507 · Cited by 1
Cannon, J. L., Liu, L., & Kang, W. (2017) · doi:10.1002/9781119238102.ch8 · Cited by 1
Schultz‐Cherry, S. (2015) · Encyclopedia of Life Sciences · doi:10.1002/9780470015902.a0001006.pub3 · Cited by 1
Self-citationFerrando, E. C. (2022) · RiuNet (Universitat Politècnica de València) · doi:10.4995/thesis/10251/190899 · Cited by 2
Horigan, S., Kistler, A., Ranaivoson, H., Andrianianina, A., Andry, S., Kettenburg, G., Raharinosy, V., Randriambolamanantsoa, T. H., Tato, C., Lacoste, V., et al. (2023) · bioRxiv · doi:10.1101/2023.10.27.564436 · Cited by 1
First report of astroviruses in Tanzanian batsPreprint
Joffrin, L., Iliopoulou, E., Falzon, M., Sabuni, C., Kirkpatrick, L., & Bruyn, L. D. (2024) · bioRxiv (Cold Spring Harbor Laboratory) · doi:10.1101/2024.03.05.581362 · Cited by 1
“In humans, they are transmitted via the faecal-oral route and are responsible for a significant proportion of non-bacterial enteric diseases, especially in young children (37,38).”
BackgroundNear-atomic structures of human astrovirus capsids reveal a subunit-specific maturation mechanismPreprint
Hiraka, K., Burton‐Smith, R. N., Song, C., Miyamoto, K., Haga, K., Takai‐Todaka, R., Nakanishi, A., Katayama, K., & Murata, K. (2026) · bioRxiv (Cold Spring Harbor Laboratory) · doi:10.64898/2026.06.22.733877 · Cited by 1
Emerging Trend of Astroviruses, Enteric Adenoviruses, and Rotaviruses in Human Viral Gastroenteritis
Cowley, D., Donato, C., & Kirkwood, C. (2013) · doi:10.1002/9781118297469.ch27
Zhao, W., Niu, K., Liu, W., Zhao, J., Jin, Y., & Sui, T. (2013) · Archives of Virology · doi:10.1007/s00705-013-1899-9
Astroviruses as causative agents of gastroenteritis
Palombo, E. (2012) · Microbiology Australia · doi:10.1071/ma12077
Studies of Astrovirus Structure–Function Relationships
Marvin, S. A., Meliopoulos, V., & Schultz‐Cherry, S. (2016) · Elsevier eBooks · doi:10.1016/b978-0-12-802241-2.00022-5
Self-citationHepatitis E virus and other viruses occasionally reported as foodborne
Johne, R., & Albert, T. (2013) · Wageningen Academic Publishers eBooks · doi:10.3920/978-90-8686-780-6_10
Is Porcine Kobuvirus 1 a Typical Diarrhoeic Pathogen of Piglets?
McFall, H., & Vilcek, S. (2017) · Folia veterinaria · doi:10.1515/fv-2017-0018
“Similar difficulty in establishing significance is also true for other emerging viruses, including porcine sapovirus, porcine enterovirus G and porcine astrovirus, as they are also detected in healthy and diarrhoeic pigs without known clinical significance [3, 4, 5, 8].”
BackgroundPrimer design for complete sequencing of the Avastrovirus ORF2 gene
Luis Luna, E., Beserra, L. A. R., Soares, R. M., & Gregori, F. (2018) · Semina Ciências Agrárias · doi:10.5433/1679-0359.2018v39n1p411
Detection and Characterization of Avastrovirus Associated with Diarrhea Isolated from Minks in China
SunYong, N., & Tan, W. (2014)
An Outbreak of Gastroenteritis Caused by Human Astrovirus Serotype 8 in Nagano Prefecture, Japan.
Tsukada, R., Mori, K., Usuku, S., Kumazaki, M., & Yoshida, T. (2020) · Kansenshogaku zasshi · doi:10.11150/kansenshogakuzasshi.94.808
Three Novel Avastroviruses Identified in Dead Wild Crows
Zhang, C., Yang, Y., Hu, T., Zhou, H., Zhang, C., Cao, J., Li, J., Wang, P., Wong, G., Wang, X., et al. (2021) · Virologica Sinica · doi:10.1007/s12250-021-00416-5
Bowen, M. D. (2016) · ASM Press eBooks · doi:10.1128/9781555819156.ch22
Arias, C. F., & LÓPEZ, T. (2016) · ASM Press eBooks · doi:10.1128/9781555819439.ch51
Alles neu?! – Typische und untypische Infektionserreger beim Kaninchen: Teil 2
Liebscher, J., & Hein, J. (2021) · kleintier konkret · doi:10.1055/a-1534-0292
“Bei Kindern ist die AstrovirusInfektion die dritthäufigste Ursache für Durchfall nach Rotavirus-Infektionen [26,30].”
BackgroundLock, W. (1921) · The Journal of Theological Studies · doi:10.1093/jts/os-xxii.2.97
Detection of Novel Human Astrovirus MLB1 by a Commercial Viral Gastroenteritis Multiplex Assay
Ho, Y. I., Lee, C. W., & Wong, A. (2022) · Microbiology spectrum · doi:10.1128/spectrum.00469-22
Li, W., Li, X., Hu, H., Xu, J., Qian, J., Ni, P., Zhou, X., Han, J., Zhao, Y., Gong, Q., et al. (2022) · Research Square · doi:10.21203/rs.3.rs-1695916/v1
Tate, J. E., & Cardemil, C. V. (2022) · Elsevier eBooks · doi:10.1016/b978-0-323-75608-2.00240-8
PROCESSO DE INTERNACIONALIZAÇÃO DAS EMPRESAS
Pereira, F. D. A., Miranda, E. B., & Jankowitsch, J. (2023) · Editora Enterprising eBooks · doi:10.29327/5176652.1-6
GESTÃO DA QUALIDADE E O IMPACTO DE SUA APLICAÇÃO NOS SERVIÇOS PÚBLICOS
Pinheiro, W. S., & Jankowitsch, J. (2023) · Editora Enterprising eBooks · doi:10.29327/5176652.1-9
UMA ANÁLISE SOBRE O ASTROVÍRUS
da Silva, T. C., Feitosa, I. B., & Jankowitsch, J. (2023) · Editora Enterprising eBooks · doi:10.29327/5176652.1-11
TEORIA CONCEPCIONISTA PARA A AQUISIÇÃO DA PERSONALIDADE JURÍDICA NO BRASIL
Pinheiro, W. S., & Jankowitsch, J. (2023) · Editora Enterprising eBooks · doi:10.29327/5176652.1-10
Gonçalves, A. W. O., da Silva, D. J. F., de Melo, D. A. P., Araújo, G. V., Eulálio, J. P. L. N., de Paula, C. C. C., & Filho, C. Q. A. D. (2023) · Editora Enterprising eBooks · doi:10.29327/5176652.1-4
Pereira, F. D. A., Pinheiro, W. S., & Jankowitsch, J. (2023) · Editora Enterprising eBooks · doi:10.29327/5176652.1-8
A CONTRIBUIÇÃO DA NEUROPSICOPEDAGOGIA NA EDUCAÇÃO
Barasuol, F. F., & Jankowitsch, J. (2023) · Editora Enterprising eBooks · doi:10.29327/5176652.1-7
Borges, F. G. D. S., Bezerra, M. B. S., Fenelon, S. C. D. O., Araújo, L. B. L. D., Leão, D. O. A., Martins, G. D. D. S., & Galvão, G. L. A. A. (2023) · Editora Enterprising eBooks · doi:10.29327/5176652.1-1
INTELIGÊNCIA EMOCIONAL E EMPREENDEDORISMO FEMININO
Pereira, G. A., & Abrantes, D. S. D. S. (2023) · Editora Enterprising eBooks · doi:10.29327/5176652.1-5
ABORDAGEM SISTEMATIZADA DO TRAUMA TORÁCICO: REVISÃO INTEGRATIVA DE LITERATURA
Gonçalves, A. W. O., Pereira, I. F. C., Neta, V. C. M. A., Lima, M. F. C. A., Abreu, B. G. S., Filho, R. C. L. C. B., & da Silva, D. J. F. (2023) · Editora Enterprising eBooks · doi:10.29327/5176652.1-3
Leon, L. A. A., Lima, L. R. P., Lanzarini, N. M., de Almeida, N. A. A., & de Paula, V. S. (2023) · Editora FIOCRUZ eBooks · doi:10.7476/9786557082119.0008
Pork as a Source of Diverse Viral Foodborne Infections: An Escalating Issue
Szczotka-Bochniarz, A., & Kochanowski, M. (2024) · Diversity · doi:10.3390/d16110679
Stamelou, E., Papageorgiou, K. V., Papadopoulos, D., Delis, G. A., Chatzopoulos, D., Athanasakopoulou, Z., Moschidis, E., Petridou, E., & Kritas, S. K. (2025) · Pathogens · doi:10.3390/pathogens14010092
Specific Diseases and Conditions
Patricia V. Turner BSc, M., Colette L. Wheler BSc, D., Hugues Beaufrère DVM, P., Niora Fabian DVM, M., & John E. Harkness DVM, M. (2025) · doi:10.1002/9781119290506.ch5
Emerging and re-emerging viral zoonotic diseases in livestock species
Renois, F., Abrahamyan, L. G., Zhu, J., & Meurens, F. (2025) · Elsevier eBooks · doi:10.1016/b978-0-443-15976-3.00082-9
Astroviruses in animals and the environment in Africa: a review
Owusu-Ntumy, D. D., Ayim‐Akonor, M., Larbi, R. O., & Ohene-Asa, H. E. (2025) · EMI Animal & Environment · doi:10.1080/29986990.2025.2525097
Gao, J., Han, W., Jiang, X., Yuan, X., Chen, Y., Huang, S., Huang, X., Zhang, Y., Zhang, T., Zhang, M., et al. (2025) · mSystems · doi:10.1128/msystems.00756-25
“They primarily cause gastrointestinal disease (50).”
Additional file 4 of Diversity of astroviruses in wild animals in Yunnan province, China
Xingyu, H., Hou, J., Le, X., Hou, Y., Yang, L., Li, Q., Wang, B., & Xia, X. (2024) · Figshare · doi:10.6084/m9.figshare.26686311
Bi, X., Song, Z., Meng, F., Sun, S., Du, X., Yang, M., Zhou, D., Cheng, X., Ding, L., Shi, H., et al. (2024) · Figshare · doi:10.6084/m9.figshare.26651454
Bi, X., Song, Z., Meng, F., Sun, S., Du, X., Yang, M., Zhou, D., Cheng, X., Ding, L., Shi, H., et al. (2023) · Figshare · doi:10.6084/m9.figshare.24779174
Additional file 5 of Diversity of astroviruses in wild animals in Yunnan province, China
Xingyu, H., Hou, J., Le, X., Hou, Y., Yang, L., Li, Q., Wang, B., & Xia, X. (2024) · Figshare · doi:10.6084/m9.figshare.26686314
Stamelou, E., Giantsis, I. Α., Papageorgiou, K. V., Petridou, E., Davidson, I., Polizopοulou, Z. S., Papa, A., & Kritas, S. K. (2022) · Figshare · doi:10.6084/m9.figshare.18094423
Additional file 3 of Diversity of astroviruses in wild animals in Yunnan province, China
Xingyu, H., Hou, J., Le, X., Hou, Y., Yang, L., Li, Q., Wang, B., & Xia, X. (2024) · Figshare · doi:10.6084/m9.figshare.26686308
Additional file 2 of Diversity of astroviruses in wild animals in Yunnan province, China
Xingyu, H., Hou, J., Le, X., Hou, Y., Yang, L., Li, Q., Wang, B., & Xia, X. (2024) · Figshare · doi:10.6084/m9.figshare.25303189
Additional file 1 of Diversity of astroviruses in wild animals in Yunnan province, China
Xingyu, H., Hou, J., Le, X., Hou, Y., Yang, L., Li, Q., Wang, B., & Xia, X. (2024) · Figshare · doi:10.6084/m9.figshare.25303051
Bi, X., Song, Z., Meng, F., Sun, S., Du, X., Yang, M., Zhou, D., Cheng, X., Ding, L., Shi, H., et al. (2024) · Figshare · doi:10.6084/m9.figshare.26651451
Bi, X., Song, Z., Meng, F., Sun, S., Du, X., Yang, M., Zhou, D., Cheng, X., Ding, L., Shi, H., et al. (2024) · Figshare · doi:10.6084/m9.figshare.24779398
Additional file 1 of Genetic diversity of astroviruses detected in wild aquatic birds in Hong Kong
Ng, D. Y. M., Sun, W., Sit, T. H. C., Brackman, C. J., Tse, A. C. N., Bui, C. H. T., Tang, A. W., Wong, A. N. C., Tsang, A. T. L., Koo, J. C. T., et al. (2024) · Figshare · doi:10.6084/m9.figshare.26198861
Mizuno, S., Teshima, N., Yokota, T., Khin, S. T. M. M., Takemae, H., Oi, T., Fukuda, F., Masuda, T., KIKKAWA, Y., Shiga, T., et al. (2025) · Infection Genetics and Evolution · doi:10.1016/j.meegid.2025.105875
CHAUDHURİ, D., Mukherjee, D., Shenoy, A. R., & Visweswariah, S. S. (2026) · ACS Infectious Diseases · doi:10.1021/acsinfecdis.5c00788
Chen, Y., Huang, S.-Y., Zhang, S., Wang, H., Song, X.-F., Ji, L.-K., Shen, Q., Yang, S.-X., Liu, Y.-W., Wang, X.-C., et al. (2026) · Virology · doi:10.1016/j.virol.2026.110814
Geographic and cross-species transmission of Mamastroviruses from multiple hosts
Wang, Y., Wu, H., Liu, X.-B., Ma, H., Li, A., Li, Y.-D., & Guo, X. (2026) · Animal Microbiome · doi:10.1186/s42523-026-00517-0
Takada, K., Mifsud, J. C. O., Hirano, J., Harvey, E., Sadiq, S., Lang, B. J., Matsuura, Y., & Holmes, E. C. (2026) · bioRxiv (Cold Spring Harbor Laboratory) · doi:10.64898/2026.02.19.706906
Loor-Giler, A., Sanchez-Castro, C., Santander-Parra, S., Andrade-Ojeda, D., Puga-Torres, B., Mena-Pérez, R., Campos, M., Ferreira, A. P., Novo, S. G., & Núñez, L. (2026) · Viruses · doi:10.3390/v18030308
“As commonly described in astrovirus molecular studies, this marker is widely used for initial molecular typing because it is conserved and allows discrimination at the species or genogroup level, although it provides limited resolution for strain-level epidemiology [38,56].”
InfluentialGenetic characterization and structural insights of canine astroviruses circulating in South Korea
Jeong, C., Chae, S.-B., Jeoung, H.-Y., Lee, K., & Oem, J. (2026) · BMC Veterinary Research · doi:10.1186/s12917-026-05370-6
Immunofluorescence-assisted investigation of Human Astrovirus-1 in oyster processing and production
Song, H., Han, S., Lee, H., Moon, Y. I., Park, S.-H., & Ha, S. (2026) · Food Microbiology · doi:10.1016/j.fm.2026.105078
Alqahtani, S., Awadalla, M., Al-Anazi, A. E., Alhumaidy, A. A., Hanif, A., Alshehri, H. A., Alsayegh, A. A., AlQusi, F., Alshanbari, H. M., Eifan, S. A., et al. (2026) · Virus Genes · doi:10.1007/s11262-026-02225-y
El-Nagar, E. M. S., Gamal, M. A. N., El-Saied, M. A., Mousa, M. R., Selim, K. M., & Salem, H. M. (2026) · Scientific Reports · doi:10.1038/s41598-026-50596-x
“Environmental persistence of astrovirus further enhances their spread, increasing the risk of outbreaks among wild and domestic bird populations 55 .”
Experimental Porcine Astrovirus 4‐Associated Tracheitis and Bronchitis in Pigs
Stephens, J. Q., Buckley, A., Derscheid, R. J., DuBois, R. M., Haley, D. J., Ko, C., Gauger, P. C., Sitthicharoenchai, P., Groeltz-Thrush, J. M., & Rahe, M. C. (2026) · Transboundary and Emerging Diseases · doi:10.1155/tbed/2056680
Bodic, L. L., Hoarau, M., Heinrich, K., Dietrich, M., & Lebarbenchon, C. (2026) · Journal of Virology · doi:10.1128/jvi.00657-26
Wang, A., Wu, Z., Liu, L., Zhou, Q., Lu, H., Cheng, Y., Jia, W., Zhu, R., & Zhu, S. (2026) · Frontiers in Veterinary Science · doi:10.3389/fvets.2026.1897369
Xi, H., Wei, J., Wang, Z., Lin, C., Zhang, F., Wu, C., Shaopei, F., Huang, J., & Li, H. (2026) · Poultry Science · doi:10.1016/j.psj.2026.107831
Caprine astrovirus detected in conjunction with necrotizing enterocolitis in goat kids in Indiana
Burcham, G. N., Seuberlich, T., Li, G., Chan, A. S., & Dawson, K. L. D. (2026) · Journal of Veterinary Diagnostic Investigation · doi:10.1177/10406387261488858
Li, Y., Cai, C., Li, W., Wang, Y., Feng, Y., Zhu, H., Li, J., Hou, G., Liu, H., & Yu, X. (2026) · Poultry Science · doi:10.1016/j.psj.2026.107871
Human astroviruses: molecular virology
Lentz, A., López, T., Ykema, M. R., Tao, Y. J., DuBois, R. M., & Arias, C. (2026) · Microbiology and Molecular Biology Reviews · doi:10.1128/mmbr.00255-25
Viruses as a threat to food safety
Malakar, S., Singh, P., & Sutaoney, P. (2026) · Elsevier eBooks · doi:10.1016/b978-0-443-29080-0.00019-2
Lv, Y., Feng, X., Du, Y., Shao, S., Ouyang, K., Chen, Y., Wei, Z., Huang, W., & Qin, Y. (2026) · Autophagy · doi:10.1080/15548627.2026.2754684
Metadata
- Authors
- De Benedictis, P., Schultz-Cherry, S., Burnham, A., & Cattoli, G.
- Affiliations
- St. Jude Children's Research Hospital (US)
- Istituto Zooprofilattico Sperimentale delle Venezie (IT)
- Corresponding author
- Cattoli, Giovanni
- Venue
- Infection, Genetics and Evolution
- Publisher
- Elsevier BV
- Published
- 2011-10
- Volume
- 11
- Issue
- 7
- Pages
- 1529-1544
- ISSN
- 1567-1348 (ISSN-L)
- PMC
- PMC7185765
- OpenAlex
- W1980783855
- Cited by
- 479
- References
- 178
- Citations by year
- 2026: 27 · 2025: 35 · 2024: 35 · 2023: 38 · 2022: 33 · 2021: 50 · 2020: 41 · 2019: 32 · 2018: 37 · 2017: 31 · 2016: 33 · 2015: 32 · 2014: 19 · 2013: 19 · 2012: 15
- FWCI
- 2.11
- Type
- journal article
- Language
- en
- Open access
- green
- www.ncbi.nlm.nih.gov
- Locations
- Infection Genetics and Evolution (publishedVersion)
- PubMed Central (publishedVersion)
- PubMed (publishedVersion)
- Topics
- Health Sciences › Medicine › Infectious Diseases › Viral gastroenteritis research and epidemiology
- Life Sciences › Agricultural and Biological Sciences › Animal Science and Zoology › Animal Virus Infections Studies
- Health Sciences › Medicine › Public Health, Environmental and Occupational Health › Zoonotic diseases and public health
- Keywords
- astrovirus, Astroviridae, human astrovirus, gastroenteritis, genetic diversity, viral recombination, interspecies transmission, zoonotic potential, antigenic variation, molecular biology
- MeSH terms
- Animals, Base Sequence, DNA, Viral, Humans, Phylogeny, Species Specificity, Genetic Variation, Zoonoses, Astroviridae, Astroviridae Infections
About these checks
Registry, retraction, Cites and statistics results are computed, not judged, with one exception: a printed reference that no index lists is read once by a model before it counts as a citation error. Claims are extracted by a model and kept only when their quote appears verbatim in the text; each cited source is then checked, with a model’s help, for whether it says what the claim relies on. Those verdicts can be wrong — read the claim’s quote and the cited source before relying on one.
Statistics and arithmetic are recomputed, not judged.
Confidence bands are shown only for fields calibrated on our annotated test set. None is calibrated yet, so no band is shown.
What counts as a claim ›How we measure confidence ›How we check this ›
Are you an author, or do you see a problem with this page? Request a review
