Cited by 759Developmental Biology and Gene RegulationWnt/β-catenin signaling in development and cancerPluripotent Stem Cells Research

The DOI matches its Crossref record; 44 of the 44 references it cites were found in a registry or an index.

Cerberus is a head-inducing secreted factor expressed in the anterior endoderm of Spemann's organizer

Bouwmeester, Tewis, Kim, Sung-Hyun, Sasai, Yoshiki, Lu, Bin, Robertis, Eddy M. De·1996·Nature

DOI 10.1038/382595a0

Open this paper in CoChat — free account

Abstract

An abundant cDNA enriched in Spemann's organizer, cerberus, was isolated by differential screening. It encodes a secreted protein that is expressed in the anterior endomesoderm. Microinjection of cerberus mRNA into Xenopus embryos induces ectopic heads, and duplicated hearts and livers. The results suggest a role for a molecule expressed in the anterior endoderm in the induction of head structures in the vertebrate embryo.

Integrity signals

Registry

Crossref · 10.1038/382595a0

Cites

44 of 44 references verified0 citation errors · 0 not checkable

Statistics

Recomputing p-values needs the paper’s full text.

Claims the paper makes

This paper’s full text isn’t openly available, so its claims and self-check weren’t run. The registry and citation checks still apply.

Claims other papers make about this one

Each is checked against this paper’s own text: does it say what the citing paper says it does?

Appendix G: In Situ Hybridization: An Improved Whole-Mount Method for Xenopus Embryos
Harland, R. M. (1991) · Methods in cell biology · doi:10.1016/s0091-679x(08)60307-6 · Cited by 2,048
Expression cloning of noggin, a new dorsalizing factor localized to the Spemann organizer in Xenopus embryos
Smith, W. C., & Harland, R. M. (1992) · Cell · doi:10.1016/0092-8674(92)90316-5 · Cited by 1,184
Xenopus chordin: A novel dorsalizing factor activated by organizer-specific homeobox genes
Sasai, Y. (1994) · Cell · doi:10.1016/0092-8674(94)90068-x · Cited by 1,122
Self-citation
Expression of a xenopus homolog of Brachyury (T) is an immediate-early response to mesoderm induction
Smith, J. C., Price, B. M. J., Green, J. B. A., Weigel, D., & Herrmann, B. G. (1991) · Cell · doi:10.1016/0092-8674(91)90573-h · Cited by 971
Retinoic acid causes an anteroposterior transformation in the developing central nervous system
Durston, A. J., Timmermans, J. P., Hage, W. J., Hendriks, H., de Vries, N. J., Heideveld, M., & Nieuwkoop, P. D. (1989) · Nature · doi:10.1038/340140a0 · Cited by 887
Molecular nature of Spemann's organizer: the role of the Xenopus homeobox gene goosecoid
Cho, K. W. Y., Blumberg, B., Steinbeißer, H., & Robertis, E. M. D. (1991) · Cell · doi:10.1016/0092-8674(91)90288-a · Cited by 807
Self-citation
Requirement for LIml in head-organizer function
Shawlot, W., & Behringer, R. R. (1995) · Nature · doi:10.1038/374425a0 · Cited by 805
Neural Induction by the Secreted Polypeptide Noggin
Lamb, T. M., Knecht, A. K., Smith, W. C., Stachel, S. E., Economides, A. N., Stahl, N., Yancopolous, G. D., & Harland, R. M. (1993) · Science · doi:10.1126/science.8235591 · Cited by 785
A common plan for dorsoventral patterning in Bilateria
De Robertis, E. M., & Sasai, Y. (1996) · Nature · doi:10.1038/380037a0 · Cited by 780
Self-citation
Follistatin, an antagonist of activin, is expressed in the Spemann organizer and displays direct neuralizing activity
Hemmati‐Brivanlou, A., Kelly, O., & Melton, D. A. (1994) · Cell · doi:10.1016/0092-8674(94)90320-4 · Cited by 761

Flagged first, then by citations

Show all 44 references

Research works printed but not linked: 6

Spemann, H. & Mangold, H. Wilhelm Roux Arch. EntwMech. Org. 100, 599–638 (1924).
Nieuwkoop, P. D. & Florschütz, P. A. Archs Biol., Paris 61, 113–150 (1950).
Pasteels, J. Archs Biol., Paris 60, 235–250 (1949).
Hausen, P. & Riebesell, M. The Early development of Xenopus laevis (Springer, Berlin, 1991).
Sasai, Y., Lu, B., Piccolo, S. & De Robertis, E. M. EMBO J. (in the press).
Sive, H. L., Hattori, K. & Weintraub, H. Cell 58, 170–180 (1989).

Sorted by citations

Items 301–400 of 754

A role for the hypoblast (AVE) in the initiation of neural induction, independent of its ability to position the primitive streak
Albazerchi, A., & Stern, C. D. (2006) · Developmental Biology · doi:10.1016/j.ydbio.2006.08.057 · Cited by 60
“The anterior embryonic endoderm shares expression of some genes with the AVE/hypoblast (Hex: Newman et al., 1997; Thomas et al., 1998; Xblimp1: de Souza et al., 1999; Cerberus: Bouwmeester et al., 1996; Belo et al., 1997; Biben et al., 1998 and Dkk1: Glinka et al., 1998; Osada and Wright, 1999; Schneider and Mercola,…”
Background
Initiating head development in mouse embryos: integrating signalling and transcriptional activity
Arkell, R. M., & Tam, P. (2012) · Open Biology · doi:10.1098/rsob.120030 · Cited by 59
A novel function for the Xslug gene: control of dorsal mesendoderm development by repressing BMP-4
Mayor, R., Guerrero, N., Young, R., Gómez-Skármeta, J. L., & Cuellar, C. (2000) · Mechanisms of Development · doi:10.1016/s0925-4773(00)00412-3 · Cited by 60
“Antisense RNA probes were prepared from Xslug (Mayor et al., 1995), Chordin (Sasai et al., 1994), cerberus (Bouwmeester et al., 1996), Xwnt-8 (Christian et al., 1991; Smith and Harland, 1991), Xvent-1 (Gawantka et al., 1995), Xsnail (Essex et al., 1993), ADAM (Alfandari et al., 1997), and Xtwist…”
BackgroundMethod
The Mouse Cer1 (Cerberus related or homologue) Gene Is Not Required for Anterior Pattern Formation
Simpson, E. H., Johnson, D. K., Hunsicker, P. R., Suffolk, R. A., Jordan, S. A., & Jackson, I. J. (1999) · Developmental Biology · doi:10.1006/dbio.1999.9372 · Cited by 61
“The Xenopus laevis Cerberus gene was identified by differential screening of cDNA enriched in Spemann’s organiser and encodes a putative secreted protein belonging to the cysteine knot superfamily which includes TGF-b and MP proteins (Bouwmeester et al., 1996).”
Background
Evolution of the organizer and the chordate body plan
Gerhart, J. C. (2001) · The International Journal of Developmental Biology · doi:10.1387/ijdb.11291842 · Cited by 59
“The third part, the deep yolky endoderm, is the most recently found (Bouwmeester et al., 1996) and least characterized.”
Role of Goosecoid, Xnot and Wnt antagonists in the maintenance of the notochord genetic programme inXenopusgastrulae
Yasuo, H., & Lemaire, P. (2001) · Development · doi:10.1242/dev.128.19.3783 · Cited by 59
Transcription factors and head formation in vertebrates
Bally‐Cuif, L., & Boncinelli, E. (1997) · BioEssays · doi:10.1002/bies.950190207 · Cited by 58
Xenopus Zic3 controls notochord and organizer development through suppression of the Wnt/β-catenin signaling pathway
Fujimi, T. J., Hatayama, M., & Aruga, J. (2011) · Developmental Biology · doi:10.1016/j.ydbio.2011.10.026 · Cited by 60
Members of the DAN Family Are BMP Antagonists That Form Highly Stable Noncovalent Dimers
Kattamuri, C., Luedeke, D. M., Nolan, K., Rankin, S. A., Greis, K. D., Zorn, A. M., & Thompson, T. B. (2012) · Journal of Molecular Biology · doi:10.1016/j.jmb.2012.10.003 · Cited by 58
Gene profiling during neural induction inXenopus laevis:regulation of BMP signaling by post-transcriptional mechanisms and TAB3, a novel TAK1-binding protein
Muñoz-Sanjuán, I., Bell, E. J. D. H., Altmann, C. R., Vonica, A., & Brivanlou, A. H. (2002) · Development · doi:10.1242/dev.00097 · Cited by 58
“5 expression (Bouwmeester et al., 1996).”
Background
Anterior Endoderm Is Sufficient to Rescue Foregut Apoptosis and Heart Tube Morphogenesis in an Embryo Lacking Retinoic Acid
Ghatpande, S. K., Ghatpande, A., Zile, M. H., & Evans, T. (2000) · Developmental Biology · doi:10.1006/dbio.1999.9601 · Cited by 58
Axial Protocadherin Is a Mediator of Prenotochord Cell Sorting in Xenopus
Kuroda, H., Inui, M., Sugimoto, K., Hayata, T., & Asashima, M. (2002) · Developmental Biology · doi:10.1006/dbio.2002.0589 · Cited by 57
Revisions to the Xenopus gastrula fate map: Implications for mesoderm induction and patterning
Kumano, G., & Smith, W. C. (2002) · Developmental Dynamics · doi:10.1002/dvdy.10177 · Cited by 56
“There is no question that the Spemann organizer is a source of BMP-inhibiting and wnt-inhibiting factors such as noggin, follistatin, Xnr3, cerberus, and chordin (Harland, 1992; Hemmati-Brivanlou et al., 1994; Sasai et al., 1994; Smith and Smith et al., 1995; Bouwmeester et al., 1996).”
Background
TGFβ Family Signaling Pathways in Pluripotent and Teratocarcinoma Stem Cells’ Fate Decisions: Balancing Between Self-Renewal, Differentiation, and Cancer
Гордеева, О. Ф. (2019) · Cells · doi:10.3390/cells8121500 · Cited by 60
“Inhibition of Activin/Nodal/Smad2/3 signaling by follistatin or SB431542 and by overexpression of Nodal antagonists Lefty or Cerberus, leads to neuroectoderm differentiation of hESCs [111,155]; whereas treatment with Activin and Nodal, when bFGF is depleted, results in mesendoderm differentiation [111,219].”
Background
Xenopus leads the way: Frogs as a pioneering model to understand the human brain
Exner, C. R. T., & Willsey, H. R. (2020) · genesis · doi:10.1002/dvg.23405 · Cited by 57
Sequence and expression of a novel mouse gene PRDC (protein related to DAN and cerberus) identified by a gene trap approach
Minabe‐Saegusa, C., Saegusa, H., Tsukahara, M., & Noguchi, S. (1998) · Development Growth & Differentiation · doi:10.1046/j.1440-169x.1998.t01-1-00010.x · Cited by 55
Specification of anteroposterior axis by combinatorial signaling during Xenopus development
Carron, C., & Shi, D. (2015) · Wiley Interdisciplinary Reviews Developmental Biology · doi:10.1002/wdev.217 · Cited by 59
“Similarly, the multifunctional antagonist Cerberus induces an ectopic head when ventrally expressed in the whole embryo and anterior neural markers in isolated ectoderm explants.(40) Other organizer-secreted Wnt inhibitors, such as Frzb-1, are less efficient to induce ectopic head probably because they only inhibit a…”
Background
PDGF-A controls mesoderm cell orientation and radial intercalation during Xenopus gastrulation
Damm, E. W., & Winklbauer, R. (2011) · Development · doi:10.1242/dev.056903 · Cited by 55
Primary body axes of vertebrates: Generation of a near‐Cartesian coordinate system and the role of Spemann‐type organizer
Meinhardt, H. (2006) · Developmental Dynamics · doi:10.1002/dvdy.20952 · Cited by 54
“Some Wnt antagonists are maternally supplied (Bouwmeester et al., 1996).”
Xema, afoxi-class gene expressed in the gastrula stageXenopusectoderm, is required for the suppression of mesendoderm
Suri, C., Haremaki, T., & Weinstein, D. C. (2005) · Development · doi:10.1242/dev.01865 · Cited by 54
“3E; compare lanes 2 and 3), including Xbra, Xwnt8, chordin, the panendodermal marker Sox17β, and the anterior endodermal markers cerberus and Xhex (Bouwmeester et al., 1996; Hudson et al., 1997; Jones et al., 1999; Newman et al., 1997).”
Background
The role of the homeodomain protein Bozozok in zebrafish axis formation
Solnica‐Krezel, L., & Driever, W. (2001) · The International Journal of Developmental Biology · doi:10.1387/ijdb.11291860 · Cited by 54
Current perspectives on the genetic causes of neural tube defects
Marco, P. D., Merello, E., Mascelli, S., & Capra, V. (2006) · Neurogenetics · doi:10.1007/s10048-006-0052-2 · Cited by 55
Evolution of Axis Specification Mechanisms in Jawed Vertebrates: Insights from a Chondrichthyan
Coolen, M., Sauka‐Spengler, T., Nicolle, D. M., Mentec, C. L., Lallemand, Y., Silva, C. D., Plouhinec, J.-L., Robert, B., Wincker, P., Shi, D., et al. (2007) · PLoS ONE · doi:10.1371/journal.pone.0000374 · Cited by 54
“While the underlying molecular signals, which involve a transient and localized repression of Nodal and Wnt signalling, appear shared by all vertebrate model organisms and even Amphioxus [27,74– 82], the conservation of a distinct territory homologous to the amniote hypoblast is far from clear, even in amphibians and…”
Background
Nodal signaling and vertebrate germ layer formation
Weng, W., & Stemple, D. L. (2003) · Birth Defects Research Part C Embryo Today Reviews · doi:10.1002/bdrc.10027 · Cited by 54
The initial phase of embryonic patterning in mammals
Gardner, R. L. (2001) · International review of cytology · doi:10.1016/s0074-7696(01)03009-1 · Cited by 54
Pluripotent cells (stem cells) and their determination and differentiation in early vertebrate embryogenesis†
Tiedemann, H., Asashima, M., Grunz, H., & Knöchel, W. (2001) · Development Growth & Differentiation · doi:10.1046/j.1440-169x.2001.00599.x · Cited by 54
“At the midgastrula stage, the gene is expressed anterior and lateral to the prechordal plate (Bouwmeester et al. 1996).”
Background
3 The Anterior Margin of the Mammalian Gastrula: Comparative and Phylogenetic Aspects of Its Role in Axis Formation and Head Induction
Viebahn, C. (1999) · Current topics in developmental biology/Current Topics in Developmental Biology · doi:10.1016/s0070-2153(08)60326-9 · Cited by 53
Identification of neural crest competence territory: Role of Wnt signaling
Bastidas, F., Calisto, J. D., & Mayor, R. (2003) · Developmental Dynamics · doi:10.1002/dvdy.10486 · Cited by 53
“Many of these anti-Wnt signals have been identified, such as dkk1, cerberus, crescent, dan, etc. (Bouwmeester et al., 1996; Kazanskaya et al., 2000; Hashimoto et al., 2000; Ogita et al., 2001).”
Background
Expression cloning of Xantivin, a Xenopus lefty/antivin-related gene, involved in the regulation of activin signaling during mesoderm induction
Tanegashima, K., Yokota, C., Takahashi, S., & Asashima, M. (2000) · Mechanisms of Development · doi:10.1016/s0925-4773(00)00465-2 · Cited by 53
“Furthermore, while the injection of cerberus (Bouwmeester et al., 1996) inhibited Xatv expression, injection of the activin antagonist Xfollstatin (XFS) did not (Tashiro et al., 1991) (Fig.”
Background
The role of cnidarian developmental biology in unraveling axis formation and Wnt signaling
Holstein, T. W. (2022) · Developmental Biology · doi:10.1016/j.ydbio.2022.04.005 · Cited by 54
Smad7 Inhibits Mesoderm Formation and Promotes Neural Cell Fate inXenopusEmbryos
Bhushan, A., Chen, Y., & Vale, W. (1998) · Developmental Biology · doi:10.1006/dbio.1998.8965 · Cited by 52
VegT Activation of Sox17 at the Midblastula Transition Alters the Response to Nodal Signals in the Vegetal Endoderm Domain
Engleka, M. J., Craig, E. J., & Kessler, D. S. (2001) · Developmental Biology · doi:10.1006/dbio.2001.0366 · Cited by 52
Neural induction takes a transcriptional twist
Bainter, J. J., Boos, A., & Kroll, K. L. (2001) · Developmental Dynamics · doi:10.1002/dvdy.1210 · Cited by 52
“Rather than triggering a signal transduction cascade, all of these molecules were found to induce neural tissue by interfering with BMP signaling (Lamb et al., 1993; Hemmati-Brivanlou et al., 1994; Sasai et al., 1995; Bouwmeester et al., 1996; Hansen et al., 1997).”
Background
PP2A:B56ε is required for eye induction and eye field separation
Rorick, A. M., Mei, W., Liette, N. L., Phiel, C. J., El‐Hodiri, H. M., & Yang, J. (2006) · Developmental Biology · doi:10.1016/j.ydbio.2006.10.011 · Cited by 51
“, 1998), cerberus (Bouwmeester et al., 1996), goosecoid (Cho et al.”
Snail2 controls mesodermal BMP/Wnt induction of neural crest
Shi, J., Severson, C., Yang, J., Wedlich, D., & Klymkowsky, M. W. (2011) · Development · doi:10.1242/dev.064394 · Cited by 51
“Plasmids encoding Sizzled (Salic et al., 1997), Cerberus (Bouwmeester et al., 1996), BMP4, Wnt8, Noggin (Smith and Harland, 1992) and Dickkopf (Dkk) (Glinka et al., 1998) were supplied by Eddy DeRobertis and Richard Harland.”
MethodInfluential
Molecular mechanisms of cell-cell signaling by the Spemann-Mangold organizer
Robertis, E. M. D., Wessely, O., Oelgeschläger, M., Brizuela, B. J., Pera, E. M., Larraı́n, J., Abreu, J. G., & Bachiller, D. (2001) · The International Journal of Developmental Biology · doi:10.1387/ijdb.11291846 · Cited by 52
Self-citation
Patterning and lineage specification in the amphibian embryo
Chan, A. P.-Y., & Etkin, L. D. (2001) · Current topics in developmental biology/Current Topics in Developmental Biology · doi:10.1016/s0070-2153(01)51001-7 · Cited by 51
Molecular link in the sequential induction of the Spemann organizer: direct activation of the cerberus gene by Xlim-1, Xotx2, Mix.1, and Siamois, immediately downstream from Nodal and Wnt signaling
Yamamoto, S., Hikasa, H., Ono, H., & Taira, M. (2003) · Developmental Biology · doi:10.1016/s0012-1606(03)00034-4 · Cited by 50
“We ﬁrst examined whether Siamois, Mix.1, Xlim-1, and Xotx2 cooperate to activate the endogenous cerberus gene in animal caps, using Northern blotting.”
BackgroundMethodInfluential
Antimorphic goosecoids
Ferreiro, B., Artinger, M., Cho, K. W. Y., & Niehrs, C. (1998) · Development · doi:10.1242/dev.125.8.1347 · Cited by 50
Role of the Xlim-1 and Xbra genes in anteroposterior patterning of neural tissue by the head and trunk organizer
Taira, M., Saint‐Jeannet, J., & Dawid, I. B. (1997) · Proceedings of the National Academy of Sciences · doi:10.1073/pnas.94.3.895 · Cited by 50
Spemann organizer transcriptome induction by early beta-catenin, Wnt, Nodal, and Siamois signals in Xenopus laevis
Ding, Y., Ploper, D., Sosa, E., Colozza, G., Moriyama, Y., Benitez, M. D. J., Zhang, K. X., Merkurjev, D., & Robertis, E. M. D. (2017) · Proceedings of the National Academy of Sciences · doi:10.1073/pnas.1700766114 · Cited by 50
Self-citation
ForkheadFoxe3 maps to thedysgenetic lens locus and is critical in lens development and differentiation
Brownell, I., Dirksen, M., & Jamrich, M. (2000) · genesis · doi:10.1002/1526-968x(200006)27:2 · Cited by 135
Self-citation
Dickkopf1 and the Spemann-Mangold head organizer
Niehrs, C., Kazanskaya, O., Wu, W., & Glinka, A. (2001) · The International Journal of Developmental Biology · doi:10.1387/ijdb.11291852 · Cited by 49
“An important step in understanding the molecular nature of the head organizer was the identification of Cerberus, a multifunctional secreted protein which can induce entire ectopic heads (Bouwmeester et al., 1996).”
SITE-SPECIFIC INTERACTION OF BONE MORPHOGENETIC PROTEIN 2 WITH PROCOLLAGEN II
Sieroń, A. L., Louneva, N., & Fertala, A. (2002) · Cytokine · doi:10.1006/cyto.2002.1035 · Cited by 49
A role for Xenopus Frizzled 8 in dorsal development
Itoh, K., Jacob, J., & Sokol, S. Y. (1998) · Mechanisms of Development · doi:10.1016/s0925-4773(98)00076-8 · Cited by 49
Spemann organizer activity of Smad10
LeSueur, J. A., & Graff, J. M. (1999) · Development · doi:10.1242/dev.126.1.137 · Cited by 49
Coordinate Nodal and BMP inhibition directs Baf60c-dependent cardiomyocyte commitmentPreprint
Cai, W., Albini, S., Wei, K., Willems, E., Guzzo, R. M., Tsuda, M., Giordani, L., Spiering, S., Kurian, L., Yeo, G. W.-M., et al. (2013) · Genes & Development · doi:10.1101/gad.225144.113 · Cited by 49
“%) sequence positional identity with Cer1 and is also a potent Wnt inhibitor (Bouwmeester et al. 1996; Biben et al. 1998; Piccolo et al. 1999); thus, the cardiogenic significance of Cer1 in mammals or ESCs has never been established.”
Background
Early neural crest induction requires an initial inhibition of Wnt signals
Steventon, B., & Mayor, R. (2012) · Developmental Biology · doi:10.1016/j.ydbio.2012.02.029 · Cited by 48
“How the levels of Wnt signalling are modulated such that prospective neural crest cells receive initially a low level during NPB specification, followed by higher levels for NC specification? Although high levels of Wnt signalling are important for Brachyury expression within the marginal zone (Vonica and Gumbiner, 20…”
TheamnGene Product Is Required in Extraembryonic Tissues for the Generation of Middle Primitive Streak Derivatives
Tomihara-Newberger, C., Haub, O., Lee, H.-G., Soares, V., Manova, K., & Lacy, E. (1998) · Developmental Biology · doi:10.1006/dbio.1998.9034 · Cited by 48
Xenopus tropicalis nodal-related gene 3 regulates BMP signaling: an essential role for the pro-region
Haramoto, Y., Tanegashima, K., Onuma, Y., Takahashi, S., Sekizaki, H., & Asashima, M. (2003) · Developmental Biology · doi:10.1016/j.ydbio.2003.09.015 · Cited by 48
“However, unlike Xnr3, overexpression of other BMP antagonists such as noggin, chordin, follistatin, Cerberus, and Gremlin (Bouwmeester et al., 1996; Hemmati-Brivanlou et al., 1994; Hsu et al., 1998; Lamb et al., 1993; Sasai et al., 1994, 1995; Smith and Harland, 1992; Smith et al., 1993; Zimmerman…”
Background
Endogenous Cerberus activity is required for anterior head specification inXenopus
Silva, A. C., Filipe, M., Kuerner, K., Steinbeißer, H., & Belo, J. A. (2003) · Development · doi:10.1242/dev.00705 · Cited by 48
“1E) (Bouwmeester et al., 1996).”
BackgroundMethodInfluential
A Zebrafish Forebrain-Specific Zinc Finger Gene Can Induce Ectopic dlx2 and dlx6 Expression
Yang, Z., Liu, N., & Lin, S. (2001) · Developmental Biology · doi:10.1006/dbio.2000.0139 · Cited by 48
The cerberus-related gene, Cerr1, is not essential for mouse head formation
Shawlot, W., Deng, J. M., Wakamiya, M., & Behringer, R. R. (2000) · genesis · doi:10.1002/(sici)1526-968x(200004)26:4 · Cited by 56
Self-citation
Genome-wide analysis of dorsal and ventral transcriptomes of the Xenopus laevis gastrula
Ding, Y., Colozza, G., Zhang, K. X., Moriyama, Y., Ploper, D., Sosa, E., Benitez, M. D. J., & Robertis, E. M. D. (2016) · Developmental Biology · doi:10.1016/j.ydbio.2016.02.032 · Cited by 47
“…suppression of canonical Wnt signaling by several inhibitors, such as Cerberus, Dkk1, Frzb-1, Notum, Shisa and Tiki, while increased late Wnt signaling leads to the reduction of head structures (Bouwmeester et al., 1996; Glinka et al., 1997, 1998; Yamamoto et al., 2005; Zhang et al., 2012, 2015).”
BackgroundMethodInfluentialSelf-citation
Maturation of Stem Cell-Derived Beta-cells Guided by the Expression of Urocortin 3
van der Meulen, T., & Huising, M. O. (2014) · The Review of Diabetic Studies · doi:10.1900/rds.2014.11.115 · Cited by 46
“The pancreas forms from Cerberus [29], hepatocyte nuclear factor 1 beta (HNF1B), and HNF4-expressing foregut endoderm [30, 31].”
Background
Gastrulation and homeobox genes in chick embryos
Lemaire, L., & Kessel, M. (1997) · Mechanisms of Development · doi:10.1016/s0925-4773(97)00102-0 · Cited by 46
“The secreted protein Cerberus, was recently identified as signaling molecule derived from dorsal/anterior endoderm in Xenopus Zuevis (Bouwmeester et al., 1996).”
Background
Multiple nodal-Related Genes Act Coordinately in Xenopus Embryogenesis
Onuma, Y., Takahashi, S., Yokota, C., & Asashima, M. (2002) · Developmental Biology · doi:10.1006/dbio.2001.0493 · Cited by 46
“…EF-1 a and msactin (Takahashi et al., 1998); Xnr1 (Lustig et al., 1996); Xnr2, Xnr3, Xnr4, Xnr6, and derrière (Takahashi et al., 2000); siamois (Brannon and Kimelman, 1996); cerberus (Bouwmeester et al., 1996); Mixer (Henry and Melton, 1998); Sox17b (Hudson et al., 1997).”
BackgroundInfluential
Analysis of Spemann organizer formation in Xenopus embryos by cDNA macroarrays
Wessely, O., Kim, J. I., Geissert, D., Tran, U., & Robertis, E. M. D. (2004) · Developmental Biology · doi:10.1016/j.ydbio.2004.01.018 · Cited by 46
“This is because the picking of bacterial colonies of cDNA clones into 384-well plates and their subsequent arraying avoids the error-prone secondary screening of putative positive colonies required in traditional cDNA library platings (e.g. Bouwmeester et al., 1996 ).”
BackgroundInfluentialSelf-citation
Dynamic in vivo binding of transcription factors to cis-regulatory modules ofcerandgscin the stepwise formation of the Spemann–Mangold organizer
Sudou, N., Yamamoto, S., Ogino, H., & Taira, M. (2012) · Development · doi:10.1242/dev.068395 · Cited by 45
“The expression domains of these seven genes have already been reported individually (Taira et al., 1992; Bouwmeester et al., 1996; Lemaire et al., 1998; Rankin et al., 2011), but some of their initial or early expression domains have not been reported, such as gsc, mix1, cer, lim1 and otx2.”
Induction of cardiogenesis by Hensen's node and fibroblast growth factors
López‐Sánchez, C., Climent, V. E., Schoenwolf, G. C., Álvarez, I. S., & García‐Martínez, V. (2002) · Cell and Tissue Research · doi:10.1007/s00441-002-0567-2 · Cited by 45
“Moreover, both caudal and rostral areas of the embryo produce potentially relevant factors for cardiogenesis; for example, caudal tissue: Wnts (Marvin et al. 2001); rostral tissue: antagonists of BMP signaling (Ehrman and Yutzey 1999), the Wnt antagonist crescent (Pfeffer et al. 1997), Dkk-1 (Schneider and Mercola 200…”
Background
Serum Dickkopf-1 as a Biomarker for the Diagnosis of Hepatocellular Carcinoma
Kim, S. U., Park, J. H., Kim, H.-S., Lee, J. M., Lee, H. G., Kim, H., Choi, S. H., Baek, S., Kim, B. K., Park, J. Y., et al. (2015) · Yonsei Medical Journal · doi:10.3349/ymj.2015.56.5.1296 · Cited by 44
Self-citation
A Secreted BMP Antagonist, Cer1, Fine Tunes the Spatial Organization of the Ureteric Bud Tree during Mouse Kidney Development
Chi, L., Saarela, U., Railo, A., Prunskaite‐Hyyryläinen, R., Skovorodkin, I., Anthony, S., Katsu, K., Liu, Y., Shan, J., Salgueiro, A. M., et al. (2011) · PLoS ONE · doi:10.1371/journal.pone.0027676 · Cited by 45
“Cerberus 1 (Cer1) gain of function in early embryos induces ectopic head, heart and liver development [41,42], but head development remains normal in Cer1-deficient embryos [43,44].”
Background
Selective degradation of excess Ldb1 by Rnf12/RLIM confers proper Ldb1 expression levels and Xlim-1/Ldb1 stoichiometry inXenopusorganizer functions
Hiratani, I., Yamamoto, N., Mochizuki, T., Ohmori, S., & Taira, M. (2003) · Development · doi:10.1242/dev.00621 · Cited by 43
“…from Xlim-1 (Taira et al., 1992), gsc (Cho et al., 1991), chd (Sasai et al., 1995), Xotx2 (Pannese et al., 1995), XPAPC (Kim et al., 1998), cer (Bouwmeester et al., 1996), XFKH1 (Dirksen and Jamrich, 1992), Xnot (von Dassow et al., 1993), Mix.1 (Rosa, 1989 ) and Xbra (Smith et al., 1991)…”
Modulation of activin and BMP signaling
Harrison, C. A., Wiater, E., Gray, P. C., Greenwald, J., Choe, S., & Vale, W. (2004) · Molecular and Cellular Endocrinology · doi:10.1016/j.mce.2004.02.008 · Cited by 44
Twisted gastrulation loss-of-function analyses support its role as a BMP inhibitor during earlyXenopusembryogenesis
Blitz, I. L., Cho, K. W. Y., & Chang, C. (2003) · Development · doi:10.1242/dev.00709 · Cited by 44
“These inhibitors include noggin, chordin, follistatin and members of the DAN family of proteins (Smith and Harland, 1992; Sasai et al., 1994; Hemmati-Brivanlou et al., 1994; Bouwmeester et al., 1996; Fainsod et al., 1997; Hsu et al., 1998).”
Background
The role ofMixerin patterning the earlyXenopusembryo
Kofron, M. J., Wylie, C., & Heasman, J. (2004) · Development · doi:10.1242/dev.01132 · Cited by 43
“, 2000), the anterior endodermal marker cerberus (Bouwmeester et al., 1996), and the mesodermal markers, Xbra, ntipodean, eFGF (Slack, 1994; Smith et al.”
Background
BMPs on the road to hepatogenesis: Figure 1.Preprint
Duncan, S. A., & Watt, A. J. (2001) · Genes & Development · doi:10.1101/gad.920601 · Cited by 44
“laevis embryos has been found to induce a dramatic duplication of both the heart and liver (Bouwmeester et al. 1996).”
Background
Bmp signaling is necessary and sufficient for ventrolateral endoderm specification in Xenopus
Wills, A. E., Dickinson, K., Khokha, M. K., & Baker, J. C. (2008) · Developmental Dynamics · doi:10.1002/dvdy.21631 · Cited by 41
Secreted HHIP1 interacts with heparan sulfate and regulates Hedgehog ligand localization and function
Holtz, A. M., Griffiths, S. C., Davis, S. J., Bishop, B., Siebold, C., & Allen, B. L. (2015) · The Journal of Cell Biology · doi:10.1083/jcb.201411024 · Cited by 43
“…is a secreted Hedgehog antagonist • Holtz et al. 751 way antagonists (Leyns et al., 1997; Wang et al., 1997; Hsieh et al., 1999; Cruciat and Niehrs, 2013); and Cerberus, which binds to and antagonizes the activity of BMP, Nodal, and WNT ligands (Bouwmeester et al., 1996; Piccolo et al., 1999).”
Background
Zebrafish foxo3b Negatively Regulates Canonical Wnt Signaling to Affect Early Embryogenesis
Xie, X., Liu, J., Hu, B., & Xiao, W. (2011) · PLoS ONE · doi:10.1371/journal.pone.0024469 · Cited by 43
“Wnt inhibitors, such as cerberus, frzb1 and dickkopf1, all function as head inducers [9,10,11].”
Background
Mechanisms driving neural crest induction and migration in the zebrafish and Xenopus laevis
Klymkowsky, M. W., Rossi, C. C., & Artinger, K. (2010) · Cell Adhesion & Migration · doi:10.4161/cam.4.4.12962 · Cited by 41
The facial neural crest controls fore- and midbrain patterning by regulating Foxg1 expression through Smad1 activity
Aguiar, D. P., Sghari, S., & Creuzet, S. (2014) · Development · doi:10.1242/dev.101790 · Cited by 42
“Regulation of Cerberus expression by Dkk1 is required for Otx2 and Foxa2 expression In Smad1-depleted embryos, the activity ofCerberus, which is known to interfere with Bmp andWnt signalling (Bouwmeester et al., 1996), was examined at 26ss; its transcripts are normallyaccumulated inFNC cells that populate the retro- a…”
Background
Identification and characterization of Xenopus NDRG1
Kyuno, J., Fukui, A., Michiue, T., & Asashima, M. (2003) · Biochemical and Biophysical Research Communications · doi:10.1016/s0006-291x(03)01522-5 · Cited by 42
Expression of Siamois and Twin in the blastula Chordin/Noggin signaling center is required for brain formation in Xenopus laevis embryos
Ishibashi, H., Matsumura, N., Hanafusa, H., Matsumoto, K., Robertis, E. M. D., & Kuroda, H. (2007) · Mechanisms of Development · doi:10.1016/j.mod.2007.10.005 · Cited by 42
“Cerberus is a head-inducing secreted factor expressed in the anterior endoderm of Spemann’s organizer.”
InfluentialSelf-citation
Bone morphogenetic protein-3 family members and their biological functions
Hino, J. (2004) · Frontiers in bioscience · doi:10.2741/1355 · Cited by 42
“These effects of BMP-3b in embryos are comparable to those of cerberus, a known head inducer (8).”
Background
Characterization of a Novel Member of the FGF Family, XFGF-20, in Xenopus laevis
Koga, C., Adati, N., Nakata, K., Mikoshiba, K., Furuhata, Y., Sato, S., Tei, H., Sakaki, Y., Kurokawa, T., Shiokawa, K., et al. (1999) · Biochemical and Biophysical Research Communications · doi:10.1006/bbrc.1999.1039 · Cited by 41
Regulation of BMP/Dpp signaling during embryonic development
Nakayama, T., Cui, Y., & Christian, J. L. (2000) · Cellular and Molecular Life Sciences · doi:10.1007/pl00000736 · Cited by 41
Regionalization in the mammalian telencephalon
Fishell, G. (1997) · Current Opinion in Neurobiology · doi:10.1016/s0959-4388(97)80121-3 · Cited by 41
Molecular Regionalization of the Developing Neural Tube
Martı́nez, S., Puelles, E., Puelles, L., & Echevarrı́a, D. (2011) · Elsevier eBooks · doi:10.1016/b978-0-12-369497-3.10001-9 · Cited by 40
Amphibians provide new insights into taste-bud development
Northcutt, R. G., & Barlow, L. A. (1998) · Trends in Neurosciences · doi:10.1016/s0166-2236(97)01146-6 · Cited by 40
Early steps in vertebrate cardiogenesis
Mohun, T. J., & Sparrow, D. B. (1997) · Current Opinion in Genetics & Development · doi:10.1016/s0959-437x(97)80010-x · Cited by 40
An inducible system for the study of FGF signalling in early amphibian development
Pownall, M. E., Welm, B. E., Freeman, K. W., Spencer, D. M., Rosen, J. M., & Isaacs, H. V. (2003) · Developmental Biology · doi:10.1016/s0012-1606(02)00120-3 · Cited by 39
“Such approaches have not only revealed a detailed picture of the role of known signalling pathways in early patterning and specification, but have also led to the identification of a wide range of novel signalling molecules (Bouwmeester et al., 1996; Hsu et al., 1998; Smith and Harland, 1992).”
Background
Extracellular modulation of the Hedgehog, Wnt and TGF-β signalling pathways during embryonic development
Capdevila, J., & Belmonte, J. C. I. (1999) · Current Opinion in Genetics & Development · doi:10.1016/s0959-437x(99)80065-3 · Cited by 39
Formation and Septation of the Tubular Heart: Integrating the Dynamics of Morphology With Emerging Molecular Concepts
Markwald, R. R., Trusk, T. C., & Moreno‐Rodriguez, R. A. (1998) · Birkhäuser Boston eBooks · doi:10.1007/978-1-4612-1788-6_2 · Cited by 39
The tumor suppressor PTPRK promotes ZNRF3 internalization and is required for Wnt inhibition in the Spemann organizer
Chang, L.-S., Kim, M., Glinka, A., Reinhard, C., & Niehrs, C. (2020) · eLife · doi:10.7554/elife.51248 · Cited by 39
“Various Wnt antagonists or membrane-bound Wnt inhibitors are expressed in neural-inducing dorsal mesoderm and/or the prospective neuroectoderm itself to promote organizer function, and to pattern the neural plate, including cerberus, frzb, dkk1, shisa, tiki, notum, angptl4, and bighead (Bouwmeester et al., 1996; Leyns…”
Background
Induction and patterning of the telencephalon inXenopus laevis
Lupo, G., Harris, W. A., Barsacchi, G., & Vignali, R. (2002) · Development · doi:10.1242/dev.00095 · Cited by 38
3 The Organizer of the Gastrulating Mouse Embryo
Camus, A., & Tam, P. (1999) · Current topics in developmental biology/Current Topics in Developmental Biology · doi:10.1016/s0070-2153(08)60315-4 · Cited by 40
OtxGenes and the Genetic Control of Brain Morphogenesis
Acampora, D., Gulisano, M., & Simeone, A. (1999) · Molecular and Cellular Neuroscience · doi:10.1006/mcne.1998.0730 · Cited by 38
Cell-autonomous and signal-dependent expression of liver and intestine marker genes in pluripotent precursor cells from Xenopus embryos
Chen, Y., Jürgens, K., Hollemann, T., Claußen, M., Ramadori, G. P., & Pieler, T. (2003) · Mechanisms of Development · doi:10.1016/s0925-4773(02)00460-4 · Cited by 38
“While Cerberus is only transiently expressed in these cells, XHex expression persists in the liver lineage throughout development (Bouwmeester et al., 1996; Newman et al., 1997; Jones et al., 1999; Zorn et al., 1999; Zorn and Mason, 2001).”
Cellular and molecular interactions in the development of theXenopusolfactory system
Reiss, J. O., & Burd, G. D. (1997) · Seminars in Cell and Developmental Biology · doi:10.1006/scdb.1996.0138 · Cited by 38
“Moreover, of the identified neural inducers, only cerberus has been shown to induce histologically recognizable olfactory placodes in animal caps.(63) This result is consistent with the location of cerberus message — but not noggin, follistatin, or chordin — in the endoderm that immediately underlies the prospective p…”
Result
Bottle cell formation in relation to mesodermal patterning in the Xenopus embryo
Kurth, T., & Hausen, P. (2000) · Mechanisms of Development · doi:10.1016/s0925-4773(00)00428-7 · Cited by 37
“…pBSK, restriction with EcoRI, transcription with T7-RNA-Polymerase (Blumberg et al., 1991; Cho et al., 1991)), Xbra (pSP73, restriction with SalI, SP6-RNA-Polymerase (Smith et al., 1991)), and cerberus (pBSK, restriction with EcoRI, transcription with T7-RNA-Polymerase (Bouwmeester et al., 1996)).”
BackgroundMethodInfluential
Wnt inhibitory factor ( WIF )‐1 promotes melanogenesis in normal human melanocytes
Park, T. J., Kim, M.-S., Kim, H.-R., Park, S. Y., Park, K., Ortonne, J. P., & Kang, H. Y. (2013) · Pigment Cell & Melanoma Research · doi:10.1111/pcmr.12168 · Cited by 37
Neuroectodermal specification and regionalization of the Spemann organizer in Xenopus
Fetka, I., Doederlein, G., & Bouwmeester, T. (2000) · Mechanisms of Development · doi:10.1016/s0925-4773(00)00265-3 · Cited by 37
Self-citation
The Spemann organizer and embryonic head induction
Niehrs, C. (2001) · The EMBO Journal · doi:10.1093/emboj/20.4.631 · Cited by 37
In Xenopus Embryos, BMP Heterodimers Are Not Required for Mesoderm Induction, but BMP Activity Is Necessary for Dorsal/Ventral Patterning
Eimon, P. M., & Harland, R. M. (1999) · Developmental Biology · doi:10.1006/dbio.1999.9496 · Cited by 37
Evolution of vertebrate forebrain development: how many different mechanisms?
Foley, A. C., & Stern, C. D. (2001) · Journal of Anatomy · doi:10.1046/j.1469-7580.2001.19910035.x · Cited by 36
Evo-Devo of Urbilateria and its larval forms
Robertis, E. M. D., & Tejeda‐Muñoz, N. (2022) · Developmental Biology · doi:10.1016/j.ydbio.2022.04.003 · Cited by 39
Self-citation
Evolutionary origins of blastoporal expression and organizer activity of the vertebrate gastrula organizer genelhx1and its ancient metazoan paraloglhx3
Yasuoka, Y., Kobayashi, M., Kurokawa, D., Akasaka, K., Saiga, H., & Taira, M. (2009) · Development · doi:10.1242/dev.028530 · Cited by 36
“…Reverse Product (bp) Reference Xl_gsc ACAACTGGAAGCACTGGA TCTTATTCCAGAGGAACC 278 Xenbase* Xl_cer GCTGAACTATTTGATTCCACC ATGGCTTGTATTCTGTGGGGC 255 Bouwmeester et al., 1996 Xl_chd CCTCCAATCCAAGACTCCAGCAG GGAGGAGGAGGAGCTTTGGGACAAG 267 Bouwmeester et al., 1996 Xl_otx2 GGATGGATTTGTTGCACCAGTC…”
Embryonic Heart Induction
Foley, A. C., Gupta, R., Guzzo, R. M., Korol, O., & Mercola, M. A. (2006) · Annals of the New York Academy of Sciences · doi:10.1196/annals.1380.008 · Cited by 36
Characterization of cis-regulatory elements of the homeobox gene Xanf-1
Eroshkin, F. M., Kazanskaya, O., Martynova, N. Y., & Zaraisky, A. G. (2002) · Gene · doi:10.1016/s0378-1119(02)00393-1 · Cited by 36

Authors: Bouwmeester, T., Kim, S.-H., Sasai, Y., Lu, B., & Robertis, E. M. D.
Affiliations: Howard Hughes Medical Institute (US)
ORCID: Bouwmeester, Tewis
Kim, Sung-Hyun
Venue: Nature
Publisher: Springer Science and Business Media LLC
Published: 1996-08
Volume: 382
Issue: 6592
Pages: 595-601
ISSN: 0028-0836 (ISSN-L)
1476-4687
DOI: 10.1038/382595a0
OpenAlex: W2081939122
Cited by: 759
References: 44
Citations by year: 2026: 3 · 2025: 9 · 2024: 15 · 2023: 11 · 2022: 10 · 2021: 7 · 2020: 9 · 2019: 6 · 2018: 10 · 2017: 13 · 2016: 14 · 2015: 14 · 2014: 10 · 2013: 21 · 2012: 23
FWCI: 23.03
Type: journal article
Language: en
Open access: closed
Licence: www.springer.com/tdm (tdm)
Locations: Nature (publishedVersion)
PubMed (publishedVersion)
Topics: Life Sciences › Biochemistry, Genetics and Molecular Biology › Molecular Biology › Developmental Biology and Gene Regulation
Life Sciences › Biochemistry, Genetics and Molecular Biology › Molecular Biology › Wnt/β-catenin signaling in development and cancer
Life Sciences › Biochemistry, Genetics and Molecular Biology › Molecular Biology › Pluripotent Stem Cells Research
Keywords: Cerberus, Spemann's organizer, anterior endoderm, secreted proteins, head induction, Xenopus embryo, gene expression, embryonic induction
MeSH terms: Amino Acid Sequence, Animals, Base Sequence, Blastomeres, Digestive System, Embryonic Induction, Endoderm, Gastrula, Head, Mesoderm, Molecular Sequence Data, Proteins, RNA, Messenger, Tail, Ultraviolet Rays, Xenopus, Cell Polarity, In Situ Hybridization, DNA Primers, DNA, Complementary, Xenopus Proteins, Intercellular Signaling Peptides and Proteins

About these checks

Registry, retraction, Cites and statistics results are computed, not judged, with one exception: a printed reference that no index lists is read once by a model before it counts as a citation error. Claims are extracted by a model and kept only when their quote appears verbatim in the text; each cited source is then checked, with a model’s help, for whether it says what the claim relies on. Those verdicts can be wrong — read the claim’s quote and the cited source before relying on one.

Statistics and arithmetic are recomputed, not judged.

Confidence bands are shown only for fields calibrated on our annotated test set. None is calibrated yet, so no band is shown.

What counts as a claim ›How we measure confidence ›How we check this ›

Are you an author, or do you see a problem with this page? Request a review

Cerberus is a head-inducing secreted factor expressed in the anterior endoderm of Spemann's organizer

Abstract

Overview

Integrity signals

Verification

Claims the paper makes

Claims other papers make about this one

Citations

Cites

Cited by

Related

Metadata

Record

About these checks