The DOI matches its Crossref record; 64 of the 64 references it cites were found in a registry or an index; none of the 30 sources its claims cite is checked for support yet.
Assessment of variation in microbial community amplicon sequencing by the Microbiome Quality Control (MBQC) project consortium
Open accessAbstract
In order for human microbiome studies to translate into actionable outcomes for health, meta-analysis of reproducible data from population-scale cohorts is needed. Achieving sufficient reproducibility in microbiome research has proven challenging. We report a baseline investigation of variability in taxonomic profiling for the Microbiome Quality Control (MBQC) project baseline study (MBQC-base). Blinded specimen sets from human stool, chemostats, and artificial microbial communities were sequenced by 15 laboratories and analyzed using nine bioinformatics protocols. Variability depended most on biospecimen type and origin, followed by DNA extraction, sample handling environment, and bioinformatics. Analysis of artificial community specimens revealed differences in extraction efficiency and bioinformatic classification. These results may guide researchers in experimental design choices for gut microbiome studies.
Overview
Integrity signals
Registry
Cites
Statistics
Verification
Claims the paper makes
69 Own result · 27 Own method · 16 Not checked yet · 11 Own interpretation · 4 No basis given
A result the paper reports from its own data — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“The experiments we report find that differences in DNA extraction, amplification protocol, and bioinformatics sometimes (but not always) result in effects comparable to those of biological differences”
§ Assessment of variation in microbial community amplicon sequencing by the Microbiome Quality Control (MBQC) project consortium > Results
hedgeddirect- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: passes — The paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
A result the paper reports from its own data — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“Variability depended most on biospecimen type and origin, followed by DNA extraction, sample handling environment, and bioinformatics.”
§ Assessment of variation in microbial community amplicon sequencing by the Microbiome Quality Control (MBQC) project consortium > Abstract
plaindirect- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: passes — The paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
A result the paper reports from its own data — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“Analysis of artificial community specimens particularly revealed differences in extraction efficiency and bioinformatic classification.”
§ Assessment of variation in microbial community amplicon sequencing by the Microbiome Quality Control (MBQC) project consortium > Abstract
plaincorrelational- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: passes — The paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
A result the paper reports from its own data — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“differences induced by bioinformatics pipelines were typically smaller than those arising from data generation”
§ Assessment of variation in microbial community amplicon sequencing by the Microbiome Quality Control (MBQC) project consortium > Results
plain- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: passes — The paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
A result the paper reports from its own data — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“relative (rather than absolute) computational measures were typically more reliable than absolute measures in resolving these differences among protocols.”
§ Assessment of variation in microbial community amplicon sequencing by the Microbiome Quality Control (MBQC) project consortium > Results
hedgedcorrelational- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: passes — The paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
A result the paper reports from its own data — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“almost half of the participating wet-laboratories produced variable results for positive control artificial communities.”
§ Assessment of variation in microbial community amplicon sequencing by the Microbiome Quality Control (MBQC) project consortium > Discussion
plain- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: passes — The paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
A result the paper reports from its own data — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“A qualitative overview of sample beta-diversity values (Fig. 2) revealed that biological, experimental, and bioinformatics variables all contribute to facets of between-sample variation”
§ Assessment of variation in microbial community amplicon sequencing by the Microbiome Quality Control (MBQC) project consortium > Results > Taxonomic profiles
plaindirect- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: passes — The paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
A result the paper reports from its own data — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“in almost all cases, the range of differences between samples was greatest for the 18 human-derived specimens.”
§ Assessment of variation in microbial community amplicon sequencing by the Microbiome Quality Control (MBQC) project consortium > Results > Variation in taxonomic profiles
plaincorrelationaln = 18- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: passes — The paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
A result the paper reports from its own data — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“Differences owing to sample handling in laboratories were generally larger than the effect size of sample type, especially in those labs that handled samples extracted centrally and in other locations”
§ Assessment of variation in microbial community amplicon sequencing by the Microbiome Quality Control (MBQC) project consortium > Results > Variation in taxonomic profiles
plaincorrelational- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: passes — The paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
A result the paper reports from its own data — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“There was no single bioinformatics pipeline that was consistently either the least or most conservative in estimating the effects of handling laboratory on measures of community structure such as alpha diversity”
§ Assessment of variation in microbial community amplicon sequencing by the Microbiome Quality Control (MBQC) project consortium > Results > Variation among biospecimens
plain- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: passes — The paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
- It may state two separate claims as one. 63
- Probably not a substantial claim. 45
- The quote only partly states this claim. 2
A result the paper reports from its own data — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“both types of effects can differ per sample (and sometimes interact)”
§ Assessment of variation in microbial community amplicon sequencing by the Microbiome Quality Control (MBQC) project consortium > Results
plaincorrelational- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: passes — The paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
It may state two separate claims as one.
A result the paper reports from its own data — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“At least one OTU was reported in 342 of these samples, with the observed number ranging from 1 to ~130 at low (1,000 sequences) rarefaction and almost 200 in all sequences”
§ Assessment of variation in microbial community amplicon sequencing by the Microbiome Quality Control (MBQC) project consortium > Results > Negative controls
plainn = 342- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: passes — The paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
It may state two separate claims as one.
- Rests on an assumption: Negative control buffer aliquots are expected to contain no microbial DNA or OTUs, so any OTUs detected in them indicate contamination.
A result the paper reports from its own data — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“Beta diversities between locally- versus centrally-extracted samples were specimen-specific, with some samples showing little effect and others differing significantly primarily based on this single handling protocol variable”
§ Assessment of variation in microbial community amplicon sequencing by the Microbiome Quality Control (MBQC) project consortium > Results > Variation due to extraction protocol
plaindirectn = 22- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: passes — The paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
It may state two separate claims as one.
- Rests on an assumption: Comparing centrally extracted DNA with locally extracted DNA isolates the effect of DNA extraction from PCR and sequencing effects.
A result the paper reports from its own data — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“Chimeric reads represented another ~1–5% of mismatched reads across all labs, although this rate did not vary monotonically with number of PCR thermal cycles”
§ Assessment of variation in microbial community amplicon sequencing by the Microbiome Quality Control (MBQC) project consortium > Results > Positive controls
plain- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: unclear — It is unclear whether the paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
It may state two separate claims as one.
A result the paper reports from its own data — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“Approximately 50–80% of 16S amplicon reads matched one of the 20 or 22 fecal/oral reference sequences exactly, with most labs varying only slightly (typically <10%) between samples.”
§ Assessment of variation in microbial community amplicon sequencing by the Microbiome Quality Control (MBQC) project consortium > Results > Positive controls
plain- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: unclear — It is unclear whether the paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
It may state two separate claims as one.
A result the paper reports from its own data — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“This produced comparable taxonomic profiles to MBQC-base bioinformatics, shifted significantly (but with modest effect size) to deplete some clades that were dominant in protocols BL-1 to 9 (genus Fusobacterium, unclassified Enterobacteriaceae, most species-level assignments, etc.) and enriching the otherwise less-abundant Firmicutes”
§ Assessment of variation in microbial community amplicon sequencing by the Microbiome Quality Control (MBQC) project consortium > Results > Taxonomic profiles
plaindirect- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: unclear — It is unclear whether the paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
It may state two separate claims as one.
A result the paper reports from its own data — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“Overall taxonomic profiles were also sensitive to handling protocol, bioinformatics, and to the interaction of these variables, although all estimates of OTU richness were high (means ~30–35 for centrally and locally extracted samples, respectively) and neared 100 OTUs in one case (HL-E handling, BL-6 bioinformatics), despite an expectation of 20 and 22 (fecal and oral, respectively) and low raref”
§ Assessment of variation in microbial community amplicon sequencing by the Microbiome Quality Control (MBQC) project consortium > Results > Positive controls
plaindirect- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: passes — The paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
It may state two separate claims as one.
A result the paper reports from its own data — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“This resulted in complex interactions between handling and bioinformatics protocol choices: some sample diversity estimates agreed across handling labs and bioinformatics protocols, while others differed significantly across handling, bioinformatics, or both”
§ Assessment of variation in microbial community amplicon sequencing by the Microbiome Quality Control (MBQC) project consortium > Results > Variation among biospecimens
plaincorrelational- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: passes — The paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
It may state two separate claims as one.
A result the paper reports from its own data — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“The most abundant contaminant OTU was an unidentified Bacteroides at 1.6 s.d. 7.0%, which was detected in 22.6% of negative control samples and was also abundant in stool samples (average 1.2 s.d. 3.7%).”
§ Assessment of variation in microbial community amplicon sequencing by the Microbiome Quality Control (MBQC) project consortium > Results > Negative controls
plainn = 345- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: unclear — It is unclear whether the paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
It may state two separate claims as one.
- Rests on an assumption: Negative control buffer aliquots are expected to contain no microbial DNA or OTUs, so any OTUs detected in them indicate contamination.
A result the paper reports from its own data — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“Some samples, e.g. artificial communities, were minimally affected by different sample handling protocols, and there was no statistically significant variation in measures of diversity (e.g. Simpson’s diversity) associated with a handling laboratory.”
§ Assessment of variation in microbial community amplicon sequencing by the Microbiome Quality Control (MBQC) project consortium > Results > Variation among biospecimens
plain- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: passes — The paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
It may state two separate claims as one.
A result the paper reports from its own data — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“Most human- and chemostat-derived samples cluster together, with the biologically distinct artificial communities and a subset of human-derived samples forming outgroups.”
§ Assessment of variation in microbial community amplicon sequencing by the Microbiome Quality Control (MBQC) project consortium > Results > Taxonomic profiles
plaincorrelational- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: unclear — It is unclear whether the paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
It may state two separate claims as one.
A result the paper reports from its own data — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“handling laboratories generated a total of ~215M sequence reads spanning 2,250 samples”
§ Assessment of variation in microbial community amplicon sequencing by the Microbiome Quality Control (MBQC) project consortium > Results > Sample handling and bioinformatics protocols
hedgedn = 2,250- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: fails — The paper’s conclusions may not depend on it.
- Based: passes — The paper gives a reason why it holds.
Probably not a substantial claim. The paper’s conclusions may not depend on it.
A result the paper reports from its own data — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“The two labs using fully open-reference OTU calling found high variance in their per-sample QC criteria, because in some, but not all, samples many reads were captured only by de novo OTUs.”
§ Assessment of variation in microbial community amplicon sequencing by the Microbiome Quality Control (MBQC) project consortium > Results > Taxonomic profiles
plaindirect- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: unclear — It is unclear whether the paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
It may state two separate claims as one.
A result the paper reports from its own data — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“Absolute levels of diversity varied among laboratories (Supplementary Fig. 2–3), although relative correlations between community profiles in the 22 primary specimens across laboratories remained high (min. Spearman r=0.9”
§ Assessment of variation in microbial community amplicon sequencing by the Microbiome Quality Control (MBQC) project consortium > Results > Variation in taxonomic profiles
plaincorrelationaln = 22- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: passes — The paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
It may state two separate claims as one.
A result the paper reports from its own data — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“Using arcsine-square root transformed phylum-level taxonomic abundances as a readout, the greatest variability in microbiome profiling was assigned to biological differences between specimen sources and handling laboratories, as in the univariate whole-community models above.”
§ Assessment of variation in microbial community amplicon sequencing by the Microbiome Quality Control (MBQC) project consortium > Results > Multivariate quantification of variation
plaincorrelational- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: passes — The paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
It may state two separate claims as one.
A result the paper reports from its own data — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“Single base error accounted for many of the remainder, at a rate of 0.15–0.2% per nucleotide, while two labs (HL-C and HL-N, two of only three labs using single-indexed 8nt barcodes) also generated 1–3% mismatched sequences due to single base gaps at the barcode/linker.”
§ Assessment of variation in microbial community amplicon sequencing by the Microbiome Quality Control (MBQC) project consortium > Results > Positive controls
plaindirect- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: unclear — It is unclear whether the paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
It may state two separate claims as one.
In the paper
“this experiment supported the expected ground truth and further confirmed the variability of laboratory and bioinformatics protocols when reading out even these low-complexity communities.”
§ Assessment of variation in microbial community amplicon sequencing by the Microbiome Quality Control (MBQC) project consortium > Results > Positive controls
What the sources say
- Not checked yetcites [22] Segata, N. et al. Metagenomic microbial community profiling using unique clade-specific marker genes. Nat. Methods 9, 811–814 (2012). source
plaincorrelationaln = 6- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: passes — The paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
It may state two separate claims as one.
A result the paper reports from its own data — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“read-level error rates did not correlate with handling labs’ diversity averages. Instead, inflated diversity arose from other handling (e.g. contamination) or bioinformatics sources, although such errors do decrease absolute accuracy in taxonomic profile assessment”
§ Assessment of variation in microbial community amplicon sequencing by the Microbiome Quality Control (MBQC) project consortium > Results > Positive controls
plaindirect- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: passes — The paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
It may state two separate claims as one.
A result the paper reports from its own data — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“Three labs that used single 8nt barcodes (HL-C, HL-N, and HL-I) had the highest proportion of these reads, although this factor was not directly associated with diversity rates (see Supplementary Fig. 12) or absolute accuracy”
§ Assessment of variation in microbial community amplicon sequencing by the Microbiome Quality Control (MBQC) project consortium > Results > Positive controls
plain- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: unclear — It is unclear whether the paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
It may state two separate claims as one.
A result the paper reports from its own data — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“Additionally, DNA extraction method was the individual protocol variable of greatest effect, also as observed in univariate analyses.”
§ Assessment of variation in microbial community amplicon sequencing by the Microbiome Quality Control (MBQC) project consortium > Results > Multivariate quantification of variation
plaincorrelational- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: passes — The paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
It may state two separate claims as one.
A result the paper reports from its own data — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“Of the top 100 most abundant false positive Greengenes identifiers (average relative abundances ranging from 0.2% to 1.5%), 34% were from genera Bacteroides; Faecalibacterium prausnitzii also comprised 9% of the top 100 IDs, genus Pseudomonas 7%, and family Enterobacteriaceae 6%”
§ Assessment of variation in microbial community amplicon sequencing by the Microbiome Quality Control (MBQC) project consortium > Results > Negative controls
plainn = 345- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: unclear — It is unclear whether the paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
It may state two separate claims as one.
- Rests on an assumption: Negative control buffer aliquots are expected to contain no microbial DNA or OTUs, so any OTUs detected in them indicate contamination.
A result the paper reports from its own data — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“In total, 345 negative controls were fully processed.”
§ Assessment of variation in microbial community amplicon sequencing by the Microbiome Quality Control (MBQC) project consortium > Results > Negative controls
plainn = 345- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: fails — The paper’s conclusions may not depend on it.
- Based: passes — The paper gives a reason why it holds.
Probably not a substantial claim. The paper’s conclusions may not depend on it.
A result the paper reports from its own data — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“Fusobacterium was only substantively detected in HL-A samples by the BL-2 and BL-6 pipelines, for example, or by BL-1, BL-4, and BL-9A in the sole HiSeq laboratory, HL-L.”
§ Assessment of variation in microbial community amplicon sequencing by the Microbiome Quality Control (MBQC) project consortium > Results > Positive controls
plaincorrelational- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: passes — The paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
It may state two separate claims as one.
A result the paper reports from its own data — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“Sample handling and bioinformatics protocols had an effect on community profile accuracy (Fig. 4A–B), but the largest contributor to variability was contamination or omissions owing to microbes whose DNA was not extracted”
§ Assessment of variation in microbial community amplicon sequencing by the Microbiome Quality Control (MBQC) project consortium > Results > Positive controls
plaindirect- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: passes — The paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
It may state two separate claims as one.
- Rests on an assumption: Negative control buffer aliquots are expected to contain no microbial DNA or OTUs, so any OTUs detected in them indicate contamination.
A result the paper reports from its own data — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“Differences induced by a subset of computational protocols are readily visible (e.g. BL-8), with those arising from sample handling protocol choices more difficult to see in this visualization but nevertheless present”
§ Assessment of variation in microbial community amplicon sequencing by the Microbiome Quality Control (MBQC) project consortium > Results > Taxonomic profiles
plaindirect- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: unclear — It is unclear whether the paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
It may state two separate claims as one.
A result the paper reports from its own data — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“Fecal and oral microbes were depleted in all bioinformatics protocols in the handling lab using V3-4 primers (HL-A), in favor of genus Lactobacillus.”
§ Assessment of variation in microbial community amplicon sequencing by the Microbiome Quality Control (MBQC) project consortium > Results > Positive controls
plaindirect- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: unclear — It is unclear whether the paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
It may state two separate claims as one.
A result the paper reports from its own data — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“Human-derived samples averaged 383 ±326 OTUs, with 325 ±244 in chemostat-derived samples, 187 ±200 in positive control artificial communities, and 302 ±283 in negative controls”
§ Assessment of variation in microbial community amplicon sequencing by the Microbiome Quality Control (MBQC) project consortium > Results > Taxonomic profiles
plain- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: unclear — It is unclear whether the paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
It may state two separate claims as one.
A result the paper reports from its own data — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“Quantitative alpha diversity was relatively robust to protocol differences (Fig. 3A), although both bioinformatics and sample handling protocols tended to affect the median observed diversity more than biological specimen type.”
§ Assessment of variation in microbial community amplicon sequencing by the Microbiome Quality Control (MBQC) project consortium > Results > Variation in taxonomic profiles
hedgeddirect- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: passes — The paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
It may state two separate claims as one.
A result the paper reports from its own data — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“While each bioinformatics laboratory induced a modest overall shift in a samples’ microbial profile, only one laboratory (BL-8) resulted in a consistent, large shift in the sample composition.”
§ Assessment of variation in microbial community amplicon sequencing by the Microbiome Quality Control (MBQC) project consortium > Results > Variation in taxonomic profiles
plaindirect- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: passes — The paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
It may state two separate claims as one.
A result the paper reports from its own data — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“The combination of read-level QC and OTU assignment yielded an average of ~40M reads per sample handling laboratory and ~35,000 ±43,700 reads/sample, for a total of 15,749 filtered samples”
§ Assessment of variation in microbial community amplicon sequencing by the Microbiome Quality Control (MBQC) project consortium > Results > Taxonomic profiles
plainn = 15,749- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: unclear — It is unclear whether the paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
It may state two separate claims as one.
In the paper
“Sources of contamination varied, including one lab with samples comprising mainly Lactobacillus (HL-A), three labs with Pseudomonas (possibly reagent contamination23 , HL-B, HL-F, and HL-D), and sequence, bioinformatic, and/or physical contamination from gut-derived samples in all laboratories.”
§ Assessment of variation in microbial community amplicon sequencing by the Microbiome Quality Control (MBQC) project consortium > Results > Negative controls
What the sources say
- Not checked yetcites [23] Salter, S.J. et al. Reagent and laboratory contamination can critically impact sequence-based microbiome analyses. BMC Biol. 12, 87 (2014). source
hedgedconditionaln = 345- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: passes — The paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
It may state two separate claims as one.
- Rests on an assumption: Negative control buffer aliquots are expected to contain no microbial DNA or OTUs, so any OTUs detected in them indicate contamination.
A result the paper reports from its own data — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“Reads and QC together produced 27,211 OTUs with Greengenes v13.5 identifiers”
§ Assessment of variation in microbial community amplicon sequencing by the Microbiome Quality Control (MBQC) project consortium > Results > Taxonomic profiles
plain- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: fails — The paper’s conclusions may not depend on it.
- Based: passes — The paper gives a reason why it holds.
Probably not a substantial claim. The paper’s conclusions may not depend on it.
In the paper
“Centrally extracted (pre-extracted) samples were associated with higher abundances of Bacteroidetes; since all pre-extracted samples were extracted using a MO-BIO kit, these results are consistent with reports showing that the MO-BIO based HMP protocol generated data enriched for genera within the Bacteroidetes24.”
§ Assessment of variation in microbial community amplicon sequencing by the Microbiome Quality Control (MBQC) project consortium > Results > Multivariate quantification of variation
What the sources say
- Not checked yetcites [24] Wesolowska-Andersen, A. et al. Choice of bacterial DNA extraction method from fecal material influences community structure as evaluated by metagenomic analysis. Microbiome 2, 19 (2014). source
plaincorrelational- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: unclear — It is unclear whether the paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
It may state two separate claims as one.
A result the paper reports from its own data — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“from the four phyla present in at least half of all subjects (Bacteroidetes, Firmicutes, Actinobacteria, and Proteobacteria).”
§ Assessment of variation in microbial community amplicon sequencing by the Microbiome Quality Control (MBQC) project consortium > Online Methods > Data Integration
plain- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: fails — The paper’s conclusions may not depend on it.
- Based: passes — The paper gives a reason why it holds.
Probably not a substantial claim. The paper’s conclusions may not depend on it.
A result the paper reports from its own data — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“only one laboratory did not use paired end reads.”
§ Assessment of variation in microbial community amplicon sequencing by the Microbiome Quality Control (MBQC) project consortium > Online Methods > Sequencing
plain- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: fails — The paper’s conclusions may not depend on it.
- Based: passes — The paper gives a reason why it holds.
Probably not a substantial claim. The paper’s conclusions may not depend on it.
A result the paper reports from its own data — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“Fourteen of the fifteen laboratories used V4 forward primer 515F (GTGCCAGCMGCCGCGGTAA) and all the laboratories used reverse primer number 806R (GGACTACHVGGGTWTCTAAT); the remaining laboratory used V3-4 forward primer 318F (ACTCCTACGGGAGGCAGCAG)6–8.”
§ Assessment of variation in microbial community amplicon sequencing by the Microbiome Quality Control (MBQC) project consortium > Online Methods > 16S rRNA gene amplification primers
plain- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: fails — The paper’s conclusions may not depend on it.
- Based: passes — The paper gives a reason why it holds.
Probably not a substantial claim. The paper’s conclusions may not depend on it. It may state two separate claims as one.
The paper states this without a source or data behind it here, so there is nothing to check it against. The quote shows it is in the paper.
In the paper
“Overlapping reads were stitched (and often filtered) using QIIME9, UPARSE10, FLASH11, PANDAseq12, or custom software.”
§ Assessment of variation in microbial community amplicon sequencing by the Microbiome Quality Control (MBQC) project consortium > Online Methods > Bioinformatics
plain- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: fails — The paper’s conclusions may not depend on it.
- Based: passes — The paper gives a reason why it holds.
Probably not a substantial claim. The paper’s conclusions may not depend on it.
A result the paper reports from its own data — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“Three labs reported filtering OTUs from the resulting table for quality control after creation, and one reported filtering samples.”
§ Assessment of variation in microbial community amplicon sequencing by the Microbiome Quality Control (MBQC) project consortium > Online Methods > Bioinformatics
plainn = 4- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: fails — The paper’s conclusions may not depend on it.
- Based: passes — The paper gives a reason why it holds.
Probably not a substantial claim. The paper’s conclusions may not depend on it. It may state two separate claims as one.
A result the paper reports from its own data — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“Only methods included in QIIME (N=6) or UPARSE (N=4) were used for OTU creation, although taxonomic assignments in some cases also used the RDP classification 13 or custom software.”
§ Assessment of variation in microbial community amplicon sequencing by the Microbiome Quality Control (MBQC) project consortium > Online Methods > Bioinformatics
plainn = 6- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: fails — The paper’s conclusions may not depend on it.
- Based: passes — The paper gives a reason why it holds.
Probably not a substantial claim. The paper’s conclusions may not depend on it. It may state two separate claims as one.
A result the paper reports from its own data — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“In the laboratories that froze the extracted DNA, it remained frozen anywhere from 1 day to 45 days.”
§ Assessment of variation in microbial community amplicon sequencing by the Microbiome Quality Control (MBQC) project consortium > Online Methods > 16S rRNA gene amplification primers
plain- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: fails — The paper’s conclusions may not depend on it.
- Based: passes — The paper gives a reason why it holds.
Probably not a substantial claim. The paper’s conclusions may not depend on it.
A result the paper reports from its own data — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“For the MiSeq runs, Illumina chemistry V2 was used most often, with 2 laboratories using V3 chemistry and one laboratory using V4 chemistry.”
§ Assessment of variation in microbial community amplicon sequencing by the Microbiome Quality Control (MBQC) project consortium > Online Methods > Sequencing
plain- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: fails — The paper’s conclusions may not depend on it.
- Based: passes — The paper gives a reason why it holds.
Probably not a substantial claim. The paper’s conclusions may not depend on it. It may state two separate claims as one.
A result the paper reports from its own data — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“Four laboratories used a sequencing read length of 150 base pairs, 1 used a sequencing read length of 175 base pairs, 1 used a sequencing read of 210 base pairs, 6 used a sequencing read length of 250 base pairs, and 2 used a sequencing read length of 300 base pairs.”
§ Assessment of variation in microbial community amplicon sequencing by the Microbiome Quality Control (MBQC) project consortium > Online Methods > Sequencing
plain- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: fails — The paper’s conclusions may not depend on it.
- Based: passes — The paper gives a reason why it holds.
Probably not a substantial claim. The paper’s conclusions may not depend on it. It may state two separate claims as one.
A result the paper reports from its own data — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“After PCR amplification, samples were frozen in all laboratories except for two at 4 °C or −20 °C for anywhere from 1 day to 39 days.”
§ Assessment of variation in microbial community amplicon sequencing by the Microbiome Quality Control (MBQC) project consortium > Online Methods > Sequencing
plain- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: fails — The paper’s conclusions may not depend on it.
- Based: passes — The paper gives a reason why it holds.
Probably not a substantial claim. The paper’s conclusions may not depend on it.
A result the paper reports from its own data — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“During sequencing, the fraction of PhiX ranged from 0 to 0.25”
§ Assessment of variation in microbial community amplicon sequencing by the Microbiome Quality Control (MBQC) project consortium > Online Methods > Sequencing
plain- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: fails — The paper’s conclusions may not depend on it.
- Based: passes — The paper gives a reason why it holds.
Probably not a substantial claim. The paper’s conclusions may not depend on it.
A result the paper reports from its own data — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“Most (N=7) also included a minimum (or percent) length threshold to retain reads, and many (N=5) performed explicit chimera checking as well.”
§ Assessment of variation in microbial community amplicon sequencing by the Microbiome Quality Control (MBQC) project consortium > Online Methods > Bioinformatics
plainn = 7- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: fails — The paper’s conclusions may not depend on it.
- Based: passes — The paper gives a reason why it holds.
Probably not a substantial claim. The paper’s conclusions may not depend on it. It may state two separate claims as one.
A result the paper reports from its own data — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“the fraction of quality bases (using the Illumina default Q=15) ranged from 0.573 to 0.961”
§ Assessment of variation in microbial community amplicon sequencing by the Microbiome Quality Control (MBQC) project consortium > Online Methods > Sequencing
plain- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: fails — The paper’s conclusions may not depend on it.
- Based: passes — The paper gives a reason why it holds.
Probably not a substantial claim. The paper’s conclusions may not depend on it.
A result the paper reports from its own data — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“The Illumina MiSeq was used for sequencing in all laboratories except for one, which used the HiSeq;”
§ Assessment of variation in microbial community amplicon sequencing by the Microbiome Quality Control (MBQC) project consortium > Online Methods > Sequencing
plain- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: fails — The paper’s conclusions may not depend on it.
- Based: passes — The paper gives a reason why it holds.
Probably not a substantial claim. The paper’s conclusions may not depend on it. It may state two separate claims as one.
A result the paper reports from its own data — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“All bioinformatic protocols removed a subset of raw reads based on low-quality base trimming, although exact criteria varied (Q threshold, from end vs. within window, etc.)”
§ Assessment of variation in microbial community amplicon sequencing by the Microbiome Quality Control (MBQC) project consortium > Online Methods > Bioinformatics
plain- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: fails — The paper’s conclusions may not depend on it.
- Based: passes — The paper gives a reason why it holds.
Probably not a substantial claim. The paper’s conclusions may not depend on it. It may state two separate claims as one.
A result the paper reports from its own data — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“After DNA was extracted, most laboratories froze the samples at 4 °C, −20 °C, or −80 °C prior to amplification, except for one which began amplification the day of DNA extraction.”
§ Assessment of variation in microbial community amplicon sequencing by the Microbiome Quality Control (MBQC) project consortium > Online Methods > 16S rRNA gene amplification primers
plain- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: fails — The paper’s conclusions may not depend on it.
- Based: passes — The paper gives a reason why it holds.
Probably not a substantial claim. The paper’s conclusions may not depend on it. It may state two separate claims as one.
What the paper did — it cites no source for this, so there is none to check. The quote shows it is in the paper.
In the paper
“Re-blinded data were analyzed by nine bioinformatics labs, to produce more than 16,000 taxonomic profiles”
§ Assessment of variation in microbial community amplicon sequencing by the Microbiome Quality Control (MBQC) project consortium > Introduction
plain- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: unclear — It is unclear whether the paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
It may state two separate claims as one.
What the paper did — it cites no source for this, so there is none to check. The quote shows it is in the paper.
In the paper
“Blinded specimen sets from human stool, chemostats and artificial microbial communities were sequenced by 15 laboratories and analyzed using nine bioinformatics protocols.”
§ Assessment of variation in microbial community amplicon sequencing by the Microbiome Quality Control (MBQC) project consortium > Abstract
plain- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: passes — The paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
It may state two separate claims as one.
What the paper did — it cites no source for this, so there is none to check. The quote shows it is in the paper.
In the paper
“This baseline MBQC was carried out by volunteer laboratories; all samples were provided by a central repository, blinded, and handled by 15 laboratories.”
§ Assessment of variation in microbial community amplicon sequencing by the Microbiome Quality Control (MBQC) project consortium > Introduction
plain- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: passes — The paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
Probably not a substantial claim. It may state two separate claims as one.
What the paper did — it cites no source for this, so there is none to check. The quote shows it is in the paper.
In the paper
“Near-balanced replicates/triplicates (54 vs. 42 aliquots, respectively) and raw aliquots (53 raw vs. 43 pre-extracted) were the best-powered in our simulations and hence yielded the final aliquot set design.”
§ Assessment of variation in microbial community amplicon sequencing by the Microbiome Quality Control (MBQC) project consortium > Results > Specimen selection, set design, and blinding
plaindirect- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: passes — The paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
It may state two separate claims as one.
A conclusion the paper draws from its own results — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“estimates of absolute diversity are not comparable among laboratories even when processed using the same bioinformatics pipeline, whereas relative diversity levels are on average consistent among similar sample types.”
§ Assessment of variation in microbial community amplicon sequencing by the Microbiome Quality Control (MBQC) project consortium > Results > Variation among biospecimens
plain- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: passes — The paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
It may state two separate claims as one.
What the paper did — it cites no source for this, so there is none to check. The quote shows it is in the paper.
In the paper
“The resulting combination of specimens and extracted DNA comprised 96 aliquots with 60% duplicates and 40% triplicates.”
§ Assessment of variation in microbial community amplicon sequencing by the Microbiome Quality Control (MBQC) project consortium > Results > Specimen selection, set design, and blinding
plain- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: passes — The paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
Probably not a substantial claim. It may state two separate claims as one.
What the paper did — it cites no source for this, so there is none to check. The quote shows it is in the paper.
In the paper
“Handling laboratories each received one or more blinded copies of the 96-aliquot set and processed them within a small number of fixed constraints.”
§ Assessment of variation in microbial community amplicon sequencing by the Microbiome Quality Control (MBQC) project consortium > Results > MBQC-base study design
plain- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: passes — The paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
Probably not a substantial claim. It may state two separate claims as one.
None of the sources cited for this claim have been checked yet.
In the paper
“choices of 16S rRNA gene variable region primers may enable improved detection or differentiation of microbes16; for example, Propionibacterium spp. abundant on the skin are often undetected by V4 primers29, and Lactobacillus spp. in the vagina are better differentiated by including V321.”
§ Assessment of variation in microbial community amplicon sequencing by the Microbiome Quality Control (MBQC) project consortium > Discussion
What the sources say
- Not checked yetcites [16] Soergel, D.A., Dey, N., Knight, R. & Brenner, S.E. Selection of primers for optimal taxonomic classification of environmental 16S rRNA gene sequences. ISME J. 6, 1440–1444 (2012). source
- Not checked yetcites [29] Nelson, M.C., Morrison, H.G., Benjamino, J., Grim, S.L. & Graf, J. Analysis, optimization and verification of Illumina-generated 16S rRNA gene amplicon surveys. PLoS One 9, e94249 (2014). source
- Not checked yetcites [21] Fadrosh, D.W. et al. An improved dual-indexing approach for multiplexed 16S rRNA gene sequencing on the Illumina MiSeq platform. Microbiome 2, 6 (2014). source
hedgedconditional- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: fails — The paper’s conclusions may not depend on it.
- Based: passes — The paper gives a reason why it holds.
Probably not a substantial claim. The paper’s conclusions may not depend on it. It may state two separate claims as one.
A conclusion the paper draws from its own results — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“Grossly different beta-diversity profiles were generally caused by a subset of samples that were strikingly dissimilar, rather than consistent differences in all of the samples, indicating that a handful of samples may have been contaminated, mislabeled, or otherwise altered in these laboratories.”
§ Assessment of variation in microbial community amplicon sequencing by the Microbiome Quality Control (MBQC) project consortium > Results > Variation in taxonomic profiles
hedgedconditional- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: passes — The paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
It may state two separate claims as one.
What the paper did — it cites no source for this, so there is none to check. The quote shows it is in the paper.
In the paper
“Fifteen laboratories carried out extraction and/or 16S amplicon sequencing, and the raw sequence data were re-blinded and distributed for processing to nine bioinformatics labs”
§ Assessment of variation in microbial community amplicon sequencing by the Microbiome Quality Control (MBQC) project consortium > Results > MBQC-base study design
plain- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: passes — The paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
Probably not a substantial claim. It may state two separate claims as one.
A conclusion the paper draws from its own results — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“While the MBQC-base sample size is too small to quantify the relative sizes of these effects, sequencing error, extraction efficiency, computational stringency, bar-hopping, and contamination may all have detectable and combinatorial roles in taxonomic profiling errors.”
§ Assessment of variation in microbial community amplicon sequencing by the Microbiome Quality Control (MBQC) project consortium > Results > Positive controls
hedgedconditional- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: passes — The paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
It may state two separate claims as one.
What the paper did — it cites no source for this, so there is none to check. The quote shows it is in the paper.
In the paper
“All aliquots in the set were assigned blinded identifiers prior to distribution, such that handling labs received no information linking aliquots either to replicates or to specimens of origin.”
§ Assessment of variation in microbial community amplicon sequencing by the Microbiome Quality Control (MBQC) project consortium > Results > Specimen selection, set design, and blinding
plaindirect- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: passes — The paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
Probably not a substantial claim. It may state two separate claims as one.
A conclusion the paper draws from its own results — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“This agrees with our observation that relative diversity levels remain consistent (Supplementary Fig. 2–4), because each protocol will have a set of biases that affect all samples equally.”
§ Assessment of variation in microbial community amplicon sequencing by the Microbiome Quality Control (MBQC) project consortium > Results > Variation among biospecimens
plaindirect- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: passes — The paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
It may state two separate claims as one.
What the paper did — it cites no source for this, so there is none to check. The quote shows it is in the paper.
In the paper
“aliquots of the 22 specimens were extracted at a central facility using the MO-BIO PowerSoil kit.”
§ Assessment of variation in microbial community amplicon sequencing by the Microbiome Quality Control (MBQC) project consortium > Results > Specimen selection, set design, and blinding
plainn = 22- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: passes — The paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
Probably not a substantial claim.
What the paper did — it cites no source for this, so there is none to check. The quote shows it is in the paper.
In the paper
“Each sample handling laboratory deposited demultiplexed FASTQ files containing the resulting data at the DACC, which were then re-blinded for distribution to bioinformatics participants”
§ Assessment of variation in microbial community amplicon sequencing by the Microbiome Quality Control (MBQC) project consortium > Results > Sample handling and bioinformatics protocols
plain- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: fails — The paper’s conclusions may not depend on it.
- Based: passes — The paper gives a reason why it holds.
Probably not a substantial claim. The paper’s conclusions may not depend on it. It may state two separate claims as one.
None of the sources cited for this claim have been checked yet.
In the paper
“different human host cohorts may harbor remarkably different Gram-negative versus Gram-positive diversity3, 30, and a protocol appropriate for one type of community may work well in one study but not in another.”
§ Assessment of variation in microbial community amplicon sequencing by the Microbiome Quality Control (MBQC) project consortium > Discussion
What the sources say
- Not checked yetcites [3] Yatsunenko, T. et al. Human gut microbiome viewed across age and geography. Nature 486, 222–227 (2012). source
- Not checked yetcites [30] De Filippo, C. et al. Impact of diet in shaping gut microbiota revealed by a comparative study in children from Europe and rural Africa. Proc. Natl. Acad. Sci. USA 107, 14691–14696 (2010). source
hedgedconditional- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: unclear — It is unclear whether the paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
It may state two separate claims as one.
A conclusion the paper draws from its own results — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“human- and chemostat-derived samples do not segregate substantially in this high-level overview, highlighting the latter’s value as biologically-realistic positive controls.”
§ Assessment of variation in microbial community amplicon sequencing by the Microbiome Quality Control (MBQC) project consortium > Results > Taxonomic profiles
plain- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: passes — The paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
It may state two separate claims as one.
A conclusion the paper draws from its own results — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“A per-barcode synthesis error rate comparable to the per-read errors above (~0.2%) is sufficient to explain much of this effect, leading to a non-negligible fraction of reads being assigned to the wrong sample through barcode hopping (“bar-hopping”).”
§ Assessment of variation in microbial community amplicon sequencing by the Microbiome Quality Control (MBQC) project consortium > Results > Positive controls
plaindirect- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: passes — The paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
It may state two separate claims as one.
What the paper did — it cites no source for this, so there is none to check. The quote shows it is in the paper.
In the paper
“A subset of specimens were centrally extracted and replicated or triplicated into 96-sample aliquot sets that were shipped to handling laboratories”
§ Assessment of variation in microbial community amplicon sequencing by the Microbiome Quality Control (MBQC) project consortium > Results > MBQC-base study design
plain- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: passes — The paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
Probably not a substantial claim.
What the paper did — it cites no source for this, so there is none to check. The quote shows it is in the paper.
In the paper
“All sample types, metadata, and phenotypes remained blinded to participants until consolidated data release at the end of the baseline experiment.”
§ Assessment of variation in microbial community amplicon sequencing by the Microbiome Quality Control (MBQC) project consortium > Online Methods > Sample sets
plain- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: fails — The paper’s conclusions may not depend on it.
- Based: passes — The paper gives a reason why it holds.
Probably not a substantial claim. The paper’s conclusions may not depend on it.
What the paper did — it cites no source for this, so there is none to check. The quote shows it is in the paper.
In the paper
“P-values for fixed and random effects were calculated using a likelihood-ratio test and adjusted using the Benjamini-Hochberg-Yekutieli method across all four phyla per model.”
§ Assessment of variation in microbial community amplicon sequencing by the Microbiome Quality Control (MBQC) project consortium > Online Methods > Data Integration
plain- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: fails — The paper’s conclusions may not depend on it.
- Based: passes — The paper gives a reason why it holds.
Probably not a substantial claim. The paper’s conclusions may not depend on it.
What the paper did — it cites no source for this, so there is none to check. The quote shows it is in the paper.
In the paper
“We first fit a full model with fixed effects for pre-extraction, collapsed specimen type, collapsed health status, PCR primer, read length, collapsed sequencing chemistry version, PhiX fraction, fraction quality bases, log read count, collapsed OTU software, OTU clustering, taxonomic assignment method, and OTU filtering”
§ Assessment of variation in microbial community amplicon sequencing by the Microbiome Quality Control (MBQC) project consortium > Online Methods > Data Integration
plain- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: passes — The paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
Probably not a substantial claim.
What the paper did — it cites no source for this, so there is none to check. The quote shows it is in the paper.
In the paper
“Participating labs were blinded to sample collection methods or sample types.”
§ Assessment of variation in microbial community amplicon sequencing by the Microbiome Quality Control (MBQC) project consortium > Online Methods > Sample sets
plainn = 15- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: passes — The paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
Probably not a substantial claim. It may state two separate claims as one. The quote only partly states this claim.
What the paper did — it cites no source for this, so there is none to check. The quote shows it is in the paper.
In the paper
“Separate accounts were created for each bioinformatics laboratory with separate document roots so that each laboratory would not have visibility into the data uploaded by its peers.”
§ Assessment of variation in microbial community amplicon sequencing by the Microbiome Quality Control (MBQC) project consortium > Online Methods > Bioinformatics
plaindirect- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: fails — The paper’s conclusions may not depend on it.
- Based: passes — The paper gives a reason why it holds.
Probably not a substantial claim. The paper’s conclusions may not depend on it.
What the paper did — it cites no source for this, so there is none to check. The quote shows it is in the paper.
In the paper
“Arcsine-square root transformed abundances (for variance stabilization) were used as outcomes”
§ Assessment of variation in microbial community amplicon sequencing by the Microbiome Quality Control (MBQC) project consortium > Online Methods > Data Integration
plain- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: passes — The paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
Probably not a substantial claim.
In the paper
“Artificial communities were developed from in-house isolates representative of the range of bacterial genera found within the oral or gut habitats, including both Gram positive and Gram negative bacteria with a range of genomic G+C ratios (Supplementary Table 1).”
§ Assessment of variation in microbial community amplicon sequencing by the Microbiome Quality Control (MBQC) project consortium > Online Methods > Biological specimens
What the sources say
- Not checked yetcites Supplementary Table 1
plain- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: passes — The paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
Probably not a substantial claim.
The paper states this without a source or data behind it here, so there is nothing to check it against. The quote shows it is in the paper.
In the paper
“many studies, including ours, agree that DNA extraction (particularly bead beating), 16S rRNA gene primer selection, and negative control contamination have large effects on variation.”
§ Assessment of variation in microbial community amplicon sequencing by the Microbiome Quality Control (MBQC) project consortium > Discussion
plaindirect- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: passes — The paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
It may state two separate claims as one.
The paper states this without a source or data behind it here, so there is nothing to check it against. The quote shows it is in the paper.
In the paper
“Previous results have been mixed in their characterization of sequencing platform effects; we included Illumina MiSeq and HiSeq 16S data, but earlier evaluations capture these, Roche 454, Ion Torrent, Pacific Biosciences, and other technologies (including comparisons of amplicon and shotgun metagenomic sequencing).”
§ Assessment of variation in microbial community amplicon sequencing by the Microbiome Quality Control (MBQC) project consortium > Discussion
plain- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: fails — The paper’s conclusions may not depend on it.
- Based: passes — The paper gives a reason why it holds.
Probably not a substantial claim. The paper’s conclusions may not depend on it. It may state two separate claims as one.
What the paper did — it cites no source for this, so there is none to check. The quote shows it is in the paper.
In the paper
“Sample sets were designed by simulation under the constraints that, of 96 total samples, 40–60% should be pre-extracted DNA (the remainder raw specimens), 40–60% should represent duplicates, and 40–60% triplicates.”
§ Assessment of variation in microbial community amplicon sequencing by the Microbiome Quality Control (MBQC) project consortium > Online Methods > Sample sets
plainn = 96- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: passes — The paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
Probably not a substantial claim. It may state two separate claims as one. The quote only partly states this claim.
In the paper
“All strains were originally isolated from human subjects, and HMP genome reference strains were included where available5.”
§ Assessment of variation in microbial community amplicon sequencing by the Microbiome Quality Control (MBQC) project consortium > Online Methods > Biological specimens
What the sources say
- Not checked yetcites [5] Vatanen, T. et al. Variation in microbiome LPS immunogenicity contributes to autoimmunity in humans. Cell 165, 842–853 (2016). source
plain- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: fails — The paper’s conclusions may not depend on it.
- Based: passes — The paper gives a reason why it holds.
Probably not a substantial claim. The paper’s conclusions may not depend on it. It may state two separate claims as one.
What the paper did — it cites no source for this, so there is none to check. The quote shows it is in the paper.
In the paper
“After the data uploads were completed and an initial round of quality control performed, the document root names belonging to each laboratory were renamed to randomly generated strings so that each dataset was anonymized.”
§ Assessment of variation in microbial community amplicon sequencing by the Microbiome Quality Control (MBQC) project consortium > Online Methods > Bioinformatics
plaindirect- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: fails — The paper’s conclusions may not depend on it.
- Based: passes — The paper gives a reason why it holds.
Probably not a substantial claim. The paper’s conclusions may not depend on it.
In the paper
“Sequencing data for positive controls diverge in almost every published study28, including ours (Supplementary Dataset 1), which confirms that relative, not absolute, measures are comparable between protocols.”
§ Assessment of variation in microbial community amplicon sequencing by the Microbiome Quality Control (MBQC) project consortium > Discussion
What the sources say
- Not checked yetcites [28] Morgan, J.L., Darling, A.E. & Eisen, J.A. Metagenomic sequencing of an in vitro-simulated microbial community. PLoS One 5, e10209 (2010). source
boosteddirect- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: passes — The paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
It may state two separate claims as one.
What the paper did — it cites no source for this, so there is none to check. The quote shows it is in the paper.
In the paper
“and a random effect for specimen number.”
§ Assessment of variation in microbial community amplicon sequencing by the Microbiome Quality Control (MBQC) project consortium > Online Methods > Data Integration
plain- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: fails — The paper’s conclusions may not depend on it.
- Based: passes — The paper gives a reason why it holds.
Probably not a substantial claim. The paper’s conclusions may not depend on it.
What the paper did — it cites no source for this, so there is none to check. The quote shows it is in the paper.
In the paper
“and random effects for specimen number, handling laboratory, and bioinformatics laboratory.”
§ Assessment of variation in microbial community amplicon sequencing by the Microbiome Quality Control (MBQC) project consortium > Online Methods > Data Integration
plain- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: fails — The paper’s conclusions may not depend on it.
- Based: passes — The paper gives a reason why it holds.
Probably not a substantial claim. The paper’s conclusions may not depend on it.
What the paper did — it cites no source for this, so there is none to check. The quote shows it is in the paper.
In the paper
“We also fit a simplified model with fixed effects for handling laboratory, bioinformatics laboratory, and pre-extraction”
§ Assessment of variation in microbial community amplicon sequencing by the Microbiome Quality Control (MBQC) project consortium > Online Methods > Data Integration
plain- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: fails — The paper’s conclusions may not depend on it.
- Based: passes — The paper gives a reason why it holds.
Probably not a substantial claim. The paper’s conclusions may not depend on it.
What the paper did — it cites no source for this, so there is none to check. The quote shows it is in the paper.
In the paper
“one of the several sample configurations that near-equally maximized power to partition variance (as described below by multivariate modeling) was selected for construction and distribution.”
§ Assessment of variation in microbial community amplicon sequencing by the Microbiome Quality Control (MBQC) project consortium > Online Methods > Sample sets
plaincorrelationaln = 96- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: passes — The paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
Probably not a substantial claim.
What the paper did — it cites no source for this, so there is none to check. The quote shows it is in the paper.
In the paper
“Since this protocol was run centrally post-hoc, it was not recorded formally nor included in most systematic, blinded analyses.”
§ Assessment of variation in microbial community amplicon sequencing by the Microbiome Quality Control (MBQC) project consortium > Online Methods > Bioinformatics
plain- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: fails — The paper’s conclusions may not depend on it.
- Based: passes — The paper gives a reason why it holds.
Probably not a substantial claim. The paper’s conclusions may not depend on it. It may state two separate claims as one.
None of the sources cited for this claim have been checked yet.
In the paper
“newly diagnosed cases with adenocarcinoma of the colon or rectum were recruited prior to surgery and treatment during 1985–19891, 2. Controls were patients awaiting elective surgery for non-oncologic, non-gastrointestinal conditions at these hospitals during the same period.”
§ Assessment of variation in microbial community amplicon sequencing by the Microbiome Quality Control (MBQC) project consortium > Online Methods > Biological specimens
What the sources say
- Not checked yetcites [1] Human Microbiome Project Consortium. Structure, function and diversity of the healthy human microbiome. Nature 486, 207–214 (2012). source
- Not checked yetcites [2] Qin, J. et al. A human gut microbial gene catalogue established by metagenomic sequencing. Nature 464, 59–65 (2010). source
plainn = 4- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: fails — The paper’s conclusions may not depend on it.
- Based: passes — The paper gives a reason why it holds.
Probably not a substantial claim. The paper’s conclusions may not depend on it.
The paper relies on this without support.
Negative control buffer aliquots are expected to contain no microbial DNA or OTUs, so any OTUs detected in them indicate contamination.
“We included Tris-HCl buffer aliquots as negative control samples (two per 96-sample set)”
“At least one OTU was reported in 342 of these samples”
The paper relies on this without support.
Comparing centrally extracted DNA with locally extracted DNA isolates the effect of DNA extraction from PCR and sequencing effects.
“We separated variation caused by DNA extraction from variation owing to PCR and sequencing by comparing centrally- versus locally-extracted samples”
Claims other papers make about this one
Each is checked against this paper’s own text: does it say what the citing paper says it does?
In the citing paper
“The central analysis of samples in this study was another important element because both wet-laboratory processing and computational pipelines are critical factors in the reproducibility and quality of microbiota data.45”
From Microbiota as Predictor of Mortality in Allogeneic Hematopoietic-Cell Transplantation (2020) · cites this paper as [45]
In the citing paper
“analogous to the Microbiome Quality Control consortium's analysis of fecal amplicon sequencing among 15 laboratories and nine bioinformatic protocols (163).”
From The microbiome and human cancer (2021) · cites this paper as [163]
Self-check
Percentages, sums and reported differences re-computed from the paper’s own numbers.
Each contradiction between two passages listed here was confirmed by an independent check.
Rated major: it would touch a result — a value a result rests on, reported and recomputed p-values on opposite sides of the significance level, two passages that conflict with no sign which is right, or a cited work retracted before this paper was published.
In the paper
§ Assessment of variation in microbial community amplicon sequencing by the Microbiome Quality Control (MBQC) project consortium > Online Methods > Biological specimens
“A 10% (w/v) fecal slurry was prepared by homogenizing 5 g of feces in 50 mL of pre-reduced growth medium for 1 min using a stomacher (Tekmar Stomacher Lab Blender, Seward; Worthing, West Sussex, UK).”
§ Assessment of variation in microbial community amplicon sequencing by the Microbiome Quality Control (MBQC) project consortium > Online Methods > Biological specimens
“The resulting slurry was centrifuged for 10 min at 175 ×g to remove large food particles4, and 100 mL of the supernatant slurry was added to 300 mL of sterile growth medium in each vessel.”
Rated minor: it would not touch a result — a value no result rests on, a p-value that stays on the same side of the significance level, or a conflict that is clerical, resolved elsewhere in the paper, or outside its own findings.
In the paper
§ Assessment of variation in microbial community amplicon sequencing by the Microbiome Quality Control (MBQC) project consortium > Results > Multivariate quantification of variation
“the four major gut phyla (Actinobacteria, Bacteroides, Firmicutes, and Proteobacteria; see Methods; Supplementary Table 8, Supplementary Fig. 15, Fig. 5)”
§ Assessment of variation in microbial community amplicon sequencing by the Microbiome Quality Control (MBQC) project consortium > Online Methods > Data Integration
“the four phyla present in at least half of all subjects (Bacteroidetes, Firmicutes, Actinobacteria, and Proteobacteria)”
Rated minor: it would not touch a result — a value no result rests on, a p-value that stays on the same side of the significance level, or a conflict that is clerical, resolved elsewhere in the paper, or outside its own findings.
In the paper
§ Assessment of variation in microbial community amplicon sequencing by the Microbiome Quality Control (MBQC) project consortium > Online Methods > DNA extraction
“The majority of laboratories (N=6) used the MO-BIO PowerSoil kit for DNA extraction and one used the MO-BIO PowerMag kit.”
§ Assessment of variation in microbial community amplicon sequencing by the Microbiome Quality Control (MBQC) project consortium > Results > MBQC-base study design
“Fifteen laboratories carried out extraction and/or 16S amplicon sequencing”
Citations
Cites
Trimmomatic: a flexible trimmer for Illumina sequence data
Bolger, A. M., Lohse, M., & Usadel, B. (2014) · Bioinformatics · doi:10.1093/bioinformatics/btu170 · Cited by 65,548
QIIME allows analysis of high-throughput community sequencing data
Caporaso, J. G., Kuczynski, J., Stombaugh, J., Bittinger, K., Bushman, F. D., Costello, E. K., Fierer, N., Peña, A. G., Goodrich, J. K., Gordon, J. I., et al. (2010) · Nature Methods · doi:10.1038/nmeth.f.303 · Cited by 34,887
Self-citationSchloss, P. D., Westcott, S. L., Ryabin, T., Hall, J. R., Hartmann, M., Hollister, E. B., Lesniewski, R. A., Oakley, B. B., Parks, D. H., Robinson, C. J., et al. (2009) · Applied and Environmental Microbiology · doi:10.1128/aem.01541-09 · Cited by 19,549
UPARSE: highly accurate OTU sequences from microbial amplicon reads
Edgar, R. C. (2013) · Nature Methods · doi:10.1038/nmeth.2604 · Cited by 16,770
FLASH: fast length adjustment of short reads to improve genome assemblies
Magoč, T., & Salzberg, S. L. (2011) · Bioinformatics · doi:10.1093/bioinformatics/btr507 · Cited by 15,366
Structure, function and diversity of the healthy human microbiome
The Human Microbiome Project Consortium (2012) · Nature · doi:10.1038/nature11234 · Cited by 11,726
A human gut microbial gene catalogue established by metagenomic sequencing
MetaHIT Consortium, Qin, J., Li, R., Raes, J., Arumugam, M., Burgdorf, K. S., Manichanh, C., Nielsen, T., Pons, N., Levenez, F., et al. (2010) · Nature · doi:10.1038/nature08821 · Cited by 11,624
Ultra-high-throughput microbial community analysis on the Illumina HiSeq and MiSeq platforms
Caporaso, J. G., Lauber, C. L., Walters, W. A., Berg-Lyons, D., Huntley, J., Fierer, N., Owens, S. M., Betley, J., Fraser, L., Bauer, M., et al. (2012) · The ISME Journal · doi:10.1038/ismej.2012.8 · Cited by 8,839
Self-citationHuman gut microbiome viewed across age and geography
Yatsunenko, T., Rey, F. E., Manary, M. J., Trehan, I., Dominguez-Bello, M. G., Contreras, M., Magris, M., Hidalgo, G., Baldassano, R. N., Anokhin, A. P., et al. (2012) · Nature · doi:10.1038/nature11053 · Cited by 7,815
Self-citationKozich, J. J., Westcott, S. L., Baxter, N. T., Highlander, S. K., & Schloss, P. D. (2013) · Applied and Environmental Microbiology · doi:10.1128/aem.01043-13 · Cited by 7,246
Cited by
Sorted by citations
Current understanding of the human microbiome
Gilbert, J. A., Blaser, M. J., Caporaso, J. G., Jansson, J. K., Lynch, S. V., & Knight, R. (2018) · Nature Medicine · doi:10.1038/nm.4517 · Cited by 2,609
Self-citationGut microbiota-derived metabolites as key actors in inflammatory bowel disease
Lavelle, A., & Sokol, H. (2020) · Nature Reviews Gastroenterology & Hepatology · doi:10.1038/s41575-019-0258-z · Cited by 2,015
Best practices for analysing microbiomes
Knight, R., Vrbanac, A., Taylor, B. C., Aksenov, A., Callewaert, C., Debelius, J., Gonzalez, A., Kosciolek, T., McCall, L.-I., McDonald, D., et al. (2018) · Nature Reviews Microbiology · doi:10.1038/s41579-018-0029-9 · Cited by 2,030
Self-citationLarge-scale association analyses identify host factors influencing human gut microbiome composition
Kurilshikov, A., Medina-Gomez, C., Bacigalupe, R., Radjabzadeh, D., Wang, J., Demirkan, A., Le Roy, C. I., Raygoza Garay, J. A., Finnicum, C. T., Liu, X., et al. (2021) · Nature Genetics · doi:10.1038/s41588-020-00763-1 · Cited by 1,786
Self-citationDrinking Water Nitrate and Human Health: An Updated Review
Ward, M., Jones, R., Brender, J., De Kok, T., Weyer, P., Nolan, B., Villanueva, C., & Van Breda, S. (2018) · International Journal of Environmental Research and Public Health · doi:10.3390/ijerph15071557 · Cited by 1,576
“Tools for measuring bacterial DNA and characterizing the oral microbiome are now available and are currently being incorporated into epidemiologic studies [168,169].”
BackgroundThe microbiome and human cancer
Sepich-Poore, G. D., Zitvogel, L., Straussman, R., Hasty, J., Wargo, J. A., & Knight, R. (2021) · Science · doi:10.1126/science.abc4552 · Cited by 1,332
“data and guide the selection of “gold-standard” pipelines, analogous to theMicrobiomeQuality Control consortium’s analysis of fecal amplicon sequencing among 15 laboratories and nine bioinformatic protocols (163).”
MethodSelf-citationEnterotypes in the landscape of gut microbial community composition
Costea, P. I., Hildebrand, F., Arumugam, M., Bäckhed, F., Blaser, M. J., Bushman, F. D., de Vos, W. M., Ehrlich, S. D., Fraser, C. M., Hattori, M., et al. (2017) · Nature Microbiology · doi:10.1038/s41564-017-0072-8 · Cited by 1,138
Self-citationGlobal diversity and biogeography of bacterial communities in wastewater treatment plants
Wu, L., Ning, D., Zhang, B., Li, Y., Zhang, P., Shan, X., Zhang, Q., Brown, M. R., Li, Z., Nostrand, J. D. V., et al. (2019) · Nature Microbiology · doi:10.1038/s41564-019-0426-5 · Cited by 899
A practical guide to amplicon and metagenomic analysis of microbiome data
Liu, Y., Qin, Y., Chen, T., Lu, M., Qian, X., Guo, X., & Bai, Y. (2020) · Protein & Cell · doi:10.1007/s13238-020-00724-8 · Cited by 931
The Human Gut Microbiome: From Association to Modulation
Schmidt, T. S. B., Raes, J., & Bork, P. (2018) · Cell · doi:10.1016/j.cell.2018.02.044 · Cited by 845
Microbiota as Predictor of Mortality in Allogeneic Hematopoietic-Cell Transplantation
Peled, J. U., Gomes, A. L. C., Devlin, S. M., Littmann, E. R., Taur, Y., Sung, A. D., Weber, D., Hashimoto, D., Slingerland, A. E., Slingerland, J. B., et al. (2020) · New England Journal of Medicine · doi:10.1056/nejmoa1900623 · Cited by 765
Environmental factors shaping the gut microbiome in a Dutch population
Gacesa, R., Kurilshikov, A., Vich Vila, A., Sinha, T., Klaassen, M. A. Y., Bolte, L. A., Andreu-Sánchez, S., Chen, L., Collij, V., Hu, S., et al. (2022) · Nature · doi:10.1038/s41586-022-04567-7 · Cited by 735
Qiita: rapid, web-enabled microbiome meta-analysis
Gonzalez, A., Navas-Molina, J. A., Kościółek, T., McDonald, D. T., Vázquez‐Baeza, Y., Ackermann, G. L., DeReus, J., Janssen, S., Swafford, A. D.-E., Orchanian, S. B., et al. (2018) · Nature Methods · doi:10.1038/s41592-018-0141-9 · Cited by 606
Self-citationGreengenes2 unifies microbial data in a single reference tree
McDonald, D. T., Jiang, Y., Balaban, M., Cantrell, K., Zhu, Q., González, A., Morton, J. T., Nicolaou, G., Parks, D. H., Karst, S. M., et al. (2023) · Nature Biotechnology · doi:10.1038/s41587-023-01845-1 · Cited by 788
“Microbiome science has been described as having a reproducibility crisis 21 , but much of this problem stems from incompatible methods 22 .”
Self-citationShaping the Future of Probiotics and Prebiotics
Cunningham, M., Azcarate-Peril, M. A., Barnard, A., Benoit, V., Grimaldi, R., Guyonnet, D., Holscher, H. D., Hunter, K., Manurung, S., Obis, D., et al. (2021) · Trends in Microbiology · doi:10.1016/j.tim.2021.01.003 · Cited by 637
Lu, Y. P., Zhou, G., Ewald, J., Pang, Z., Shiri, T. J., & Xia, J. (2023) · Nucleic Acids Research · doi:10.1093/nar/gkad407 · Cited by 668
“It is notoriously challenging to achie v e reproducib le fea-tur es across differ ent microbiome studies due to the variations in experimental design, analysis methods and quan-titati v e assessment ( 37 , 38 ).”
Reporting guidelines for human microbiome research: the STORMS checklist
Mirzayi, C. A., Renson, A., Massive Analysis and Quality Control Society, Furlanello, C., Sansone, S., Zohra, F., Elsafoury, S., Geistlinger, L., Kasselman, L. J., Eckenrode, K. B., et al. (2021) · Nature Medicine · doi:10.1038/s41591-021-01552-x · Cited by 587
“These are focused on the technical aspects of data generation, however, as are projects such as the MBQC (Microbiome Quality Control) project 10 and IHMS (International Human Microbiome Standards) 11,12 .”
MethodInfluentialSelf-citationPan-cancer analyses reveal cancer-type-specific fungal ecologies and bacteriome interactions
Narunsky-Haziza, L., Sepich-Poore, G. D., Livyatan, I., Asraf, O., Martino, C., Nejman, D., Gavert, N., Stajich, J. E., Amit, G., González, A., et al. (2022) · Cell · doi:10.1016/j.cell.2022.09.005 · Cited by 538
Self-citationPrimer, Pipelines, Parameters: Issues in 16S rRNA Gene Sequencing
Abellan-Schneyder, I., Matchado, M. S., Reitmeier, S., Sommer, A., Sewald, Z., Baumbach, J., List, M., & Neuhaus, K. (2021) · mSphere · doi:10.1128/msphere.01202-20 · Cited by 542
Lücking, R., Aime, M. C., Robbertse, B., Miller, A. N., Ariyawansa, H. A., Aoki, T., Cardinali, G., Crous, P. W., Druzhinina, I. S., Geiser, D. M., et al. (2020) · IMA Fungus · doi:10.1186/s43008-020-00033-z · Cited by 541
“These approaches have become popular as they are easily integrated into automated pipelines and allow the analysis of extremely large data sets in a short time and with little manual work involved (Majaneva et al. 2015; Sinha et al. 2017; Anslan et al. 2018).”
BackgroundMethodInfluentialConsistent and correctable bias in metagenomic sequencing experiments
McLaren, M. R., Willis, A. D., & Callahan, B. J. (2019) · eLife · doi:10.7554/elife.46923 · Cited by 424
“Previous analyses of bias in MGS experiments have largely relied on descriptive statistical models (Bell et al. 2018; Brooks et al. 2015; Krehenwinkel et al. 2017; Sinha et al. 2017) whose parameters cannot be identified with biophysical quantities that one might expect to apply to differently composed samples.”
BackgroundInfluentialGlenn, T. C., Nilsen, R., Kieran, T. J., Sanders, J. G., Bayona‐Vásquez, N. J., Finger, J. W., Pierson, T. W., Bentley, K. E., Hoffberg, S. L., Louha, S., et al. (2019) · PeerJ · doi:10.7717/peerj.7755 · Cited by 426
Next-generation sequencing: insights to advance clinical investigations of the microbiome
Wensel, C. R., Pluznick, J. L., Salzberg, S. L., & Sears, C. L. (2022) · Journal of Clinical Investigation · doi:10.1172/jci154944 · Cited by 437
“Typically samples are homogenized, but protocols vary substantially from laboratory to laboratory (59).”
BackgroundThe progress of gut microbiome research related to brain disorders
Zhu, S., Jiang, Y., Xu, K., Cui, M., Ye, W., Zhao, G., Jin, L., & Chen, X. (2020) · Journal of Neuroinflammation · doi:10.1186/s12974-020-1705-z · Cited by 419
“ical pipelines in data processing [263, 264].”
Gut Microbiome Composition in Obese and Non-Obese Persons: A Systematic Review and Meta-Analysis
Pinart, M., Dötsch, A., Schlicht, K., Laudes, M., Bouwman, J., Forslund, S. K., Pischon, T., & Nimptsch, K. (2021) · Nutrients · doi:10.3390/nu14010012 · Cited by 415
Questioning the fetal microbiome illustrates pitfalls of low-biomass microbial studies
Kennedy, K. M., de Goffau, M. C., Pérez-Muñoz, M. E., Arrieta, M., Bäckhed, F., Bork, P., Braun, T., Bushman, F. D., Dore, J. M., de Vos, W. M., et al. (2023) · Nature · doi:10.1038/s41586-022-05546-8 · Cited by 415
“The C-section derived fetal samples in Kennedy et al. , which were not exposed to the vagina, carried no Gardnerella or Lactobacillus but instead contained skin and reagent contaminants 28,53 .”
Self-citationRole of the gut microbiota in anticancer therapy: from molecular mechanisms to clinical applications
Zhao, L.-Y., Mei, J.-X., Yu, G., Lei, L., Zhang, W.-H., Liu, K., Chen, X.-L., Kołat, D., Yang, K., & Hu, J.-K. (2023) · Signal Transduction and Targeted Therapy · doi:10.1038/s41392-023-01406-7 · Cited by 359
“To address these challenges, a comprehensive “standard operation procedure (SOP)” for all methodologies could be introduced in coming years, with the precondition of reaching consensuses on sample collection, technique selection, and data sharing and analysis, despite the multiple existing protocols proposed by the Mi…”
MethodMeta-Analysis Reveals Reproducible Gut Microbiome Alterations in Response to a High-Fat Diet
Bisanz, J. E., Upadhyay, V., Turnbaugh, J. A., Ly, K., & Turnbaugh, P. J. (2019) · Cell Host & Microbe · doi:10.1016/j.chom.2019.06.013 · Cited by 333
Microbiome 101: Studying, Analyzing, and Interpreting Gut Microbiome Data for Clinicians
Allaband, C., McDonald, D. T., Vázquez‐Baeza, Y., Minich, J. J., Tripathi, A., Brenner, D. A., Loomba, R. S., Smarr, L. L., Sandborn, W. J., Schnabl, B., et al. (2018) · Clinical Gastroenterology and Hepatology · doi:10.1016/j.cgh.2018.09.017 · Cited by 331
“Similarly, the Microbiome Quality Control project showed that differences in the computational pipeline, even on the same data, could lead to large differences in the inferred outcomes at levels from the species to the phylum.(95) However, one valuable outcome of the Microbiome Quality Control project was that many di…”
ResultSelf-citationGut microbiome correlates of response and toxicity following anti-CD19 CAR T cell therapy
Smith, M., Dai, A., Ghilardi, G., Amelsberg, K. V., Devlin, S. M., Pajarillo, R., Slingerland, J. B., Beghi, S., Herrera, P. S., Giardina, P., et al. (2022) · Nature Medicine · doi:10.1038/s41591-022-01702-9 · Cited by 349
Schirmer, M., Denson, L. A., Vlamakis, H. C., Franzosa, E. A., Thomas, S., Gotman, N., Rufo, P. A., Baker, S. S., Sauer, C. G., Markowitz, J. F., et al. (2018) · Cell Host & Microbe · doi:10.1016/j.chom.2018.09.009 · Cited by 292
Self-citationWirbel, J., Zych, K., Essex, M., Karcher, N., Kartal, E., Salazar, G., Bork, P., Sunagawa, S., & Zeller, G. (2021) · Genome Biology · doi:10.1186/s13059-021-02306-1 · Cited by 269
Gut bacteria identified in colorectal cancer patients promote tumourigenesis via butyrate secretion
Okumura, S., Konishi, Y., Narukawa, M., Sugiura, Y., Yoshimoto, S., Arai, Y., Sato, S., Yoshida, Y., Tsuji, S., Uemura, K., et al. (2021) · Nature Communications · doi:10.1038/s41467-021-25965-x · Cited by 273
Dietary Fiber, Gut Microbiota, and Metabolic Regulation—Current Status in Human Randomized Trials
Myhrstad, M. C. W., Tunsjø, H. S., Charnock, C., & Telle‐Hansen, V. H. (2020) · Nutrients · doi:10.3390/nu12030859 · Cited by 297
“have shown that variability in 16S rRNA targeted amplicon sequencing depends mainly on bio-specimen type and origin, followed by DNA extraction, sample handling environment, and bioinformatics [57].”
BackgroundIdentifying biases and their potential solutions in human microbiome studies
Nearing, J. T., Comeau, A. M., & Langille, M. G. I. (2021) · Microbiome · doi:10.1186/s40168-021-01059-0 · Cited by 240
“Overall, their work along with others has shown that while technical biases due to the use of different DNA extraction kits are smaller than interindividual variation, they still posed significant issues for downstream analysis [54, 55].”
BackgroundMachine learning for microbiologists
Asnicar, F., Thomas, A. M., Passerini, A., Waldron, L., & Segata, N. (2023) · Nature Reviews Microbiology · doi:10.1038/s41579-023-00984-1 · Cited by 284
“Furthermore, differences in experimental protocols of independent studies may affect metagenomic quantification 112 .”
Issues and current standards of controls in microbiome research
Hornung, B., Zwittink, R. D., & Kuijper, E. J. (2019) · FEMS Microbiology Ecology · doi:10.1093/femsec/fiz045 · Cited by 262
Prospects and challenges of implementing DNA metabarcoding for high-throughput insect surveillance
Piper, A. M., Batovska, J., Cogan, N. O. I., Weiss, J., Cunningham, J. P., Rodoni, B., & Blacket, M. J. (2019) · GigaScience · doi:10.1093/gigascience/giz092 · Cited by 259
“Incorrect reporting or interpretation of significant taxa can lead to incorrect managment response datasets [266] would enable benchmarking of laboratory and computational methods and begin to characterize the sources of technical variation between laboratories [267, 268].”
Lactobacillus and intestinal diseases: Mechanisms of action and clinical applications
Huang, R., Wu, F. L., Zhou, Q., Wei, W., Juan, Y., Xiao, B., & Luo, Z. (2022) · Microbiological Research · doi:10.1016/j.micres.2022.127019 · Cited by 268
Combinatorial, additive and dose-dependent drug–microbiome associations
Forslund, S. K., Chakaroun, R., Zimmermann‐Kogadeeva, M., Markó, L., Aron‐Wisnewsky, J., Nielsen, T., Moitinho‐Silva, L., Schmidt, T., Falony, G., Vieira‐Silva, S., et al. (2021) · Nature · doi:10.1038/s41586-021-04177-9 · Cited by 231
Gut microbiota dysbiosis in a cohort of patients with psoriasis
Hidalgo‐Cantabrana, C., Gómez, J., Delgado, S., Requena‐López, S., Queiro‐Silva, R., Margolles, A., Coto, E., Sánchez, B., & Coto‐Segura, P. (2019) · British Journal of Dermatology · doi:10.1111/bjd.17931 · Cited by 236
Morton, J. T., Jin, D.-M., Mills, R. H., Shao, Y., Rahman, G., McDonald, D. T., Zhu, Q., Balaban, M., Jiang, Y., Cantrell, K., et al. (2023) · Nature Neuroscience · doi:10.1038/s41593-023-01361-0 · Cited by 246
“We used the MicroBiome Quality Control (MBQC) study (Sinha et al. 2017 (ref.”
MethodSelf-citationHarnessing the plant microbiome to promote the growth of agricultural crops
Zhang, J. Y., Cook, J., Nearing, J. T., Zhang, J., Raudonis, R., Glick, B. R., Langille, M. G. I., & Cheng, Z. (2021) · Microbiological Research · doi:10.1016/j.micres.2020.126690 · Cited by 223
Xia, Y. (2020) · Progress in molecular biology and translational science · doi:10.1016/bs.pmbts.2020.04.003 · Cited by 239
Teng, F., Nair, S. S. D., Zhu, P., Li, S., Huang, S. W., Li, X., Xu, J., & Yang, F. (2018) · Scientific Reports · doi:10.1038/s41598-018-34294-x · Cited by 205
Methods in Lung Microbiome Research
Carney, S. M., Clemente, J. C., Cox, M. J., Dickson, R. P., Huang, Y. J., Kitsios, G. D., Kloepfer, K. M., Leung, J. M., LeVan, T. D., Molyneaux, P. L., et al. (2019) · American Journal of Respiratory Cell and Molecular Biology · doi:10.1165/rcmb.2019-0273tr · Cited by 201
Dynamics of the normal gut microbiota: A longitudinal one-year population study in Sweden
Olsson, L. M., Boulund, F., Nilsson, S., Khan, M. T., Gummesson, A., Fagerberg, L., Engstrand, L. G., Perkins, R., Uhlén, M., Bergström, G. M. L., et al. (2022) · Cell Host & Microbe · doi:10.1016/j.chom.2022.03.002 · Cited by 200
Quantifying and Understanding Well-to-Well Contamination in Microbiome Research
Minich, J. J., Sanders, J. G., Amir, A., Humphrey, G. C., Gilbert, J. A., & Knight, R. D. (2019) · mSystems · doi:10.1128/msystems.00186-19 · Cited by 189
“Such “barcode-hopping” behavior has been 184 observed in labs using 8 bp barcodes in the Microbiome Quality Control project [31].”
MethodSelf-citationNaught all zeros in sequence count data are the same
Silverman, J. D., Roche, K. E., Mukherjee, S., & David, L. A. (2020) · Computational and Structural Biotechnology Journal · doi:10.1016/j.csbj.2020.09.014 · Cited by 171
Fetal meconium does not have a detectable microbiota before birth
Kennedy, K. M., Gerlach, M., Adam, T., Heimesaat, M. M., Rossi, L., Surette, M. G., Sloboda, D. M., & Braun, T. (2021) · Nature Microbiology · doi:10.1038/s41564-021-00904-0 · Cited by 201
Diversity, compositional and functional differences between gut microbiota of children and adults
Radjabzadeh, D., Boer, C. G., Beth, S. A., van der Wal, P., Jong, J. C. K., Jansen, M. A. E., Konstantinov, S. R., Peppelenbosch, M. P., Hays, J. P., Jaddoe, V. W. V., et al. (2020) · Scientific Reports · doi:10.1038/s41598-020-57734-z · Cited by 188
Comparative Analysis of 16S rRNA Gene and Metagenome Sequencing in Pediatric Gut Microbiomes
Peterson, D., Bonham, K. S., Rowland, S., Pattanayak, C. W., & Klepac‐Ceraj, V. (2021) · Frontiers in Microbiology · doi:10.3389/fmicb.2021.670336 · Cited by 196
Gut Microbes and Health: A Focus on the Mechanisms Linking Microbes, Obesity, and Related Disorders
Rastelli, M., Knauf, C., & Cani, P. D. (2018) · Obesity · doi:10.1002/oby.22175 · Cited by 191
“Therefore, it is urgent to standardize the sampling of specimens, the DNA extraction protocols, and the bioinformatics tools, not only in order to achieve sufficient reproducibility between studies but also to generate comparable data between cohorts for further meta-analysis and an eventually interesting outcome for…”
MethodThe Skin Microbiome: Current Landscape and Future Opportunities
Smythe, P., & Wilkinson, H. N. (2023) · International Journal of Molecular Sciences · doi:10.3390/ijms24043950 · Cited by 218
Microbial Contribution to the Human Metabolome: Implications for Health and Disease
Treuren, W. V., & Dodd, D. (2019) · Annual Review of Pathology Mechanisms of Disease · doi:10.1146/annurev-pathol-020117-043559 · Cited by 180
Gut microbiota density influences host physiology and is shaped by host and microbial factors
Contijoch, E. J., Britton, G. J., Yang, C., Mogno, I., Li, Z., Ng, R., Llewellyn, S. R., Hira, S., Johnson, C. N., Rabinowitz, K. M., et al. (2019) · eLife · doi:10.7554/elife.40553 · Cited by 172
“Recent work has demonstrated that the amount of live/dead bacteria can vary between fecal samples (Costea et al., 2017; Maurice et al., 2013; Sinha et al., 2017), which would not be captured by a DNA-based density metric.”
BackgroundGoodman, B., & Gardner, H. (2018) · The Journal of Pathology · doi:10.1002/path.5047 · Cited by 187
“As many laboratories sequence samples using a variety of different techniques for sample extraction, processing, and data analysis, choices regarding these experimental details can change the observed results [32].”
BackgroundCritical role of the gut microbiota in immune responses and cancer immunotherapy
Li, Z., Xiong, W., Zhu, L. W., Wang, J., Zeng, Z., Kołat, D., Li, X., Zhou, D., Xu, X., & Zhao, L.-Y. (2024) · Journal of Hematology & Oncology · doi:10.1186/s13045-024-01541-w · Cited by 197
“To address this issue, a consortium-level effort is needed to construct a standardized protocol specifying certain requirements for microbial specimen type and origin, sample handling environment, and microbiota bioinformatics analysis [395].”
BackgroundMa, S., Shungin, D., Mallick, H., Schirmer, M., Nguyen, L. H., Kolde, R., Franzosa, E., Vlamakis, H., Xavier, R., & Huttenhower, C. (2022) · Genome biology · doi:10.1186/s13059-022-02753-4 · Cited by 164
Self-citationPjevac, P., Hausmann, B., Schwarz, J., Köhl, G., Herbold, C. W., Loy, A., & Berry, D. (2021) · Frontiers in Microbiology · doi:10.3389/fmicb.2021.669776 · Cited by 130
Developing standards for the microbiome field
Amos, G. C. A., Logan, A., Anwar, S., Fritzsche, M., Mate, R., Bleazard, T., & Rijpkema, S. G. T. (2020) · Microbiome · doi:10.1186/s40168-020-00856-3 · Cited by 154
“The variability across tools reported here supports previous studies which have demonstrated similar findings for other methodologies [5, 7, 22, 37, 38].”
MethodResultMicrobiota and cancer immunotherapy: in search of microbial signals
Gharaibeh, R. Z., & Jobin, C. (2019) · Gut · doi:10.1136/gutjnl-2018-317220 · Cited by 144
Estimating the postmortem interval using microbes: Knowledge gaps and a path to technology adoption
Metcalf, J. L. (2018) · Forensic Science International Genetics · doi:10.1016/j.fsigen.2018.11.004 · Cited by 147
Large-scale association analyses identify host factors influencing human gut microbiome compositionPreprint
Kurilshikov, A., Medina‐Gómez, C., Bacigalupe, R., Radjabzadeh, D., Wang, J., Demirkan, A., Roy, C. I. L., Garay, J. A. R., Finnicum, C. T., Liu, X., et al. (2020) · bioRxiv (Cold Spring Harbor Laboratory) · doi:10.1101/2020.06.26.173724 · Cited by 143
Self-citationThe microbiome: An emerging key player in aging and longevity
Kim, M., & Benayoun, B. A. (2020) · Translational Medicine of Aging · doi:10.1016/j.tma.2020.07.004 · Cited by 144
A Review of the Role of the Gut Microbiome in Personalized Sports Nutrition
Hughes, R. (2020) · Frontiers in Nutrition · doi:10.3389/fnut.2019.00191 · Cited by 143
“) (64), bioinformatic pipelines (90), and choice of diversity metrics (e.”
BackgroundDNA extraction for human microbiome studies: the issue of standardization
Greathouse, K. L., Sinha, R., & Vogtmann, E. (2019) · Genome Biology · doi:10.1186/s13059-019-1843-8 · Cited by 138
“Sinha R, Abu-Ali G, Vogtmann E, Fodor AA, Ren B, Amir A, Schwager E, Crabtree J, Ma S, Abnet CC, et al. Assessment of variation in microbial community amplicon sequencing by the Microbiome Quality Control (MBQC) project consortium.”
InfluentialSelf-citationSze, M. A., & Schloss, P. D. (2019) · mSphere · doi:10.1128/msphere.00163-19 · Cited by 146
“Many factors can impact how a natural community is represented 33 by the sequencing data including the method of acquiring samples (4–8), storage conditions 34 (4–6, 9–12), extraction methods (13), amplification conditions (8, 14, 15), sequencing method 35 (15–17), and analytical pipeline (15, 18–20).”
BackgroundMethodSims, T. T., El Alam, M. B., Karpinets, T. V., Dorta-Estremera, S., Hegde, V. L., Nookala, S., Yoshida-Court, K., Wu, X., Biegert, G. W. G., Delgado Medrano, A. Y., et al. (2021) · Communications Biology · doi:10.1038/s42003-021-01741-x · Cited by 135
Hu, Y.-L., Pang, W., Huang, Y., Zhang, Y., & Zhang, C. (2018) · Frontiers in Cellular and Infection Microbiology · doi:10.3389/fcimb.2018.00433 · Cited by 137
“There are many factors that may contribute to these discrepancies, including the physiological status of the host, sample type, experimental method, and bioinformatic approach (Sinha et al., 2017).”
BackgroundWhat is new and relevant for sequencing-based microbiome research? A mini-review
Fricker, A. M., Podlesny, D., & Fricke, W. F. (2019) · Journal of Advanced Research · doi:10.1016/j.jare.2019.03.006 · Cited by 139
“Most microbiome analysis protocols include combinations of physical and enzymatic disruptions of microbial cells for nucleic acid isolation [4], which can be amended based on projectspecific requirements, e.”
BackgroundInfluentialEffects of sampling strategy and DNA extraction on human skin microbiome investigations
Bjerre, R. D., Hugerth, L. W., Boulund, F., Seifert, M., Johansen, J. D., & Engstrand, L. G. (2019) · Scientific Reports · doi:10.1038/s41598-019-53599-z · Cited by 132
Tourlousse, D. M., Narita, K., Miura, T., Sakamoto, M., Ohashi, A., Shiina, K., Matsuda, M., Miura, D., Shimamura, M., Ohyama, Y., et al. (2021) · Microbiome · doi:10.1186/s40168-021-01048-3 · Cited by 132
“ferences in observed microbiota profiles, resulting in considerable variability in results across studies and laboratories using different protocols [12, 13].”
ResultHale, V. L., Jeraldo, P., Chen, J., Mundy, M. B., Yao, J. Z., Priya, S., Keeney, G., Lyke, K. J., Ridlon, J. M., White, B. A., et al. (2018) · Genome Medicine · doi:10.1186/s13073-018-0586-6 · Cited by 127
“attempted to overcome the limited statistical power of smaller studies [15] but are limited by the strong biases introduced through varying collection, sequencing, and data processing methodologies [16].”
BackgroundMeasuring and mitigating PCR bias in microbiota datasets
Silverman, J. D., Bloom, R. J., Jiang, S., Durand, H. K., Dallow, E. P., Mukherjee, S., & David, L. A. (2021) · PLoS Computational Biology · doi:10.1371/journal.pcbi.1009113 · Cited by 115
Multi ‘omic data integration: A review of concepts, considerations, and approaches
Santiago-Rodríguez, T. M., & Hollister, E. B. (2021) · Seminars in Perinatology · doi:10.1016/j.semperi.2021.151456 · Cited by 132
Assessing the variation within the oral microbiome of healthy adults
Nearing, J. T., DeClercq, V., Van Limbergen, J., & Langille, M. G. I. (2020) · mSphere · doi:10.1128/msphere.00451-20 · Cited by 117
The Microbiome and Hematopoietic Cell Transplantation: Past, Present, and Future
Andermann, T. M., Peled, J. U., Ho, C. M., Reddy, P. R., Riches, M., Storb, R. F., Teshima, T., van den Brink, M. R. M., Alousi, A. M., Balderman, S., et al. (2018) · Transplantation and Cellular Therapy · doi:10.1016/j.bbmt.2018.02.009 · Cited by 113
Manoil, D., Al‐Manei, K., & Belibasakis, G. N. (2020) · PROTEOMICS - CLINICAL APPLICATIONS · doi:10.1002/prca.201900060 · Cited by 112
Vitamin B-12 and the Gastrointestinal Microbiome: A Systematic Review
Guetterman, H. M., Huey, S. L., Knight, R. D., Fox, A. M., Mehta, S., & Finkelstein, J. L. (2021) · Advances in Nutrition · doi:10.1093/advances/nmab123 · Cited by 124
Self-citationThe Oral and Gut Bacterial Microbiomes: Similarities, Differences, and Connections
Maki, K. A., Kazmi, N., Barb, J. J., & Ames, N. J. (2020) · Biological Research For Nursing · doi:10.1177/1099800420941606 · Cited by 112
“There has been some work in an attempt to create standards of reporting and analysis to improve comparison across studies (Gonzalez et al., 2018; Sinha et al., 2017; Yilmaz et al., 2011), but uptake and implementation is far from universal.”
BackgroundHo, N. T., Li, F., Wang, S., & Kuhn, L. (2019) · BMC Bioinformatics · doi:10.1186/s12859-019-2744-2 · Cited by 90
Microbiome in cancer: Role in carcinogenesis and impact in therapeutic strategies
Rahman, M. M., Islam, M. R., Shohag, S., Ahasan, M. T., Sarkar, N., Khan, H., Hasan, A. M., Cavalu, S. D., & Rauf, A. (2022) · Biomedicine & Pharmacotherapy · doi:10.1016/j.biopha.2022.112898 · Cited by 133
Dietary quality and the colonic mucosa–associated gut microbiome in humans
Liu, Y., Ajami, N. J., El‐Serag, H. B., Hair, C. D., Graham, D. Y., White, D. L., Chen, L., Wang, Z., Plew, S., Kramer, J. R., et al. (2019) · American Journal of Clinical Nutrition · doi:10.1093/ajcn/nqz139 · Cited by 104
International consensus statement on microbiome testing in clinical practice
Porcari, S., Mullish, B. H., Asnicar, F., Ng, S. C., Zhao, L., Hansen, R., O’Toole, P. W., Raes, J., Hold, G. L., Putignani, L., et al. (2024) · The Lancet. Gastroenterology & hepatology · doi:10.1016/s2468-1253(24)00311-x · Cited by 131
“61 The main features of sequencing methods (eg, amplicon-based methods vs whole-genome sequencing), amplicon region if applicable, and the depth of sequencing (expressed as gigabytes or megabytes of DNA) should be provided, as they provide different taxonomical and functional findings.”
Self-citationTriplicate PCR Reactions for 16S rRNA Gene Amplicon Sequencing are Unnecessary
Marotz, C. A., Sharma, A., Humphrey, G. C., Gottel, N., Daum, C. G., Gilbert, J. A., Eloe‐Fadrosh, E. A., & Knight, R. D. (2019) · BioTechniques · doi:10.2144/btn-2018-0192 · Cited by 82
“We used the availability of standardized sample sets such as those from MBQC, the Microbiome Quality Control project [5], and from our previous technology testing to answer this question definitively across three different laboratories.”
MethodSelf-citationYeh, Y., Needham, D. M., Sieradzki, E. T., & Fuhrman, J. A. (2018) · mSystems · doi:10.1128/msystems.00023-18 · Cited by 92
Dynamic linear models guide design and analysis of microbiota studies within artificial human guts
Silverman, J. D., Durand, H. K., Bloom, R. J., Mukherjee, S., & David, L. A. (2018) · Microbiome · doi:10.1186/s40168-018-0584-3 · Cited by 84
Measuring the microbiome: Best practices for developing and benchmarking microbiomics methods
Bokulich, N. A., Ziemski, M., Robeson, M. S., & Kaehler, B. D. (2020) · Computational and Structural Biotechnology Journal · doi:10.1016/j.csbj.2020.11.049 · Cited by 98
“The performance of various DNA sequence analysis methods and pipelines can also be compared via estimates of alpha diversity (within-community diversity) or beta diversity (between-community distance or dissimilarity) versus the expected diversity measurements [91,111].”
BackgroundMethodInfluentialMicrobiome epidemiology and association studies in human health
VanEvery, H., Franzosa, E. A., Nguyen, L. H., & Huttenhower, C. (2022) · Nature Reviews Genetics · doi:10.1038/s41576-022-00529-x · Cited by 86
Self-citationHan, D., Gao, P., Li, R., Tan, P., Xie, J., Zhang, R., & Li, J. (2020) · Journal of Advanced Research · doi:10.1016/j.jare.2020.07.010 · Cited by 93
Li, Y., Wang, X., Wang, X., Wang, J., & Zhao, J. (2020) · Gut Microbes · doi:10.1080/19490976.2020.1773748 · Cited by 73
Generating amplicon reads for microbial community assessment with next‐generation sequencing
Gołębiewski, M., & Tretyn, A. (2019) · Journal of Applied Microbiology · doi:10.1111/jam.14380 · Cited by 85
“2018) as well as overall quality of both experimental and bioinformatic procedures (Sinha et al. 2017) should be used.”
BackgroundMethodA framework for microbiome science in public health
Wilkinson, J. E., Franzosa, E. A., Everett, C., Li, C., trainees, H. R. A., Bae, S., Berzansky, I., Bhosle, A., Bjørnevik, K., Brennan, C. A., et al. (2021) · Nature Medicine · doi:10.1038/s41591-021-01258-0 · Cited by 92
Self-citationMelanoma and microbiota: Current understanding and future directions
Routy, B., Jackson, T., Mählmann, L., Baumgartner, C. K., Blaser, M., Byrd, A., Corvaia, N., Couts, K., Davar, D., Derosa, L., et al. (2024) · Cancer Cell · doi:10.1016/j.ccell.2023.12.003 · Cited by 89
Sui, H., Weil, A. A., Nuwagira, E., Qadri, F., Ryan, E. T., Mezzari, M. P., Phipatanakul, W., & Lai, P. S. (2020) · Frontiers in Microbiology · doi:10.3389/fmicb.2020.00953 · Cited by 80
A statistical model for describing and simulating microbial community profiles
Ma, S., Ren, B., Mallick, H., Moon, Y. S., Schwager, E., Maharjan, S., Tickle, T. L., Lu, Y., Carmody, R. N., Franzosa, E. A., et al. (2021) · PLoS Computational Biology · doi:10.1371/journal.pcbi.1008913 · Cited by 74
Self-citationByrd, D. A., Vogtmann, E., Wu, Z., Han, Y., Wan, Y., Clegg‐Lamptey, J., Yarney, J., Wiafe‐Addai, B., Wiafe, S., Awuah, B., et al. (2021) · International Journal of Cancer · doi:10.1002/ijc.33473 · Cited by 82
“Within each DNA extraction batch, two artificial community and two blank quality control (QC) samples were included.(19) DNA extraction and 16S rRNA amplicon sequencing were performed using Earth Microbiome Project (EMP) standard protocols (http://www.”
MethodSelf-citationRosales, S., Huebner, L. K., Evans, J. S., Apprill, A. M., Baker, A. C., Becker, C. C., Bellantuono, A. J., Brandt, M. E., Clark, A. S., del Campo, J., et al. (2023) · ISME Communications · doi:10.1038/s43705-023-00220-0 · Cited by 75
The Human Microbiome in Relation to Cancer Risk: A Systematic Review of Epidemiologic Studies
Huybrechts, I., Zouiouich, S., Loobuyck, A., Vandenbulcke, Z., Vogtmann, E., Pisanu, S., Iguacel, I., Scalbert, A., Indave, I., Smelov, V., et al. (2020) · Cancer Epidemiology, Biomarkers & Prevention · doi:10.1158/1055-9965.epi-20-0288 · Cited by 80
“, 16S rRNA gene or shotgun sequencing), and various processing pipelines for the raw sequencing data, can all impact the comparability of different studies (137).”
BackgroundSelf-citation
Metadata
- Authors
- The Microbiome Quality Control Project Consortium, Sinha, R., Abu-Ali, G., Vogtmann, E., Fodor, A. A., Ren, B., Amir, A., Schwager, E., Crabtree, J., Ma, S., Abnet, C. C., Knight, R., White, O., & Huttenhower, C.
- Affiliations
- National Cancer Institute (US)
- Broad Institute (US)
- University of North Carolina at Charlotte (US)
- Harvard University (US)
- University of California San Diego (US)
- University of Maryland, Baltimore (US)
- Corresponding author
- Huttenhower, Curtis
- ORCID
- Venue
- Nature Biotechnology
- Published
- 2017-10-02
- Volume
- 35
- Issue
- 11
- Pages
- 1077-1086
- ISSN
- 0733-222X (ISSN-L)
- 1087-0156
- 1546-1696
- PMC
- PMC5839636
- OpenAlex
- W2762425175
- Semantic Scholar
- a253c43fc33ed458f6d9051ba718eb95e6e7ba1a
- Cited by
- 587
- References
- 64
- Citations by year
- 2026: 104 · 2025: 50 · 2024: 56 · 2023: 60 · 2022: 66 · 2021: 84 · 2020: 60 · 2019: 59 · 2018: 44 · 2017: 3
- FWCI
- 18.45
- Type
- journal article
- Language
- en
- Open access
- green
- www.ncbi.nlm.nih.gov
- Licence
- www.springer.com/tdm (tdm)
- Locations
- Nature Biotechnology (publishedVersion)
- PubMed (publishedVersion)
- PubMed Central (acceptedVersion)
- Digital Access to Scholarship at Harvard (DASH) (Harvard University) (acceptedVersion)
- eScholarship (California Digital Library) (submittedVersion)
- Funders
- National Human Genome Research Institute (U01HG004866, R01HG005969, U01HG006537, R01HG004872, R01HG005220)
- National Cancer Institute (R01CA179243)
- National Institute of Diabetes and Digestive and Kidney Diseases (P30DK043351)
- National Institute of Dental and Craniofacial Research (U54DE023798)
- Topics
- Life Sciences › Biochemistry, Genetics and Molecular Biology › Molecular Biology › Gut microbiota and health
- Life Sciences › Biochemistry, Genetics and Molecular Biology › Molecular Biology › Genomics and Phylogenetic Studies
- Physical Sciences › Environmental Science › Ecology › Microbial Community Ecology and Physiology
- Keywords
- human gut microbiome, taxonomic profiling, chemostat, DNA extraction, sample handling, bioinformatics protocols, meta-analysis, experimental design
- MeSH terms
- Gastrointestinal Microbiome, Bacteria, DNA, Bacterial, Humans, Reference Standards, Research Design, Nucleic Acid Amplification Techniques, Microbiota
About these checks
Registry, retraction, Cites and statistics results are computed, not judged, with one exception: a printed reference that no index lists is read once by a model before it counts as a citation error. Claims are extracted by a model and kept only when their quote appears verbatim in the text; each cited source is then checked, with a model’s help, for whether it says what the claim relies on. Those verdicts can be wrong — read the claim’s quote and the cited source before relying on one.
A language model drew the claims from the paper on 2026-10-07, under version 3 of the claim definition (model deepseek-v4.1-flash, prompt extract-v3).
A second model labelled each claim on 2026-10-07 (model jev-1.13-20260917, definition revision gold-guideline-v0.2).
Statistics and arithmetic are recomputed, not judged.
Confidence bands are shown only for fields calibrated on our annotated test set. None is calibrated yet, so no band is shown.
What counts as a claim ›How we measure confidence ›How we check this ›
Are you an author, or do you see a problem with this page? Request a review
