CoChat
Sign Up
Cited by 161Mosquito-borne diseases and controlViral Infections and VectorsVirology and Viral Diseases

LDLRAD3 is a receptor for Venezuelan equine encephalitis virus

Open access
Ma, Hongming, Kim, Arthur S., Kafai, Natasha M., Earnest, James T., Shah, Aadit P., Case, James Brett, Basore, Katherine, Gilliland, Theron C. +6 more·2020·Nature
DOI 10.1038/s41586-020-2915-3PMC PMC7769003
Open this paper in CoChat — free account

Abstract

Venezuelan equine encephalitis virus (VEEV) is a neurotropic alphavirus transmitted by mosquitoes that causes encephalitis and death in humans1. VEEV is a biodefence concern because of its potential for aerosol spread and the current lack of sufficient countermeasures. The host factors that are required for VEEV entry and infection remain poorly characterized. Here, using a genome-wide CRISPR–Cas9-based screen, we identify low-density lipoprotein receptor class A domain-containing 3 (LDLRAD3)—a highly conserved yet poorly characterized member of the scavenger receptor superfamily—as a receptor for VEEV. Gene editing of mouse Ldlrad3 or human LDLRAD3 results in markedly reduced viral infection of neuronal cells, which is restored upon complementation with LDLRAD3. LDLRAD3 binds directly to VEEV particles and enhances virus attachment and internalization into host cells. Genetic studies indicate that domain 1 of LDLRAD3 (LDLRAD3(D1)) is necessary and sufficient to support infection by VEEV, and both anti-LDLRAD3 antibodies and an LDLRAD3(D1)–Fc fusion protein block VEEV infection in cell culture. The pathogenesis of VEEV infection is abrogated in mice with deletions in Ldlrad3, and administration of LDLRAD3(D1)–Fc abolishes disease caused by several subtypes of VEEV, including highly virulent strains. The development of a decoy-receptor fusion protein suggests a strategy for the prevention of severe VEEV infection and associated disease in humans. LDLRAD3 is a receptor for infection with Venezuelan equine encephalitis virus, and in mouse models deletion of Ldlrad3 or treatment with a soluble LDLRAD3 decoy molecule abrogates infection and disease caused by this virus.

AI snapshot

Written from the paper’s full text.

TL;DR

Using a genome-wide CRISPR/Cas9 screen, the authors identify LDLRAD3/Ldlrad3 as a receptor for Venezuelan equine encephalitis virus (VEEV). Ldlrad3 domain 1 mediates VEEV binding and infection, and a Ldlrad3-D1-Fc decoy protein or Ldlrad3 deletion protects mice against pathogenic VEEV strains.

Key findings

  • A genome-wide CRISPR/Cas9 screen in ΔB4galt7 Neuro2a cells, using a mouse GeCKO v2 library of 130,209 sgRNAs targeting 20,611 genes and SINV-VEEV-GFP, identified Ldlrad3 as the top candidate required for VEEV infection.
  • Editing Ldlrad3 or human LDLRAD3 markedly reduced VEEV infection in neuronal and other cells, and complementation restored infection; Ldlrad3 bound VEEV particles and enhanced attachment/internalization, with monovalent Ldlrad3-D1 binding VEEV p62-E1 at an affinity of 209 nM.
  • Ldlrad3 domain 1 (D1) was necessary and sufficient to support VEEV infection; Ldlrad3-D1-Fc and anti-Ldlrad3 antibodies blocked VEEV infection in cell culture, while Ldlrad3-D1-Fc did not inhibit SINV-EEEV.
  • In mice, Ldlrad3 deletions abrogated VEEV pathogenesis, and Ldlrad3-D1-Fc prophylaxis or therapy protected against SINV-VEEV TrD, VEEV TrD, and VEEV ZPC738, including after intracranial VEEV TrD challenge.

Methods

  • Genome-wide CRISPR/Cas9 knockout screen in HS-deficient ΔB4galt7 N2a cells with SINV-VEEV-GFP (VEEV IAB strain TrD structural proteins), followed by sorting GFP-negative cells, expansion with anti-VEEV mAbs, repeated infection/sorting, sgRNA sequencing, and MAGeCK analysis.
  • Validation used CRISPR/Cas9 editing of mouse Ldlrad3 and human LDLRAD3, lentiviral complementation with full-length, truncated, GPI-anchored, or domain-deleted constructs, infectivity assays, binding/internalization assays, PI-PLC treatment, ELISA, and surface plasmon resonance.
  • In vivo studies used C57BL/6J, CD-1, and Ldlrad3 gene-edited mice; Ldlrad3-D1-Fc or isotype control was administered before or after infection with SINV-VEEV TrD, VEEV TrD, or VEEV ZPC738, with survival, weight, clinical disease, viral RNA burden, histology, and in situ hybridization assessed.

Limitations

  • The paper states that low levels of residual VEEV infection in Ldlrad3-deficient N2a or SH-SY5Y cells suggest additional factors may contribute to entry; whether laminin-binding proteins or other host factors are involved is undetermined.
  • The paper states that mosquitoes lack an apparent Ldlrad3 ortholog and must have separate entry receptors, and that EEEV and WEEV do not require Ldlrad3, so additional receptors for this virus family likely exist.
  • The text makes evident that in vivo studies were not blinded, mice were randomly assigned to treatment groups, and no sample-size calculations were performed; sample sizes were based on previous in vivo virus challenge experiments.

Model-written summary. Check it against the paper before relying on it.

Integrity signals

Registry

Crossref · 10.1038/s41586-020-2915-3

Cites

29 of 29 references verified0 citation errors · 0 not checkable

Statistics

Nothing to recompute.

Claims the paper makes

3 of 6 cited sources checked · 1 supported · 0 flagged · accuracy not yet measured

  • Findingown data

    Ldlrad3 binds directly to VEEV particles.

    “Ldlrad3 binds directly to VEEV particles and enhances virus attachment and internalization into cells.”
    • Also stated in: § Abstract · plain
      “The Ldlrad3-D1-Fc variants and Ldlrad3-D1+D2-Fc fusion protein bound to VEEV but not to CHIKV virus-like particles (VLPs); however, Ldlrad3-D2-Fc did not bind to VEEV VLPs (Fig 3b).”
    • Also stated in: § Abstract · plain
      “We found a slow association rate, a long half-life, and an affinity of 209 nM (Fig 3d).”
    Quote in the paperSubstantial claim
  • Findingown data

    Using a genome-wide CRISPR/Cas9-based screen, Ldlrad3 was identified as a receptor for VEEV.

    “Using a genome-wide CRISPR/Cas9-based screen, we identify Ldlrad3, a highly conserved member of the scavenger receptor superfamily, as a receptor for VEEV.”
    • Also stated in: § Abstract · plain
      “The top candidate was low-density lipoprotein (LDL) receptor class A domain containing 3 (Ldlrad3) (Fig 1a), a conserved plasma membrane protein of the LDL scavenger receptor family found in mammals, birds, reptiles, amphibians, and fish (Extended Data Fig 1d).”
    Quote in the paperSubstantial claim
  • Findingown data

    Anti-Ldlrad3 antibodies block VEEV infection in cell culture.

    “both anti-Ldlrad3 antibodies and a Ldlrad3-D1-Fc fusion protein block VEEV infection in cell culture.”
    • Also stated in: § Abstract · plain
      “pre-treatment of ΔB4galt7 N2a cells with anti-Ldlrad3 immune but not naïve serum blocked infection of SINV-VEEV-GFP but not SINV-EEEV-GFP (Fig 2e).”
    • Also stated in: § Abstract · plain
      “pre-treatment of primary cells with anti-Ldlrad3 immune serum reduced SINV-VEEV-GFP TrD infection (Fig 2f).”
    Quote in the paperSubstantial claim
  • Findingown data

    Ldlrad3-D2-Fc does not bind to VEEV VLPs.

    “however, Ldlrad3-D2-Fc did not bind to VEEV VLPs (Fig 3b).”
    Quote in the paperSubstantial claim
  • Findingown data

    Ectopic expression of LDLRAD3 in ΔLdlrad3 ΔB4galt7 N2a cells increases SINV-VEEV-GFP TrD infection.

    “Ectopic expression of LDLRAD3 in ΔLdlrad3 ΔB4galt7 N2a cells also increased SINV-VEEV-GFP TrD infection (Fig 1l and Extended Data Fig 2i).”
    Quote in the paperSubstantial claim
  • Classified as probably not a substantial claim. 16
  • May combine two claims. 18

  • Classified as probably not a substantial claim.

    Study design and conductreasoning

    The CRISPR screen was performed in ΔB4galt7 N2a cells lacking GAG/HS biosynthesis to avoid heparan sulfate-mediated attachment.

    “Because some alphaviruses can attach to cells via engagement of HS11–13, we performed the screen using mouse Neuro2a (termed N2a hereafter) cells that were edited to lack expression of B4galt7 (Extended Data Fig 1b), an enzyme required for glycosaminoglycan (GAG) and HS biosynthesis.”
    Quote in the paperSubstantial claim1 of 3 sources checked
    • cites [11] Ryman, K. D. et al. Heparan sulfate binding can contribute to the neurovirulence of neuroadapted and nonneuroadapted Sindbis viruses. J. Virol. 81, 3563–3573 (2007). source
    • cites [12] Gardner, C. L., Ebel, G. D., Ryman, K. D. & Klimstra, W. B. Heparan sulfate binding by natural eastern equine encephalitis viruses promotes neurovirulence. Proc. Natl Acad. Sci. USA 108, 16026–16031 (2011). source
    • cites [13] Tanaka, A. et al. Genome-wide screening uncovers the significance of N-sulfation of heparan sulfate as a host cell factor for Chikungunya virus infection. J. Virol. 91, e00432-17 (2017). source

  • Probably not a substantial claim: may not pass S3 (load-bearing).

    Study design and conductcitation

    Sample sizes were determined based on previous in vivo virus challenge experiments.

    “sample sizes were determined based on previous in vivo virus challenge experiments4.”
    Quote in the paperNot a substantial claim1 of 1 sources checked
    • cites [4] Zhang, R. et al. Mxra8 is a receptor for multiple arthritogenic alphaviruses. Nature 557, 570–574 (2018). source

      The Methods section (“Mouse experiments”; page not provided) says sample sizes were estimated to detect a 3- to 5-fold difference in the in vivo experiments. It does not say those estimates were based on previous in vivo virus challenge experiments. (LLM, conf=0.86)

      Experimental — accuracy not yet measured

  • Probably not a substantial claim: may not pass S3 (load-bearing).

    Premisecitation

    The insertion of GFP into the chimeric SINV-VEEV virus has minimal effects on virus infection and replication.

    “The insertion of GFP has minimal effects on virus infection and replication20,24.”
    Quote in the paperNot a substantial claim1 of 2 sources checked
    • cites [20] Sun, C., Gardner, C. L., Watson, A. M., Ryman, K. D. & Klimstra, W. B. Stable, high-level expression of reporter proteins from improved alphavirus expression vectors to track replication and dissemination during encephalitic and arthritogenic disease. J. Virol. 88, 2035–2046 (2014). source
    • cites [24] Kim, A. S. et al. Protective antibodies against Eastern equine encephalitis virus bind to epitopes in domains A and B of the E2 glycoprotein. Nat. Microbiol. 4, 187–197 (2019). source

      The Results section (‘Generation of anti-EEEV mAbs’; page unavailable) says that a SINV-EEEV chimera replicated efficiently in cell culture. The Methods section (‘Cell lines and plasmids’; page unavailable) describes that chimera, but neither passage addresses GFP insertion into SINV-VEEV or its effects on infection and replication. Searches for GFP insertion and a fluorescent reporter found no passage that settles the claim. (LLM, conf=0.76)

      Experimental — accuracy not yet measured

  • May combine two claims.

    Findingown data

    Gene editing of mouse Ldlrad3 or human LDLRAD3 results in markedly reduced VEEV infection of neuronal cells, which is restored upon complementation.

    “Gene editing of mouse Ldlrad3 or human LDLRAD3 results in markedly reduced viral infection of neuronal cells, which is restored upon complementation.”
    • Also stated in: § Abstract · plain
      “Markedly reduced infection of SINV-VEEV-GFP TrD was detected in ΔB4galt7 ΔLdlrad3 cells under single- or multi-step growth conditions (Fig 1b–d). Complementation with a full-length, seed-sequence Ldlrad3 variant restored expression and infectivity (Fig 1b–d and Extended Data Fig 2c and i).”
    • Also stated in: § Abstract · plain
      “A loss of LDLRAD3 expression in SH-SY5Y cells resulted in decreased SINV-VEEV TrD infection, which was restored by expression of the full-length but not truncated isoform of Ldlrad3 (Fig 1m–n and Extended Data Fig 2h).”
    Quote in the paperSubstantial claim

  • May combine two claims.

    Findingown data

    Ldlrad3 enhances VEEV attachment and internalization into cells.

    “Ldlrad3 binds directly to VEEV particles and enhances virus attachment and internalization into cells.”
    • Also stated in: § Abstract · plain
      “SINV-VEEV TrD showed reduced binding at 4°C to ΔLdlrad3 ΔB4galt7 cells compared to control ΔB4galt7 N2a cells and increased binding to cells expressing Ldlrad3 (Fig 2a).”
    • Also stated in: § Abstract · plain
      “When virus internalization assays were performed at 37°C, less SINV-VEEV TrD RNA was measured in ΔLdlrad3 ΔB4galt7 cells, and increased levels were detected in cells expressing Ldlrad3 (Fig 2b).”
    Quote in the paperSubstantial claim

  • May combine two claims.

    Findingown data

    Domain 1 (D1) of Ldlrad3 is necessary and sufficient to support VEEV infection.

    “Genetic studies indicate that domain 1 (D1) of Ldlrad3 is necessary and sufficient to support VEEV infection, and both anti-Ldlrad3 antibodies and a Ldlrad3-D1-Fc fusion protein block VEEV infection in cell culture.”
    • Also stated in: § Abstract · hedged
      “Whereas D1+D2 supported SINV-VEEV-GFP TrD infection, D2+D3 did not, consistent with a role for D1 in binding VEEV (Fig 3e and Extended Data Fig 6h).”
    • Also stated in: § Abstract · plain
      “Despite being expressed at lower levels, D1 alone still promoted SINV-VEEV-GFP TrD infection (Extended Data Fig 6i).”
    Quote in the paperSubstantial claim

  • May combine two claims.

    Findingown data

    Full-length Ldlrad3 restores SINV-VEEV-GFP TrD infection in ΔLdlrad3 ΔB4galt7 N2a cells, whereas the Δ32 Ldlrad3 isoform does not.

    “Whereas expression of full-length Ldlrad3 restored infection in ΔLdlrad3 ΔB4galt7 N2a cells, Δ32 Ldlrad3 did not (Fig 3f).”
    Quote in the paperSubstantial claim

  • May combine two claims.

    Findingown data

    Monovalent Ldlrad3-D1 binds to purified VEEV p62-E1 with a slow association rate, a long half-life, and an affinity of 209 nM.

    “We found a slow association rate, a long half-life, and an affinity of 209 nM (Fig 3d).”
    Quote in the paperSubstantial claim

  • May combine two claims.

    Findingown data

    Human dermal microvascular endothelial cells and dermal fibroblasts, but not peripheral blood monocytes and peripheral blood T cells, express LDLRAD3 and are permissive for SINV-VEEV-GFP TrD infection.

    “we observed that human dermal microvascular endothelial cells and dermal fibroblasts, but not peripheral blood monocytes and peripheral blood T cells, express LDLRAD3 and were permissive for SINV-VEEV-GFP TrD infection (Extended Data Fig 5b).”
    Quote in the paperSubstantial claim

  • Probably not a substantial claim: may not pass S3 (load-bearing).

    Findingown data

    The generated Ldlrad3 founder mouse lines carry Δ11 and Δ14 nucleotide deletions.

    “Founder lines (Δ11 and Δ14 nucleotides) were confirmed and genotyped by next-generation sequencing.”
    Quote in the paperNot a substantial claim

  • May combine two claims.

    Findingown data

    Histological evaluation of VEEV ZPC738-infected brains shows neuronal injury and hemorrhage, which is absent in mice treated with Ldlrad3-D1-Fc.

    “Histological evaluation of VEEV ZPC738-infected brains showed neuronal injury and hemorrhage, which was absent in mice treated with Ldlrad3-D1-Fc (Extended Data Fig 8b and d).”
    Quote in the paperSubstantial claim

  • May combine two claims.

    Findingown data

    Ldlrad3 mRNA is detected in many tissues in wild-type mice, whereas no signal is detected in ΔLdlrad3 mice by qRT-PCR.

    “Ldlrad3 mRNA was detected in many tissues in wild-type mice, whereas no signal was detected in ΔLdlrad3 mice by qRT-PCR (Extended Data Fig 10b–c).”
    Quote in the paperSubstantial claim

  • May combine two claims.

    Findingown data

    Ldlrad3-D1-Fc and Ldlrad3-D1+D2-Fc bind to VEEV VLPs but not to CHIKV VLPs.

    “The Ldlrad3-D1-Fc variants and Ldlrad3-D1+D2-Fc fusion protein bound to VEEV but not to CHIKV virus-like particles (VLPs); however, Ldlrad3-D2-Fc did not bind to VEEV VLPs (Fig 3b).”
    Quote in the paperSubstantial claim

  • May combine two claims.

    Findingown data

    Complementation with Ldlrad3 D1+D2 supports SINV-VEEV-GFP TrD infection, whereas D2+D3 does not.

    “Whereas D1+D2 supported SINV-VEEV-GFP TrD infection, D2+D3 did not, consistent with a role for D1 in binding VEEV (Fig 3e and Extended Data Fig 6h).”
    Quote in the paperSubstantial claim

  • May combine two claims.

    Findingown data

    Jurkat and Raji cells lack surface expression of LDLRAD3 and are resistant to SINV-VEEV-GFP TrD infection.

    “Two human tumor cell lines (Jurkat and Raji cells) lack surface expression of LDLRAD3 and were resistant to SINV-VEEV-GFP TrD infection (Extended Data Fig 3a and c).”
    Quote in the paperSubstantial claim

  • May combine two claims.

    Findingown data

    A similar LDLRAD3-D1 fusion protein with human IgG1 Fc domain binds to VEEV but not to CHIKV VLPs.

    “A similar LDLRAD3-D1 fusion protein with human IgG1 Fc domain also bound to VEEV but not to CHIKV VLPs (Fig 3c and Extended Data Fig 6b–c).”
    Quote in the paperSubstantial claim

  • May combine two claims.

    Findingown data

    At 4 days post-infection, SINV-VEEV TrD viral RNA is largely absent from sites normally targeted by VEEV including the brain of mice administered Ldlrad3-D1-Fc, whereas high levels are present in control mAb-treated animals.

    “at 4 days post-infection (dpi), SINV-VEEV TrD viral RNA was largely absent from sites normally targeted by VEEV including the brain of mice administered Ldlrad3-D1-Fc, whereas high levels were present in the control mAb-treated animals (Fig 4b).”
    Quote in the paperSubstantial claim

  • May combine two claims.

    Findingown data

    Ldlrad3-D1+D2-Fc, but not Ldlrad3-D2-Fc, inhibits SINV-VEEV-GFP TrD infection comparably to Ldlrad3-D1-Fc.

    “Ldlrad3-D1+D2-Fc, but not Ldlrad3-D2-Fc, inhibited SINV-VEEV-GFP TrD infection comparably to Ldlrad3-D1-Fc (Fig 3i).”
    Quote in the paperSubstantial claim

  • Probably not a substantial claim: may not pass S3 (load-bearing). May combine two claims.

    Findingown data

    The full-length human isoform of LDLRAD3 is 96% identical to mouse Ldlrad3 and differs by only three amino acids in the ectodomain.

    “The full-length human isoform of LDLRAD3 is 96% identical to mouse Ldlrad3 and differs by only three amino acids in the ectodomain (Extended Data Fig 1d).”
    Quote in the paperNot a substantial claim

  • Probably not a substantial claim: may not pass S3 (load-bearing).

    Findingown data

    One sgRNA targeting Ldlrad3 D1 gave rise to two out-of-frame deletion variants (Δ11 and Δ14 nucleotides).

    “One sgRNA gave rise to two out-of-frame deletion variants (Δ11 and Δ14 nucleotides) (Extended Data Fig 9b).”
    Quote in the paperNot a substantial claim

  • May combine two claims.

    Findingown data

    Ldlrad3 is required for VEEV infection but not for EEEV, WEEV, arthritogenic alphaviruses (SINV and MAYV), vesicular stomatitis virus, or West Nile virus.

    “While substantially reduced infection was observed with VEEV TrD, no difference was observed with EEEV (Fig 1f). This phenotype was confirmed with SINV-EEEV and extended to SINV-WEEV (MacMillan) (Fig 1g).”
    • Also stated in: § Abstract · plain
      “Similarly, we observed no loss of infection by arthritogenic alphaviruses (SINV and MAYV), an unrelated rhabdovirus (Vesicular stomatitis virus), or an unrelated flavivirus (West Nile virus) when Ldlrad3 was edited (Fig 1h–k).”
    Quote in the paperSubstantial claim

  • Classified as probably not a substantial claim.

    Study design and conductreasoning

    The Ldlrad3 sgRNA target sequences in complementation constructs were mutated synonymously to prevent editing of the re-introduced gene.

    “The Ldlrad3 sgRNA target sequence was mutated synonymously (sgRNA-1: ACCAACGAGTGCAACATCCC to ACAAATGAATGTAATATTCC; sgRNA-2: AGCATCACGTACGCCATCAT to TCTATTACTTATGCTATTAT) to prevent editing of the re-introduced gene.”
    Quote in the paperSubstantial claim

  • Classified as probably not a substantial claim.

    Study design and conductown data

    Ldlrad3 gene editing was validated by next generation sequencing.

    “Ldlrad3 gene-editing was validated by next generation sequencing on an Illumina HiSeq 2500 platform (Genome Technology Access Center, Washington University) with 300 base pair paired-end sequencing.”
    Quote in the paperSubstantial claim

  • Probably not a substantial claim: may not pass S3 (load-bearing).

    Study design and conductnone given

    Mice were randomly assigned to treatment groups.

    “mice were randomly assigned to treatment groups”
    Quote in the paperNot a substantial claim

  • Probably not a substantial claim: may not pass S3 (load-bearing).

    Study design and conductnone given

    In vivo studies were not blinded.

    “In vivo studies were not blinded”
    Quote in the paperNot a substantial claim

  • Probably not a substantial claim: may not pass S3 (load-bearing).

    Study design and conductnone given

    Anti-HCV mAb H77.39 was included as a negative isotype control in Ldlrad3-Fc inhibition assays.

    “Anti-HCV mAb H77.39 was included as a negative isotype control.”
    Quote in the paperNot a substantial claim

  • Probably not a substantial claim: may not pass S3 (load-bearing).

    Study design and conductnone given

    Immobilized CHIKV p62-E1 served as a reference surface to correct for bulk refractive index changes in surface plasmon resonance experiments.

    “Immobilized CHIKV p62-E1 served as a reference surface to correct for bulk refractive index changes.”
    Quote in the paperNot a substantial claim

  • Probably not a substantial claim: may not pass S3 (load-bearing).

    Study design and conductnone given

    All experiments were conducted with approval of the Institutional Animal Care and Use Committee at Washington University School of Medicine or University of Pittsburgh.

    “All experiments were conducted with approval of the Institutional Animal Care and Use Committee at Washington University School of Medicine (Assurance number A3381-01) or University of Pittsburgh.”
    Quote in the paperNot a substantial claim

  • Probably not a substantial claim: may not pass S3 (load-bearing), S4 (based). May combine two claims.

    Interpretationreasoning

    Mosquitoes, a natural host for VEEV, lack an apparent Ldlrad3 ortholog and thus must have separate entry receptors.

    “Mosquitoes, a natural host for VEEV, lack an apparent Ldlrad3 ortholog and thus must have separate entry receptors.”
    Quote in the paperNot a substantial claim
    • Rests on an assumption: Mosquitoes lack an apparent Ldlrad3 ortholog.

  • May combine two claims.

    Interpretationreasoning

    Since EEEV and WEEV do not require Ldlrad3 for infection, additional receptors for this virus family likely exist.

    “Moreover, since EEEV and WEEV do not require Ldlrad3 for infection, additional receptors for this virus family likely exist.”
    Quote in the paperSubstantial claim

  • Probably not a substantial claim: may not pass S3 (load-bearing).

    Study design and conductnone given

    No sample-size calculations were performed to power each study.

    “No sample-size calculations were performed to power each study.”
    Quote in the paperNot a substantial claim

  • Probably not a substantial claim: may not pass S3 (load-bearing).

    Study design and conductnone given

    A ZIKV RNA in situ hybridization probe was used as a negative control.

    “A ZIKV RNA probe (Advanced Cell Diagnostics #467771) was used as a negative control.”
    Quote in the paperNot a substantial claim
32 of 32

  • The paper relies on this without support.

    Host factors required for VEEV entry and infection remain poorly characterized.

    “The host factors required for VEEV entry and infection remain poorly characterized.”

  • The paper relies on this without support.

    No physiologically relevant entry receptor for VEEV has been established.

    “For VEEV, no physiologically relevant entry receptor has been established, although a laminin-binding protein reportedly enhances infection of mosquito and human cells6,7.”

  • The paper relies on this without support.

    Mosquitoes lack an apparent Ldlrad3 ortholog.

    “Mosquitoes, a natural host for VEEV, lack an apparent Ldlrad3 ortholog and thus must have separate entry receptors.”

  • The paper relies on this without support.

    Ldlrad3-D1-Fc and Ldlrad3-D1-HRV-Fc have equivalent VEEV binding and neutralizing activity.

    “which have equivalent VEEV binding and neutralizing activity”
4 of 4

Cites

Flagged first, then by citations

Cited by

Sorted by citations

Related

Authors
Ma, H., Kim, A. S., Kafai, N. M., Earnest, J. T., Shah, A. P., Case, J. B., Basore, K., Gilliland, T. C., Sun, C., Nelson, C. A., Thackray, L. B., Klimstra, W. B., Fremont, D. H., & Diamond, M. S.
Affiliations
  • Washington University in St. Louis (US)
  • University of Pittsburgh (US)
Corresponding author
Diamond, Michael S.
ORCID
Venue
Nature
Publisher
Springer Science and Business Media LLC
Published
2020-11-18
Volume
588
Issue
7837
Pages
308-314
ISSN
  • 0028-0836 (ISSN-L)
  • 1476-4687
DOI
10.1038/s41586-020-2915-3
PMC
PMC7769003
OpenAlex
W3105847615
Semantic Scholar
9b4dc7dec6bd2485669bd58a0f9c9a413946a3ec
Cited by
161
References
29
Citations by year
2026: 23 · 2025: 38 · 2024: 33 · 2023: 31 · 2022: 19 · 2021: 15 · 2020: 2
FWCI
11.53
Type
journal article
Language
en
Open access
Licence
Locations
  • Nature (publishedVersion)
  • PubMed (publishedVersion)
  • PubMed Central (submittedVersion)
  • RePEc: Research Papers in Economics (submittedVersion)
Funders
National Institute of Allergy and Infectious Diseases (R01AI153209, U19 AI142790, U19AI142759, HHSN272201700060C, R01AI095436, R01AI143673, T32AI007172)
Topics
  • Health Sciences › Medicine › Public Health, Environmental and Occupational Health › Mosquito-borne diseases and control
  • Health Sciences › Medicine › Infectious Diseases › Viral Infections and Vectors
  • Health Sciences › Medicine › Epidemiology › Virology and Viral Diseases
Keywords
Venezuelan equine encephalitis virus, viral receptor, alphavirus, scavenger receptors, viral entry, viral attachment, viral internalization, decoy receptor, neurotropic viruses, encephalitis, CRISPR-Cas9 screen, mouse model
MeSH terms
Animals, Cell Line, Encephalitis Virus, Venezuelan Equine, Encephalomyelitis, Venezuelan Equine, Female, Genetic Complementation Test, Humans, Male, Mice, Inbred C57BL, Protein Binding, Receptors, LDL, Receptors, Virus, Mice, Virus Attachment, Virus Internalization, CRISPR-Cas Systems

About these checks

Registry, retraction, Cites and statistics results are computed, not judged, with one exception: a printed reference that no index lists is read once by a model before it counts as a citation error. Claims are extracted by a model and kept only when their quote appears verbatim in the text; each cited source is then checked, with a model’s help, for whether it says what the claim relies on. Those verdicts can be wrong — read the claim’s quote and the cited source before relying on one.

Claims read by deepseek-v4.1-flash under definition version 3 (extract-v3) on 2026-10-18.

Classified by jev-1.13-20260917 (gold-guideline-v0.2) on 2026-10-18.

Cited sources are checked by gpt-6-sol.

Statistics and arithmetic are recomputed, not judged.

Confidence bands are shown only for fields calibrated on our annotated test set. None is calibrated yet, so no band is shown.

What counts as a claim ›How we measure confidence ›How we check this ›

Are you an author, or do you see a problem with this page? Request a review