The DOI matches its Crossref record; 65 of the 66 references it cites were found in a registry or an index; none of the 68 sources its claims cite is checked for support yet.
Testosterone and Progesterone, But Not Estradiol, Stimulate Muscle Protein Synthesis in Postmenopausal Women
Open accessAbstract
CONTEXT: The effect of the female sex steroids, estradiol and progesterone, on muscle protein turnover is unclear. Therefore, it is unknown whether the changes in the hormonal milieu throughout the life span in women contribute to the changes in muscle protein turnover and muscle mass (eg, age associated muscle loss). OBJECTIVE: The objective of this study was to provide a comprehensive evaluation of the effect of sex hormones on muscle protein synthesis and gene expression of growth-regulatory factors [ie, myogenic differentiation 1 (MYOD1), myostatin (MSTN), follistatin (FST), and forkhead box O3 (FOXO3)]. SUBJECTS AND DESIGN: We measured the basal rate of muscle protein synthesis and the expression of muscle growth-regulatory genes in 12 premenopausal women and four groups of postmenopausal women (n=24 total) who were studied before and after treatment with T, estradiol, or progesterone or no intervention (control group). All women were healthy, and pre- and postmenopausal women were carefully matched on body mass, body composition, and insulin sensitivity. RESULTS: The muscle protein fractional synthesis rate was approximately 20% faster, and MYOD1, FST, and FOXO3 mRNA expressions were approximately 40%-90% greater (all P<.05) in postmenopausal than premenopausal women. In postmenopausal women, both T and progesterone treatment increased the muscle protein fractional synthesis rate by approximately 50% (both P<.01), whereas it was not affected by estradiol treatment and was unchanged in the control group. Progesterone treatment increased MYOD1 mRNA expression (P<.05) but had no effect on MSTN, FST, and FOXO3 mRNA expression. T and estradiol treatment had no effect on skeletal muscle MYOD1, MSTN, FST, and FOXO3 mRNA expression. CONCLUSION: Muscle protein turnover is faster in older, postmenopausal women compared with younger, premenopausal women, but these age-related differences do not appear to be explained by the age- and menopause-related changes in the plasma sex hormone milieu.
Overview
AI snapshot
Written from the paper’s full text.
TL;DR
In healthy postmenopausal women, testosterone and progesterone treatment increased basal muscle protein synthesis, whereas estradiol did not. Postmenopausal women also had faster basal muscle protein synthesis and higher expression of several muscle growth-regulatory genes than matched premenopausal women.
Key findings
- Muscle protein fractional synthesis rate (FSR) was approximately 20% faster in postmenopausal than premenopausal women (P = .02), and MYOD1, FST, and FOXO3 mRNA expression was approximately 40%–90% greater (all P < .05).
- In postmenopausal women, testosterone and progesterone treatment each increased muscle protein FSR by approximately 50% (both P < .01), while estradiol treatment had no effect and the control group was unchanged.
- Progesterone treatment increased MYOD1 mRNA expression (P < .05) but had no effect on MSTN, FST, or FOXO3; testosterone and estradiol had no effect on MYOD1, MSTN, FST, or FOXO3 mRNA expression.
- The authors conclude that age- and menopause-related differences in basal muscle protein turnover in women do not appear to be explained by changes in the plasma sex hormone milieu.
Methods
- Longitudinal, randomized, controlled study in 12 premenopausal and 24 postmenopausal sedentary, weight-stable women; postmenopausal women were randomized to control, testosterone, estradiol, or progesterone (n = 6 per group).
- Basal mixed muscle protein FSR was measured with a 5-hour [5,5,5-²H₃]leucine infusion and quadriceps muscle biopsies at 120 and 300 minutes; muscle MYOD1, MSTN, FST, and FOXO3 mRNA expression was measured by real-time PCR.
- Pre- vs postmenopausal comparisons used t tests or Mann-Whitney U tests; treatment effects used repeated-measures ANOVA with Tukey post hoc tests, and gene expression used Kruskal-Wallis with Bonferroni-corrected Mann-Whitney post hoc analyses.
Limitations
- The paper states that muscle protein breakdown rates and changes in muscle mass were not measured, so it cannot determine whether progesterone-induced increases in synthesis produce net muscle protein gain or increased muscle mass.
- The paper states that it cannot determine whether larger pharmacological estradiol doses, more prolonged treatment, or estradiol plus progesterone combination therapy would produce different outcomes; it also notes that the estradiol effect was so small (0.0003% ± 0.011%/h) that more than 50,000 subjects would be needed to detect it.
- Evident from the text: each postmenopausal treatment group had only 6 women, treatment durations were relatively short (21 days for testosterone; intermittent active treatment over about 71 days for estradiol and progesterone), and participants were healthy, sedentary, weight-stable women, which may limit generalizability.
Model-written summary. Check it against the paper before relying on it.
Integrity signals
Registry
Cites
Statistics
Verification
Claims the paper makes
29 Not checked yet · 27 Own result · 12 Own method · 8 Own interpretation
A result the paper reports from its own data — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“Plasma substrate and hormone concentrations were unchanged in the control group (Table 2).”
§ Testosterone and Progesterone, But Not Estradiol, Stimulate Muscle Protein Synthesis in Postmenopausal Women > Effect of hormone treatments in postmenopausal women
plain- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: unclear — It is unclear whether the paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
A result the paper reports from its own data — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“The muscle protein fractional synthesis rate was approximately 20% faster, and MYOD1, FST, and FOXO3 mRNA expressions were approximately 40%-90% greater (all P Ͻ .05) in postmenopausal than premenopausal women.”
- Also stated in: § Pre-vs postmenopausal women · plain
“The muscle protein FSR was approximately 20% greater (P ϭ .02; Figure 1) and MYOD1, FST, and FOXO3 mRNA expressions were approximately 40%-90% greater (P Ͻ .05; Figure 2) in postmenopausal than premenopausal women.”
§ Testosterone and Progesterone, But Not Estradiol, Stimulate Muscle Protein Synthesis in Postmenopausal Women > Abstract
plaincorrelationaln = 12- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: passes — The paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
- Also stated in: § Pre-vs postmenopausal women · plain
A result the paper reports from its own data — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“T and estradiol treatment had no effect on skeletal muscle MYOD1, MSTN, FST, and FOXO3 mRNA expression.”
- Also stated in: § Effect of hormone treatments in postmenopausal women · plain
“T and estradiol treatment had no effect on skeletal muscle MYOD1, MSTN, FST, and FOXO3 mRNA expression; progesterone treatment significantly increased MYOD1 mRNA expression”
§ Testosterone and Progesterone, But Not Estradiol, Stimulate Muscle Protein Synthesis in Postmenopausal Women > Abstract
plain- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: unclear — It is unclear whether the paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
- Also stated in: § Effect of hormone treatments in postmenopausal women · plain
A result the paper reports from its own data — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“Progesterone treatment increased MYOD1 mRNA expression (P Ͻ .05)but had no effect on MSTN, FST, and FOXO3 mRNA expression.”
- Also stated in: § Effect of hormone treatments in postmenopausal women · plain
“progesterone treatment significantly increased MYOD1 mRNA expression (P Ͻ .05)but had no effect on MSTN, FST, and FOXO3 mRNA expression (Figure 4).”
§ Testosterone and Progesterone, But Not Estradiol, Stimulate Muscle Protein Synthesis in Postmenopausal Women > Abstract
plaindirect- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: unclear — It is unclear whether the paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
- Also stated in: § Effect of hormone treatments in postmenopausal women · plain
A result the paper reports from its own data — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“The muscle protein fractional synthesis rate was approximately 20% faster, and MYOD1, FST, and FOXO3 mRNA expressions were approximately 40%-90% greater (all P Ͻ .05) in postmenopausal than premenopausal women.”
- Also stated in: § Pre-vs postmenopausal women · plain
“The muscle protein FSR was approximately 20% greater (P ϭ .02; Figure 1) and MYOD1, FST, and FOXO3 mRNA expressions were approximately 40%-90% greater (P Ͻ .05; Figure 2) in postmenopausal than premenopausal women.”
§ Testosterone and Progesterone, But Not Estradiol, Stimulate Muscle Protein Synthesis in Postmenopausal Women > Abstract
plaincorrelationaln = 4- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: unclear — It is unclear whether the paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
- Also stated in: § Pre-vs postmenopausal women · plain
A result the paper reports from its own data — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“whereas it was not affected by estradiol treatment and was unchanged in the control group.”
- Also stated in: § Effect of hormone treatments in postmenopausal women · plain
“Estradiol treatment did not affect the muscle protein FSR”
§ Testosterone and Progesterone, But Not Estradiol, Stimulate Muscle Protein Synthesis in Postmenopausal Women > Abstract
plain- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: passes — The paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
- Also stated in: § Effect of hormone treatments in postmenopausal women · plain
A result the paper reports from its own data — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“and was unchanged in the control group.”
- Also stated in: § Effect of hormone treatments in postmenopausal women · plain
“The average muscle protein FSR was unchanged in the control group (Figure 3)”
§ Testosterone and Progesterone, But Not Estradiol, Stimulate Muscle Protein Synthesis in Postmenopausal Women > Abstract
plain- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: unclear — It is unclear whether the paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
- Also stated in: § Effect of hormone treatments in postmenopausal women · plain
A result the paper reports from its own data — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“MSTN mRNA expression was not different in premenopausal and postmenopausal women (Figure 2).”
§ Testosterone and Progesterone, But Not Estradiol, Stimulate Muscle Protein Synthesis in Postmenopausal Women > Pre-vs postmenopausal women
plain- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: unclear — It is unclear whether the paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
A result the paper reports from its own data — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“the time between the two studies (31-78 d) did not correlate with the change in muscle protein FSR (r ϭ 0.06, P ϭ .91).”
§ Testosterone and Progesterone, But Not Estradiol, Stimulate Muscle Protein Synthesis in Postmenopausal Women > Effect of hormone treatments in postmenopausal women
plain- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: unclear — It is unclear whether the paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
A result the paper reports from its own data — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“In postmenopausal women, both T and progesterone treatment increased the muscle protein fractional synthesis rate by approximately 50% (both P Ͻ .01)”
- Also stated in: § Effect of hormone treatments in postmenopausal women · plain
“Estradiol treatment did not affect the muscle protein FSR, whereas both T and progesterone treatment increased it by approximately 50% (both P Ͻ .01; Figure 3).”
§ Testosterone and Progesterone, But Not Estradiol, Stimulate Muscle Protein Synthesis in Postmenopausal Women > Abstract
plaindirect- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: passes — The paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
- Also stated in: § Effect of hormone treatments in postmenopausal women · plain
- Probably not a substantial claim. 20
- It may state two separate claims as one. 22
- The quote only partly states this claim. 2
A result the paper reports from its own data — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“However, postmenopausal women were older (as expected) and had a somewhat worse plasma lipid profile than premenopausal women (Table 1).”
§ Testosterone and Progesterone, But Not Estradiol, Stimulate Muscle Protein Synthesis in Postmenopausal Women > Pre-vs postmenopausal women
plaincorrelational- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: fails — The paper’s conclusions may not depend on it.
- Based: passes — The paper gives a reason why it holds.
Probably not a substantial claim. The paper’s conclusions may not depend on it. It may state two separate claims as one.
A result the paper reports from its own data — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“In the estradiol group, plasma estrogen concentration was significantly elevated 12 hours after the patch removal”
§ Testosterone and Progesterone, But Not Estradiol, Stimulate Muscle Protein Synthesis in Postmenopausal Women > Effect of hormone treatments in postmenopausal women
plaindirect- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: fails — The paper’s conclusions may not depend on it.
- Based: passes — The paper gives a reason why it holds.
Probably not a substantial claim. The paper’s conclusions may not depend on it.
A result the paper reports from its own data — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“Total and bioavailable plasma T, leucine, and IGF-BP3 concentrations were not different in pre-and postmenopausal women”
§ Testosterone and Progesterone, But Not Estradiol, Stimulate Muscle Protein Synthesis in Postmenopausal Women > Pre-vs postmenopausal women
plain- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: unclear — It is unclear whether the paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
It may state two separate claims as one.
A result the paper reports from its own data — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“plasma triacylglycerol concentration was reduced by approximately 20% compared with pretreatment values (both P Ͻ .05;Table 2).”
§ Testosterone and Progesterone, But Not Estradiol, Stimulate Muscle Protein Synthesis in Postmenopausal Women > Effect of hormone treatments in postmenopausal women
plaindirect- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: fails — The paper’s conclusions may not depend on it.
- Based: passes — The paper gives a reason why it holds.
Probably not a substantial claim. The paper’s conclusions may not depend on it.
A result the paper reports from its own data — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“In the T and progesterone groups, plasma T and progesterone concentrations, respectively, were significantly greater the day after the final treatment dose than before treatment”
§ Testosterone and Progesterone, But Not Estradiol, Stimulate Muscle Protein Synthesis in Postmenopausal Women > Effect of hormone treatments in postmenopausal women
plaindirect- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: passes — The paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
It may state two separate claims as one.
A result the paper reports from its own data — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“whereas plasma progesterone, estrogen, IGF-I, and SHBG concentrations were significantly lower and FSH and cortisol concentrations were greater in post-compared with premenopausal women (all P Ͻ .01;Table 1).”
§ Testosterone and Progesterone, But Not Estradiol, Stimulate Muscle Protein Synthesis in Postmenopausal Women > Pre-vs postmenopausal women
plaincorrelational- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: unclear — It is unclear whether the paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
It may state two separate claims as one.
A result the paper reports from its own data — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“whereas plasma progesterone, estrogen, IGF-I, and SHBG concentrations were significantly lower and FSH and cortisol concentrations were greater in post-compared with premenopausal women (all P Ͻ .01;Table 1).”
§ Testosterone and Progesterone, But Not Estradiol, Stimulate Muscle Protein Synthesis in Postmenopausal Women > Pre-vs postmenopausal women
plaincorrelational- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: unclear — It is unclear whether the paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
It may state two separate claims as one.
A result the paper reports from its own data — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“none of our hormone treatments affected the concentrations of insulin, IGF-I, IGF-BP3, or cortisol or resulted in nonspecific sex hormone concentration changes.”
§ Testosterone and Progesterone, But Not Estradiol, Stimulate Muscle Protein Synthesis in Postmenopausal Women > Discussion
plain- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: passes — The paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
It may state two separate claims as one.
What the paper did — it cites no source for this, so there is none to check. The quote shows it is in the paper.
In the paper
“Pre-and postmenopausal women were well matched on total body mass, body mass index, body composition, and insulin sensitivity (Table 1).”
- Also stated in: § Abstract · plain
“pre-and postmenopausal women were carefully matched on body mass, body composition, and insulin sensitivity.”
§ Testosterone and Progesterone, But Not Estradiol, Stimulate Muscle Protein Synthesis in Postmenopausal Women > Pre-vs postmenopausal women
boosted- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: passes — The paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
It may state two separate claims as one.
- Also stated in: § Abstract · plain
A conclusion the paper draws from its own results — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“whereas progesterone has potent stimulatory effects on muscle protein synthesis and MYOD1 mRNA expression.”
§ Testosterone and Progesterone, But Not Estradiol, Stimulate Muscle Protein Synthesis in Postmenopausal Women > Discussion
boosteddirect- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: passes — The paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
It may state two separate claims as one.
None of the sources cited for this claim have been checked yet.
In the paper
“T is a well-known anabolic steroid; it increases muscle protein synthesis (3-7) and muscle mass (8 -11)”
§ Testosterone and Progesterone, But Not Estradiol, Stimulate Muscle Protein Synthesis in Postmenopausal Women > Abstract
What the sources say
- Not checked yetcites [3]
- Not checked yetcites [4]
- Not checked yetcites [5]
- Not checked yetcites [6]
- Not checked yetcites [7]
- Not checked yetcites [8]
- Not checked yetcites [9]
- Not checked yetcites [10]
- Not checked yetcites [11]
boosteddirect- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: passes — The paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
It may state two separate claims as one.
A conclusion the paper draws from its own results — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“We have demonstrated that estradiol has no effect on muscle protein synthesis or the expression of genes involved in the regulation of muscle mass”
§ Testosterone and Progesterone, But Not Estradiol, Stimulate Muscle Protein Synthesis in Postmenopausal Women > Discussion
boosted- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: passes — The paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
It may state two separate claims as one.
In the paper
“a study on rodents showed that ovariectomy increases and progesterone and estradiol suppress the rate of muscle protein synthesis (13).”
§ Testosterone and Progesterone, But Not Estradiol, Stimulate Muscle Protein Synthesis in Postmenopausal Women > Abstract
What the sources say
- Not checked yetcites [13]
plaindirect- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: passes — The paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
Probably not a substantial claim. It may state two separate claims as one.
None of the sources cited for this claim have been checked yet.
In the paper
“oral administration of synthetic female sex hormone derivatives alters the concentration of anabolic and catabolic hormones (eg, IGF-I, cortisol) in plasma, whereas systemic delivery of unmodified hormones does not (20 -22).”
§ Testosterone and Progesterone, But Not Estradiol, Stimulate Muscle Protein Synthesis in Postmenopausal Women > Abstract
What the sources say
- Not checked yetcites [20]
- Not checked yetcites [21]
- Not checked yetcites [22]
boosteddirect- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: passes — The paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
It may state two separate claims as one.
A conclusion the paper draws from its own results — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“that supports this concept and helps explain the ageassociated loss of muscle mass in the face of an increased muscle protein synthesis rate.”
§ Testosterone and Progesterone, But Not Estradiol, Stimulate Muscle Protein Synthesis in Postmenopausal Women > Discussion
plaindirect- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: unclear — It is unclear whether the paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
It may state two separate claims as one.
- Rests on an assumption: Changes in mRNA expression of catabolic genes (FOXO3 and MuRF1) reflect changes in muscle protein breakdown rate.
In the paper
“whereas a study conducted in growing steer found that estradiol increases the rate of muscle protein synthesis (50).”
§ Testosterone and Progesterone, But Not Estradiol, Stimulate Muscle Protein Synthesis in Postmenopausal Women > Discussion
What the sources say
- Not checked yetcites [50]
plaindirect- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: fails — The paper’s conclusions may not depend on it.
- Based: passes — The paper gives a reason why it holds.
Probably not a substantial claim. The paper’s conclusions may not depend on it.
A conclusion the paper draws from its own results — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“Furthermore, the concomitant up-regulation of both muscle protein synthesis and breakdown in old compared with young women might further be indicative of increased skeletal muscle remodeling in post-compared with premenopausal women.”
§ Testosterone and Progesterone, But Not Estradiol, Stimulate Muscle Protein Synthesis in Postmenopausal Women > Discussion
hedgedconditional- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: fails — The paper’s conclusions may not depend on it.
- Based: passes — The paper gives a reason why it holds.
Probably not a substantial claim. The paper’s conclusions may not depend on it.
- Rests on an assumption: Muscle mass is determined by the balance between muscle protein synthesis and breakdown, so a higher synthesis rate with declining muscle mass implies increased breakdown.
What the paper did — it cites no source for this, so there is none to check. The quote shows it is in the paper.
In the paper
“None of the subjects had evidence of chronic illness or significant organ dysfunction (eg, diabetes mellitus, cirrhosis) or were taking medications (including hormone replacement therapy or hormonal contraceptives) that could interfere with muscle protein metabolism”
§ Testosterone and Progesterone, But Not Estradiol, Stimulate Muscle Protein Synthesis in Postmenopausal Women > Subjects and prestudy testing
plain- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: passes — The paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
Probably not a substantial claim. It may state two separate claims as one.
In the paper
“The free leucine labeling in muscle tissue fluid was chosen to represent the immediate precursor for muscle protein synthesis (ie, aminoacyl-t-RNA) (41).”
§ Testosterone and Progesterone, But Not Estradiol, Stimulate Muscle Protein Synthesis in Postmenopausal Women > Calculations
What the sources say
- Not checked yetcites [41]
plain- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: passes — The paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
Probably not a substantial claim.
None of the sources cited for this claim have been checked yet.
In the paper
“The lack of effect of estradiol on muscle growth-regulatory gene expression in our study is consistent with the results from studies conducted in rodents.”
§ Testosterone and Progesterone, But Not Estradiol, Stimulate Muscle Protein Synthesis in Postmenopausal Women > Discussion
What the sources say
- Not checked yetcites [45]
- Not checked yetcites [46]
- Not checked yetcites [47]
plain- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: fails — The paper’s conclusions may not depend on it.
- Based: passes — The paper gives a reason why it holds.
Probably not a substantial claim. The paper’s conclusions may not depend on it.
What the paper did — it cites no source for this, so there is none to check. The quote shows it is in the paper.
In the paper
“we also compared the expression of our genes of interest against -actin (ACTB, forward, CATGTACGTTGCTATCCAGGC, reverse, CTCCT-TAATGTCACGCACGAT) and the results were the same (data not shown).”
§ Testosterone and Progesterone, But Not Estradiol, Stimulate Muscle Protein Synthesis in Postmenopausal Women > Sample collection, processing, and analyses
plain- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: fails — The paper’s conclusions may not depend on it.
- Based: passes — The paper gives a reason why it holds.
Probably not a substantial claim. The paper’s conclusions may not depend on it. The quote only partly states this claim.
None of the sources cited for this claim have been checked yet.
In the paper
“However, estradiol treatment augments muscle MYOD1 expression during recovery from muscle injury in ovariectomized rats (45,46,49) and prevents the orchidetcomy-induced decrease in FBXO32 expression (47).”
§ Testosterone and Progesterone, But Not Estradiol, Stimulate Muscle Protein Synthesis in Postmenopausal Women > Discussion
What the sources say
- Not checked yetcites [45]
- Not checked yetcites [46]
- Not checked yetcites [49]
- Not checked yetcites [47]
boosteddirect- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: unclear — It is unclear whether the paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
It may state two separate claims as one.
In the paper
“and less in women who use oral, hormonal contraceptives compared with those who do not (16).”
§ Testosterone and Progesterone, But Not Estradiol, Stimulate Muscle Protein Synthesis in Postmenopausal Women > Abstract
What the sources say
- Not checked yetcites [16]
plaincorrelational- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: fails — The paper’s conclusions may not depend on it.
- Based: passes — The paper gives a reason why it holds.
Probably not a substantial claim. The paper’s conclusions may not depend on it.
What the paper did — it cites no source for this, so there is none to check. The quote shows it is in the paper.
In the paper
“we chose to provide 17-es-tradiol and micronized progesterone in replacement doses and delivered them to tissues through the systemic circulation to avoid these confounding influences”
§ Testosterone and Progesterone, But Not Estradiol, Stimulate Muscle Protein Synthesis in Postmenopausal Women > Discussion
plain- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: passes — The paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
It may state two separate claims as one. The quote only partly states this claim.
None of the sources cited for this claim have been checked yet.
In the paper
“Our study confirms previous observations by our own and other research groups concerning the anabolic effect of T (3-7) and an age-related up-regulation of both stimulatory and inhibitory muscle growth regulatory genes and accelerated basal muscle protein turnover in women (14,43,44), which might be indicative of increased skeletal muscle remodeling in post-compared with premenopausal women.”
§ Testosterone and Progesterone, But Not Estradiol, Stimulate Muscle Protein Synthesis in Postmenopausal Women > Discussion
What the sources say
- Not checked yetcites [3]
- Not checked yetcites [4]
- Not checked yetcites [5]
- Not checked yetcites [6]
- Not checked yetcites [7]
- Not checked yetcites [14]
- Not checked yetcites [43]
- Not checked yetcites [44]
hedgeddirect- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: passes — The paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
It may state two separate claims as one.
In the paper
“our data suggest that the mechanism(s) responsible for the anabolic effect of progesterone is different from that of T and therefore most likely the result of progesterone receptor rather than androgen receptor activation”
§ Testosterone and Progesterone, But Not Estradiol, Stimulate Muscle Protein Synthesis in Postmenopausal Women > Discussion
What the sources say
- Not checked yetcites [53]
hedgedconditional- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: passes — The paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
It may state two separate claims as one.
What the paper did — it cites no source for this, so there is none to check. The quote shows it is in the paper.
In the paper
“postmenopausal women were randomized to one of four groups (n ϭ 6 per group): control (no intervention), and T, estradiol, or progesterone treatment”
§ Testosterone and Progesterone, But Not Estradiol, Stimulate Muscle Protein Synthesis in Postmenopausal Women > Hormone treatment and repeat protein metabolism studies (postmenopausal women only)
plain- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: passes — The paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
Probably not a substantial claim.
What the paper did — it cites no source for this, so there is none to check. The quote shows it is in the paper.
In the paper
“Written informed consent was obtained from all subjects before participation in the study, which was approved by the Institutional Review Board of Washington University School of Medicine (St Louis, Missouri).”
§ Testosterone and Progesterone, But Not Estradiol, Stimulate Muscle Protein Synthesis in Postmenopausal Women > Subjects and prestudy testing
plain- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: fails — The paper’s conclusions may not depend on it.
- Based: passes — The paper gives a reason why it holds.
Probably not a substantial claim. The paper’s conclusions may not depend on it. It may state two separate claims as one.
What the paper did — it cites no source for this, so there is none to check. The quote shows it is in the paper.
In the paper
“All women were healthy”
§ Testosterone and Progesterone, But Not Estradiol, Stimulate Muscle Protein Synthesis in Postmenopausal Women > Abstract
plain- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: fails — The paper’s conclusions may not depend on it.
- Based: passes — The paper gives a reason why it holds.
Probably not a substantial claim. The paper’s conclusions may not depend on it.
What the paper did — it cites no source for this, so there is none to check. The quote shows it is in the paper.
In the paper
“We did not measure muscle protein breakdown rates or changes in muscle mass in response to the different sex hormone treatments in this study.”
§ Testosterone and Progesterone, But Not Estradiol, Stimulate Muscle Protein Synthesis in Postmenopausal Women > Discussion
plain- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: passes — The paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
It may state two separate claims as one.
In the paper
“Evidence is emerging that increased adiposity may affect the rate of muscle protein turnover (19)”
§ Testosterone and Progesterone, But Not Estradiol, Stimulate Muscle Protein Synthesis in Postmenopausal Women > Abstract
What the sources say
- Not checked yetcites [19]
hedgedconditional- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: fails — The paper’s conclusions may not depend on it.
- Based: passes — The paper gives a reason why it holds.
Probably not a substantial claim. The paper’s conclusions may not depend on it.
None of the sources cited for this claim have been checked yet.
In the paper
“Others, however, reported no difference in the rate of muscle protein synthesis between hormone users and nonusers (16), between young and old women (17), or between women who were studied during the follicular or the luteal phases of their menstrual cycle (18).”
§ Testosterone and Progesterone, But Not Estradiol, Stimulate Muscle Protein Synthesis in Postmenopausal Women > Abstract
What the sources say
- Not checked yetcites [16]
- Not checked yetcites [17]
- Not checked yetcites [18]
plain- Asserted: fails — The authors may not put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: fails — The paper’s conclusions may not depend on it.
- Based: passes — The paper gives a reason why it holds.
Probably not a substantial claim. The authors may not put it forward as true. The paper’s conclusions may not depend on it. It may state two separate claims as one.
In the paper
“other investigators reported that the basal rate of muscle protein synthesis is less in women who received estrogen replacement therapy after hysterectomy than age-matched postmenopausal women (15)”
§ Testosterone and Progesterone, But Not Estradiol, Stimulate Muscle Protein Synthesis in Postmenopausal Women > Abstract
What the sources say
- Not checked yetcites [15]
plaincorrelational- Asserted: fails — The authors may not put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: fails — The paper’s conclusions may not depend on it.
- Based: passes — The paper gives a reason why it holds.
Probably not a substantial claim. The authors may not put it forward as true. The paper’s conclusions may not depend on it.
What the paper did — it cites no source for this, so there is none to check. The quote shows it is in the paper.
In the paper
“Compliance with the interventions was confirmed by regular phone interviews and pill count at the end of the study.”
§ Testosterone and Progesterone, But Not Estradiol, Stimulate Muscle Protein Synthesis in Postmenopausal Women > Hormone treatment and repeat protein metabolism studies (postmenopausal women only)
plain- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: passes — The paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
Probably not a substantial claim.
What the paper did — it cites no source for this, so there is none to check. The quote shows it is in the paper.
In the paper
“It is conceivable (although we consider it unlikely) that our study was underpowered to detect a change in muscle protein FSR after estradiol treatment.”
- Also stated in: § Discussion · plain
“In fact, the pre-and posttreatment difference in muscle protein FSR in the estradiol group was so small (0.0003% Ϯ 0.011%/h) that we would have needed more than 50 000 subjects to detect it with a sufficiently small probability of type I error (␣ Ͻ .05) and sufficient power (Ն .80) to reject the null hypothesis.”
§ Testosterone and Progesterone, But Not Estradiol, Stimulate Muscle Protein Synthesis in Postmenopausal Women > Discussion
plain- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: passes — The paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
Probably not a substantial claim.
- Also stated in: § Discussion · plain
In the paper
“the other reported an increase (56) but lacked a placebo control group to rigorously judge the effect.”
§ Testosterone and Progesterone, But Not Estradiol, Stimulate Muscle Protein Synthesis in Postmenopausal Women > Discussion
What the sources say
- Not checked yetcites [56]
plaindirect- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: unclear — It is unclear whether the paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
It may state two separate claims as one.
What the paper did — it cites no source for this, so there is none to check. The quote shows it is in the paper.
In the paper
“This study was registered in clinicaltrials.govas trial number NCT00805207.”
§ Testosterone and Progesterone, But Not Estradiol, Stimulate Muscle Protein Synthesis in Postmenopausal Women > Acknowledgements
plain- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: fails — The paper’s conclusions may not depend on it.
- Based: passes — The paper gives a reason why it holds.
Probably not a substantial claim. The paper’s conclusions may not depend on it.
The paper relies on this without support.
Muscle mass is determined by the balance between muscle protein synthesis and breakdown, so a higher synthesis rate with declining muscle mass implies increased breakdown.
“our data from young, premenopausal vs older, postmenopausal women (greater synthesis rate in old compared with young women) and the well-established decline in muscle mass with aging (59 -61) indicate that older women must (by deduction) also have an increased rate of muscle protein breakdown.”
The paper relies on this without support.
Changes in mRNA expression of catabolic genes (FOXO3 and MuRF1) reflect changes in muscle protein breakdown rate.
“we (present study) and others (44) have observed an age-related upregulation of catabolic genes (ie, FOXO3 and MuRF1 mRNA expression) in muscle that supports this concept and helps explain the ageassociated loss of muscle mass in the face of an increased muscle protein synthesis rate.”
The paper relies on this without support.
Increased MYOD1 mRNA expression reflects increased satellite cell activation.
“Increased progesterone-induced MYOD1 expression suggests increased satellite cell activation may play a role in this observation.”
Claims other papers make about this one
Each is checked against this paper’s own text: does it say what the citing paper says it does?
In the citing paper
“Additionally, testosterone supplementation in postmenopausal women leads to a 50% increase in protein synthesis rate compared with no effect with estrogen treatment (87).”
From Sex-Based Differences in Skeletal Muscle Kinetics and Fiber-Type Composition (2015) · cites this paper as [87]
Self-check
Percentages, sums and reported differences re-computed from the paper’s own numbers.
Each contradiction between two passages listed here was confirmed by an independent check.
Rated minor: it would not touch a result — a value no result rests on, a p-value that stays on the same side of the significance level, or a conflict that is clerical, resolved elsewhere in the paper, or outside its own findings.
In the paper
§ Testosterone and Progesterone, But Not Estradiol, Stimulate Muscle Protein Synthesis in Postmenopausal Women > Hormone treatment and repeat protein metabolism studies (postmenopausal women only)
“IGF-I, ng/dL 90 (88, 139) 66 (61, 87) Ͻ.01 IGF-I, nM 11.8 (11.5, 18.2) 8.7 (8.0, 11.4)”
§ Testosterone and Progesterone, But Not Estradiol, Stimulate Muscle Protein Synthesis in Postmenopausal Women > Discussion
“| IGF-I, ng/mL | 84 Ϯ 9 | 8 0 Ϯ 8 | 7 2 Ϯ 11 | 72 Ϯ 15 | 79 Ϯ 6 | 7 1 Ϯ 8 | 6 1 Ϯ 3 | 7 2 Ϯ 10 |”
Rated minor: it would not touch a result — a value no result rests on, a p-value that stays on the same side of the significance level, or a conflict that is clerical, resolved elsewhere in the paper, or outside its own findings.
In the paper
§ Testosterone and Progesterone, But Not Estradiol, Stimulate Muscle Protein Synthesis in Postmenopausal Women > Hormone treatment and repeat protein metabolism studies (postmenopausal women only)
“Cortisol, ng/dl 70 (29, 111) 129 (107, 144) Ͻ.01 Cortisol, nM 193 (81, 305) 356 (295, 398)”
§ Testosterone and Progesterone, But Not Estradiol, Stimulate Muscle Protein Synthesis in Postmenopausal Women > Discussion
“| Cortisol, ng/mL | 129 Ϯ 17 | 110 Ϯ 18 | 137 Ϯ 13 | 165 Ϯ 17 | 104 Ϯ 18 | 141 Ϯ 12 | 160 Ϯ 27 | 135 Ϯ 21 |”
Rated minor: it would not touch a result — a value no result rests on, a p-value that stays on the same side of the significance level, or a conflict that is clerical, resolved elsewhere in the paper, or outside its own findings.
In the paper
§ Testosterone and Progesterone, But Not Estradiol, Stimulate Muscle Protein Synthesis in Postmenopausal Women > Hormone treatment and repeat protein metabolism studies (postmenopausal women only)
“IGF-BP3, ng/dL 1822 Ϯ 119 1773 Ϯ 85 .74IGF-BP3, nM 66 Ϯ 4 6 4 Ϯ 3”
§ Testosterone and Progesterone, But Not Estradiol, Stimulate Muscle Protein Synthesis in Postmenopausal Women > Discussion
“| IGF-BP3, ng/mL | 1883 Ϯ 164 | 1873 Ϯ 152 | 1856 Ϯ 173 | 1898 Ϯ 121 | 1703 Ϯ 168 | 1476 Ϯ 146 | 1651 Ϯ 200 | 1428 Ϯ 148 |”
Citations
Cites
Matthews, D. R., Hosker, J. P., Rudenski, A. S., Naylor, B. A., Treacher, D. F., & Turner, R. C. (1985) · Diabetologia · doi:10.1007/bf00280883 · Cited by 31,502
Sandri, M., Sandri, C., Gilbert, A., Skurk, C., Calabria, E., Picard, A., Walsh, K., Schiaffino, S., Lecker, S. H., & Goldberg, A. L. (2004) · Cell · doi:10.1016/s0092-8674(04)00400-3 · Cited by 3,012
Regulation of myostatin activity and muscle growth
Lee, S.-J., & McPherron, A. C. (2001) · Proceedings of the National Academy of Sciences · doi:10.1073/pnas.151270098 · Cited by 1,616
GAPDH as a housekeeping gene: analysis of GAPDH mRNA expression in a panel of 72 human tissues
Barber, R. D., Harmer, D. W., Coleman, R. A., & Clark, B. J. (2005) · Physiological Genomics · doi:10.1152/physiolgenomics.00025.2005 · Cited by 849
Isidori, A. M., Giannetta, E., Greco, E. A., Gianfrilli, D., Bonifacio, V., Isidori, A., Lenzi, A., & Fabbri, A. (2005) · Clinical Endocrinology · doi:10.1111/j.1365-2265.2005.02339.x · Cited by 695
Adult lean body mass declines with age: Some longitudinal observations
Forbes, G. B., & Reina, J. C. (1970) · Metabolism · doi:10.1016/0026-0495(70)90062-4 · Cited by 684
Wang, C., Cunningham, G., Dobs, A., Iranmanesh, A., Matsumoto, A. M., Snyder, P. J., Weber, T., Berman, N., Hull, L., & Swerdloff, R. S. (2004) · The Journal of Clinical Endocrinology & Metabolism · doi:10.1210/jc.2003-032006 · Cited by 656
Effects of Testosterone Replacement in Hypogonadal Men1
Snyder, P. J., Peachey, H., Berlin, J. A., Hannoush, P., Haddad, G., Dlewati, A., Santanna, J., Loh, L., Lenrow, D. A., Holmes, J. H., et al. (2000) · The Journal of Clinical Endocrinology & Metabolism · doi:10.1210/jcem.85.8.6731 · Cited by 610
Testosterone administration to elderly men increases skeletal muscle strength and protein synthesis
Urban, R. J., Bodenburg, Y. H., Gilkison, C., Foxworth, J., Coggan, A. R., Wolfe, R. R., & Ferrando, A. (1995) · American Journal of Physiology-Endocrinology and Metabolism · doi:10.1152/ajpendo.1995.269.5.e820 · Cited by 608
Wang, C., Catlin, D. H., Demers, L. M., Starcevic, B., & Swerdloff, R. S. (2004) · The Journal of Clinical Endocrinology & Metabolism · doi:10.1210/jc.2003-031287 · Cited by 580
Effect of testosterone on muscle mass and muscle protein synthesis
Griggs, R. C., Kingston, W., Jozefowicz, R. F., Herr, B. E., Forbes, G., & Halliday, D. (1989) · Journal of Applied Physiology · doi:10.1152/jappl.1989.66.1.498 · Cited by 517
Weight stability masks sarcopenia in elderly men and women
Gallagher, D., Ruts, E., Visser, M., Heshka, S., Baumgartner, R. N., Wang, J., Pierson, R. N., Pi-Sunyer, F. X., & Heymsfield, S. B. (2000) · American Journal of Physiology-Endocrinology and Metabolism · doi:10.1152/ajpendo.2000.279.2.e366 · Cited by 466
Effects of Testosterone Replacement in Hypogonadal Men
Snyder, P. J. (2000) · Journal of Clinical Endocrinology & Metabolism · doi:10.1210/jc.85.8.2670 · Cited by 464
Fat-free and fat mass percentiles in 5225 healthy subjects aged 15 to 98 years
Kyle, U. G., Genton, L., Slosman, D. O., & Pichard, C. (2001) · Nutrition · doi:10.1016/s0899-9007(01)00555-x · Cited by 444
Kyle, U., Genton, L., Hans, D., Karsegard, L., Slosman, D., & Pichard, C. (2001) · European Journal of Clinical Nutrition · doi:10.1038/sj.ejcn.1601198 · Cited by 442
Effect of puberty on body composition
Loomba‐Albrecht, L. A., & Styne, D. M. (2009) · Current Opinion in Endocrinology Diabetes and Obesity · doi:10.1097/med.0b013e328320d54c · Cited by 434
Sex Differences in Lipid and Lipoprotein Metabolism: It's Not Just about Sex Hormones
Wang, X., Magkos, F., & Mittendorfer, B. (2011) · The Journal of Clinical Endocrinology & Metabolism · doi:10.1210/jc.2010-2061 · Cited by 424
Self-citationWittert, G., Chapman, I. M., Haren, M. T., Mackintosh, S. F., Coates, P. S., & Morley, J. E. (2003) · The Journals of Gerontology Series A · doi:10.1093/gerona/58.7.m618 · Cited by 342
Amirouche, A., Durieux, A., Banzet, S., Koulmann, N., Bonnefoy, R., Mouret, C., Bigard, X. A., Peinnequin, A., & Freyssenet, D. G. (2008) · Endocrinology · doi:10.1210/en.2008-0959 · Cited by 301
Haidet, A. M., Rizo, L., Handy, C. R., Umapathi, P., Eagle, A., Shilling, C., Boué, D. R., Martin, P. T., Sahenk, Z., Mendell, J. R., et al. (2008) · Proceedings of the National Academy of Sciences · doi:10.1073/pnas.0709144105 · Cited by 274
Testosterone injection stimulates net protein synthesis but not tissue amino acid transport
Ferrando, A. A., Tipton, K. D., Doyle, D., Phillips, S. M., Cortiella, J., & Wolfe, R. R. (1998) · American Journal of Physiology-Endocrinology and Metabolism · doi:10.1152/ajpendo.1998.275.5.e864 · Cited by 256
Raue, U., Slivka, D. R., Jemioło, B., Hollon, C. J., & Trappe, S. W. (2006) · Journal of Applied Physiology · doi:10.1152/japplphysiol.01616.2005 · Cited by 209
Valkenburg, O., Steegers‐Theunissen, R. P. M., Smedts, H. P. M., Dallinga‐Thie, G. M., Fauser, B. C. J. M., Westerveld, E. H., & Laven, J. S. E. (2007) · The Journal of Clinical Endocrinology & Metabolism · doi:10.1210/jc.2007-1756 · Cited by 201
Short-Term Oxandrolone Administration Stimulates Net Muscle Protein Synthesis in Young Men1
Sheffield-Moore, M., Urban, R. J., Wolf, S. E., Jiang, J., Catlin, D. H., Herndon, D. N., Wolfe, R. R., & Ferrando, A. A. (1999) · The Journal of Clinical Endocrinology & Metabolism · doi:10.1210/jcem.84.8.5923 · Cited by 199
Raue, U., Slivka, D. R., Jemioło, B., Hollon, C. J., & Trappe, S. W. (2007) · The Journals of Gerontology Series A · doi:10.1093/gerona/62.12.1407 · Cited by 176
Estrogen influences satellite cell activation and proliferation following downhill running in rats
Enns, D. L., & Tiidus, P. M. (2007) · Journal of Applied Physiology · doi:10.1152/japplphysiol.00128.2007 · Cited by 167
Watt, P., Lindsay, Y. E., Scrimgeour, C. M., Chien, P., Gibson, J. N. A., Taylor, D. J., & Rennie, M. J. (1991) · Proceedings of the National Academy of Sciences · doi:10.1073/pnas.88.13.5892 · Cited by 165
Selective estrogen receptor-β activation stimulates skeletal muscle growth and regeneration
Velders, M., Schleipen, B., Fritzemeier, K. H., Zierau, O., & Diel, P. (2012) · The FASEB Journal · doi:10.1096/fj.11-194779 · Cited by 162
Relation between whole-body and regional measures of human skeletal muscle
Lee, S., Janssen, I., Heymsfield, S. B., & Ross, R. (2004) · American Journal of Clinical Nutrition · doi:10.1093/ajcn/80.5.1215 · Cited by 157
Toth, M. J., Poehlman, É. T., Matthews, D. E., Tchernof, A., & MacCoss, M. J. (2001) · American Journal of Physiology-Endocrinology and Metabolism · doi:10.1152/ajpendo.2001.280.3.e496 · Cited by 134
Qureshi, A. C., Bahri, A., Breen, L. A., Barnes, S. C., Powrie, J. K., Thomas, S. M., & Carroll, P. V. (2007) · Clinical Endocrinology · doi:10.1111/j.1365-2265.2007.02784.x · Cited by 133
Welle, S. L., Burgess, K., & Mehta, S. (2009) · American Journal of Physiology-Endocrinology and Metabolism · doi:10.1152/ajpendo.90862.2008 · Cited by 121
The Determination of Bio-Available Testosterone
Wheeler, M. J. (1995) · Annals of Clinical Biochemistry International Journal of Laboratory Medicine · doi:10.1177/000456329503200401 · Cited by 119
Patterson, B. W., Zhang, X.-J., Chen, Y., Klein, S., & Wolfe, R. R. (1997) · Metabolism · doi:10.1016/s0026-0495(97)90084-6 · Cited by 118
Enns, D. L., Iqbal, S., & Tiidus, P. M. (2008) · Acta Physiologica · doi:10.1111/j.1748-1716.2008.01861.x · Cited by 116
Miller, B. F., Hansen, M., Olesen, J. L., Flyvbjerg, A., Schwarz, P., Babraj, J. A., Smith, K., Rennie, M. J., & Kjaer, M. (2006) · American Journal of Physiology-Endocrinology and Metabolism · doi:10.1152/ajpendo.00300.2005 · Cited by 111
Hayden, J. M., Bergen, W. G., & Merkel, R. A. (1992) · Journal of Animal Science · doi:10.2527/1992.7072109x · Cited by 110
Sexually dimorphic effect of aging on skeletal muscle protein synthesis
Smith, G. I., Reeds, D. N., Hall, A. M., Chambers, K. T., Finck, B. N., & Mittendorfer, B. (2012) · Biology of Sex Differences · doi:10.1186/2042-6410-3-11 · Cited by 105
Self-citationMyofibrillar protein synthesis in myostatin-deficient mice
Welle, S. L., Bhatt, K. S., & Pinkert, C. A. (2005) · American Journal of Physiology-Endocrinology and Metabolism · doi:10.1152/ajpendo.00433.2005 · Cited by 94
Shifren, J. L., Desindes, S., McIlwain, M., Doros, G., & Mazer, N. A. (2007) · Menopause · doi:10.1097/gme.0b013e31803867a · Cited by 89
Skeletal muscle adaptations to testosterone and resistance training in men with COPD
Lewis, M. I., Fournier, M., Storer, T. W., Bhasin, S., Pórszász, J., Ren, S.-G., Da, X., & Casaburi, R. H. (2007) · Journal of Applied Physiology · doi:10.1152/japplphysiol.00150.2007 · Cited by 86
Role of MyoD in denervated, disused, and exercised muscle
Legerlotz, K., & Smith, H. K. (2008) · Muscle & Nerve · doi:10.1002/mus.21087 · Cited by 78
Hansen, M., Skovgaard, D. C., Reitelseder, S., Holm, L., Langberg, H., & Kjær, M. (2012) · The Journals of Gerontology Series A · doi:10.1093/gerona/gls007 · Cited by 78
Kvorning, T., Andersen, M., Brixen, K., Schjerling, P., Suetta, C., & Madsen, K. (2006) · The Journal of Physiology · doi:10.1113/jphysiol.2006.122671 · Cited by 75
Short-Term Oxandrolone Administration Stimulates Net Muscle Protein Synthesis in Young Men
Sheffield‐Moore, M. (1999) · The Journal of Clinical Endocrinology & Metabolism · doi:10.1210/jc.84.8.2705 · Cited by 74
Androgen Therapy Induces Muscle Protein Anabolism in Older Women
Sheffield‐Moore, M., Paddon‐Jones, D., Casperson, S. L., Gilkison, C. R., Volpi, E., Wolf, S. E., Jiang, J., Rosenblatt, J. I., & Urban, R. J. (2006) · The Journal of Clinical Endocrinology & Metabolism · doi:10.1210/jc.2006-0588 · Cited by 61
Progesterone stimulates cardiac muscle protein synthesis via receptor-dependent pathway
Goldstein, J. S., Sites, C. K., & Toth, M. J. (2004) · Fertility and Sterility · doi:10.1016/j.fertnstert.2004.03.018 · Cited by 58
Pharmacokinetics of natural progesterone administered in the form of a vaginal tablet
Levy, T. (1999) · Human Reproduction · doi:10.1093/humrep/14.3.606 · Cited by 58
Hansen, M., Langberg, H., Holm, L., Miller, B. F., Petersen, S. G., Doessing, S., Skovgaard, D., Trappe, T., & Kjaer, M. (2011) · Scandinavian Journal of Medicine & Science in Sports · doi:10.1111/j.1600-0838.2009.01002.x · Cited by 57
Protein Anabolic Responses to a Fed Steady State in Healthy Aging
Chevalier, S., Goulet, E. D. B., Burgos, S. A., Wykes, L., & Morais, J. A. (2011) · The Journals of Gerontology Series A · doi:10.1093/gerona/glr036 · Cited by 56
Estradiol treatment, physical activity, and muscle function in ovarian-senescent mice
Greising, S. M., Carey, R. S., Blackford, J. E., Dalton, L. E., Kosir, A. M., & Lowe, D. A. (2011) · Experimental Gerontology · doi:10.1016/j.exger.2011.04.006 · Cited by 55
Touchberry, C. D., Wacker, M., Richmond, S. R., Whitman, S. A., & Godard, M. P. (2006) · PubMed Central · Cited by 50
Tsai, W., Mccormick, K., Brazeau, D., & Brazeau, G. (2007) · Experimental biology and medicine · doi:10.3181/0704-rm-92 · Cited by 48
Phelan, N., O’Connor, A. S., Tun, T. K., Correia, N., Boran, G. P., Roche, H. M., & Gibney, J. (2010) · The Journal of Clinical Endocrinology & Metabolism · doi:10.1210/jc.2009-2444 · Cited by 48
Svensson, J., Movérare‐Skrtic, S., Windahl, S. H., Swanson, C., & Sjögren, K. (2010) · Journal of Molecular Endocrinology · doi:10.1677/jme-09-0165 · Cited by 46
Sonnet, E., Lacut, K., Roudaut, N., Mottier, D., Kerlan, V., & Oger, E. (2007) · Clinical Endocrinology · doi:10.1111/j.1365-2265.2007.02783.x · Cited by 44
Physical Inactivity is a Major Contributor to Ovariectomy-Induced Sarcopenia
Fonseca, H., Powers, S. K., Moreira‐Gonçalves, D., Santos, A., Mota, M. P., & Duarte, J. A. (2012) · International Journal of Sports Medicine · doi:10.1055/s-0031-1297953 · Cited by 41
Is protein metabolism changed with obesity?
Guillet, C., Masgrau, A., & Boirie, Y. (2010) · Current Opinion in Clinical Nutrition & Metabolic Care · doi:10.1097/mco.0b013e328341389e · Cited by 36
Effect of testosterone on muscle protein synthesis in myotonic dystrophy
Griggs, R. C., Halliday, D., Kingston, W. J., & Moxley, R. T. (1986) · Annals of Neurology · doi:10.1002/ana.410200506 · Cited by 35
Wang, X., Smith, G. I., Patterson, B. W., Reeds, D. N., Kampelman, J., Magkos, F., & Mittendorfer, B. (2012) · American Journal of Physiology-Endocrinology and Metabolism · doi:10.1152/ajpendo.00533.2011 · Cited by 34
Self-citationSmith, G. I., Villareal, D. T., & Mittendorfer, B. (2007) · American Journal of Physiology-Endocrinology and Metabolism · doi:10.1152/ajpendo.00185.2007 · Cited by 34
Self-citationTestosterone and obesity in men under the age of 40 years
Goncharov, N. P., Katsya, G. V., Chagina, N. A., & Gooren, L. J. (2009) · Andrologia · doi:10.1111/j.1439-0272.2008.00863.x · Cited by 31
Sex Differences in Lipid and Lipoprotein Metabolism: It's Not Just about Sex Hormones
Wang, X., Magkos, F., & Mittendorfer, B. (2011) · Endocrinology · doi:10.1210/endo.152.3.zee1192a · Cited by 25
Self-citationHarrison, L. I., & Harari, D. (2002) · The Journal of Clinical Pharmacology · doi:10.1177/009127002401382740 · Cited by 19
Meikle, A. W. (2008) · Yearbook of Endocrinology · doi:10.1016/s0084-3741(08)79190-x · Cited by 2
Cited by
Sorted by citations
Estrogens and androgens in skeletal physiology and pathophysiology
Almeida, M., Laurent, M. R., Dubois, V., Claessens, F., O'Brien, C. A., Bouillon, R., Vanderschueren, D., & Manolagas, S. C. (2017) · Physiological Reviews · doi:10.1152/physrev.00033.2015 · Cited by 860
Sex-Based Differences in Skeletal Muscle Kinetics and Fiber-Type Composition
Haizlip, K. M., Harrison, B. C., & Leinwand, L. A. (2015) · Physiology · doi:10.1152/physiol.00024.2014 · Cited by 521
Changes in body composition and weight during the menopause transition
Greendale, G. A., Sternfeld, B., Huang, M., Han, W., Karvonen-Gutierrez, C., Ruppert, K., Cauley, J. A., Finkelstein, J. S., Jiang, S.-F., & Karlamangla, A. S. (2019) · JCI Insight · doi:10.1172/jci.insight.124865 · Cited by 491
Effect of Estrogen on Musculoskeletal Performance and Injury Risk
Chidi-Ogbolu, N., & Baar, K. (2019) · Frontiers in Physiology · doi:10.3389/fphys.2018.01834 · Cited by 389
Aging of the musculoskeletal system: How the loss of estrogen impacts muscle strength
Collins, B. C., Laakkonen, E. K., & Lowe, D. A. (2019) · Bone · doi:10.1016/j.bone.2019.03.033 · Cited by 227
“Two studies by Smith and coworkers showed that basal rates of muscle protein synthesis were 20–30% greater in postmenopausal compared to young, pre-menopausal women [28, 31], indicating that estrogen deficiency may improve the rate of protein synthesis.”
Background
Metadata
- Authors
- Smith, G. I., Yoshino, J., Reeds, D. N., Bradley, D., Burrows, R. E., Heisey, H. D., Moseley, A. C., & Mittendorfer, B.
- Affiliations
- Washington University in St. Louis (US)
- Corresponding author
- Mittendorfer, Bettina
- ORCID
- Venue
- The Journal of Clinical Endocrinology & Metabolism
- Publisher
- The Endocrine Society
- Published
- 2014-01
- Volume
- 99
- Issue
- 1
- Pages
- 256-265
- ISSN
- 0021-972X (ISSN-L)
- 1945-7197
- PMC
- PMC3879672
- OpenAlex
- W1984814458
- Semantic Scholar
- 212b5fbdc15425ec0f98adb01fa360fe295f8550
- Cited by
- 124
- References
- 66
- Citations by year
- 2026: 9 · 2025: 16 · 2024: 11 · 2023: 13 · 2022: 10 · 2021: 13 · 2020: 11 · 2019: 11 · 2018: 7 · 2017: 5 · 2016: 10 · 2015: 3 · 2014: 4
- FWCI
- 3.29
- Type
- journal article
- Language
- en
- Open access
- bronze
- doi.org
- Locations
- The Journal of Clinical Endocrinology & Metabolism (publishedVersion)
- Europe PMC (PubMed Central) (publishedVersion)
- PubMed Central (publishedVersion)
- PubMed (publishedVersion)
- Funders
- National Institutes of Health (KL2TR000450, 5p41rr000954-34, UL1TR000448)
- National Heart, Lung, and Blood Institute (T32HL007456)
- National Institute of Diabetes and Digestive and Kidney Diseases (DK-94483, DK56341, R01DK094483, P30DK056341)
- National Center for Research Resources (P41-RR000954, RR024994, RR-024992, RR 00954, KL2RR024994, UL1RR024992)
- National Center for Advancing Translational Sciences
- Eunice Kennedy Shriver National Institute of Child Health and Human Development (P50HD057796, HD57796)
- Topics
- Health Sciences › Nursing › Nutrition and Dietetics › Muscle metabolism and nutrition
- Life Sciences › Biochemistry, Genetics and Molecular Biology › Molecular Biology › Muscle Physiology and Disorders
- Health Sciences › Medicine › Endocrinology, Diabetes and Metabolism › Hormonal and reproductive studies
- Keywords
- muscle protein synthesis, postmenopausal women, testosterone, progesterone, estradiol, sex hormones, muscle protein turnover, myostatin, follistatin, FOXO3, age-related muscle loss, skeletal muscle
- MeSH terms
- Adult, Blood Glucose, Body Composition, Estradiol, Female, Humans, Insulin, Middle Aged, Muscle Proteins, Progesterone, Testosterone, Gene Expression, Premenopause, Postmenopause, Muscle, Skeletal
About these checks
Registry, retraction, Cites and statistics results are computed, not judged, with one exception: a printed reference that no index lists is read once by a model before it counts as a citation error. Claims are extracted by a model and kept only when their quote appears verbatim in the text; each cited source is then checked, with a model’s help, for whether it says what the claim relies on. Those verdicts can be wrong — read the claim’s quote and the cited source before relying on one.
A language model drew the claims from the paper on 2026-10-09, under version 3 of the claim definition (model deepseek-v4.1-flash, prompt extract-v3).
A second model labelled each claim on 2026-10-09 (model jev-1.13-20260917, definition revision gold-guideline-v0.2).
Statistics and arithmetic are recomputed, not judged.
Confidence bands are shown only for fields calibrated on our annotated test set. None is calibrated yet, so no band is shown.
What counts as a claim ›How we measure confidence ›How we check this ›
Are you an author, or do you see a problem with this page? Request a review
