Cited by 1,476MicroRNA in disease regulationExtracellular vesicles in diseaseBarrier Structure and Function Studies

The DOI matches its Crossref record; 62 of the 62 references it cites were found in a registry or an index.

Cancer-Secreted miR-105 Destroys Vascular Endothelial Barriers to Promote Metastasis

Open access

Zhou, Weiying, Fong, Miranda Y., Min, Yongfen, Somlo, George, Liu, Liang, Palomares, Melanie R., Yu, Yang, Chow, Amy, O’Connor, Sean Timothy Francis, Chin, Andrew R., Yen, Yun, Wang, Yafan, Marcusson, Eric G., Chu, Peiguo, Wu, Jun, Wu, Xiwei, Li, Arthur Xuejun, Li, Zhuo, Gao, Hanlin, Ren, Xiubao, Boldin, Mark P., Lin, Pengnian Charles, Wang, Shizhen Emily·2014·Cancer Cell

DOI 10.1016/j.ccr.2014.03.007PMC PMC4016197

Open this paper in CoChat — free account Open PDF

Abstract

Cancer-secreted microRNAs (miRNAs) are emerging mediators of cancer-host crosstalk. Here we show that miR-105, which is characteristically expressed and secreted by metastatic breast cancer cells, is a potent regulator of migration through targeting the tight junction protein ZO-1. In endothelial monolayers, exosome-mediated transfer of cancer-secreted miR-105 efficiently destroys tight junctions and the integrity of these natural barriers against metastasis. Overexpression of miR-105 in nonmetastatic cancer cells induces metastasis and vascular permeability in distant organs, whereas inhibition of miR-105 in highly metastatic tumors alleviates these effects. miR-105 can be detected in the circulation at the premetastatic stage, and its levels in the blood and tumor are associated with ZO-1 expression and metastatic progression in early-stage breast cancer.

The claims and statistics of this paper haven’t been checked yet.

Run the check — free, no account needed. It reads the open-access text and checks the sources it cites.

Integrity signals

Registry

Crossref · 10.1016/j.ccr.2014.03.007

Cites

62 of 62 references verified0 citation errors · 0 not checkable

Statistics

Claims the paper makes

The claims and statistics of this paper haven’t been checked yet.

Run the check — free, no account needed. It reads the open-access text and checks the sources it cites.

Claims other papers make about this one

Each is checked against this paper’s own text: does it say what the citing paper says it does?

Self-check

Percentages, sums and reported differences re-computed from the paper’s own numbers.

The self-check needs the paper’s full text.

1 retracted

RETRACTED: MicroRNA signatures of tumor-derived exosomes as diagnostic biomarkers of ovarian cancer
Taylor, D. D., & Gerçel-Taylor, Ç. (2008) · Gynecologic Oncology · doi:10.1016/j.ygyno.2008.04.033 · Cited by 2,333
Retracted
Exosome-mediated transfer of mRNAs and microRNAs is a novel mechanism of genetic exchange between cells
Valadi, H., Ekström, K., Bossios, A., Sjöstrand, M., Lee, J. J., & Lötvall, J. O. (2007) · Nature Cell Biology · doi:10.1038/ncb1596 · Cited by 12,834
Circulating microRNAs as stable blood-based markers for cancer detection
Mitchell, P. S., Parkin, R. K., Kroh, E. M., Fritz, B. R., Wyman, S. K., Pogosova-Agadjanyan, E. L., Peterson, A., Noteboom, J., O'Briant, K. C., Allen, A., et al. (2008) · Proceedings of the National Academy of Sciences · doi:10.1073/pnas.0804549105 · Cited by 7,969
MicroRNA signatures in human cancers
Calin, G. A., & Croce, C. M. (2006) · Nature reviews. Cancer · doi:10.1038/nrc1997 · Cited by 7,668
Isolation and Characterization of Exosomes from Cell Culture Supernatants and Biological Fluids
Théry, C., Amigorena, S., Raposo, G., & Clayton, A. (2006) · Current Protocols in Cell Biology · doi:10.1002/0471143030.cb0322s30 · Cited by 5,766
Exosomes: composition, biogenesis and function
Théry, C., Zitvogel, L., & Amigorena, S. (2002) · Nature reviews. Immunology · doi:10.1038/nri855 · Cited by 5,355
The distribution of secondary growths in cancer of the breast.
Paget, S. (1889) · The Lancet · doi:10.1016/s0140-6736(00)49915-0 · Cited by 5,277
Glioblastoma microvesicles transport RNA and proteins that promote tumour growth and provide diagnostic biomarkers
Skog, J., Würdinger, T., van Rijn, S., Meijer, D. H., Gainche, L., Curry, W. T., Carter, B. S., Krichevsky, A. M., & Breakefield, X. O. (2008) · Nature Cell Biology · doi:10.1038/ncb1800 · Cited by 5,001
MicroRNA Gene Expression Deregulation in Human Breast Cancer
Iorio, M. V., Ferracin, M., Liu, C.-G., Veronese, A., Spizzo, R., Sabbioni, S., Magri, E., Pedriali, M., Fabbri, M., Campiglio, M., et al. (2005) · Cancer Research · doi:10.1158/0008-5472.can-05-1783 · Cited by 4,053
Dissemination and growth of cancer cells in metastatic sites
Chambers, A. F., Groom, A. C., & MacDonald, I. C. (2002) · Nature reviews. Cancer · doi:10.1038/nrc865 · Cited by 4,018

Flagged first, then by citations

Show all 62 references

Sorted by citations

Items 301–400 of 1,001

miRNAs and Other Epigenetic Changes as Biomarkers in Triple Negative Breast Cancer
Mathe, A., Scott, R. J., & Avery‐Kiejda, K. A. (2015) · International Journal of Molecular Sciences · doi:10.3390/ijms161226090 · Cited by 97
TWEAK-stimulated macrophages inhibit metastasis of epithelial ovarian cancer via exosomal shuttling of microRNA
Hu, Y., Li, D., Wu, A., Qiu, X., Di, W. J., Huang, L. H., & Qiu, L. (2017) · Cancer Letters · doi:10.1016/j.canlet.2017.02.009 · Cited by 95
Circular RNA Expression in Exosomes Derived from Breast Cancer Cells and Patients
Wang, J., Zhang, Q., Zhou, S., Xu, H., Wang, D., Feng, J., Zhao, J., & Zhong, S. (2019) · Epigenomics · doi:10.2217/epi-2018-0111 · Cited by 96
The Key Role of Exosomes on the Pre-metastatic Niche Formation in Tumors
Yang, X., Zhang, Y., Zhang, Y., Zhang, S., Qiu, L., Zhuang, Z., Wei, M., Deng, X., Wang, Z., & Han, J. (2021) · Frontiers in Molecular Biosciences · doi:10.3389/fmolb.2021.703640 · Cited by 97
Mesenchymal stem cell-derived exosomes as a new therapeutic strategy in the brain tumors
Ghasempour, E., Hesami, S., Movahed, E., Keshel, S. H., & Doroudian, M. (2022) · Stem Cell Research & Therapy · doi:10.1186/s13287-022-03212-4 · Cited by 97
Exosomes as a potential novel therapeutic tools against neurodegenerative diseases
Jarmalavičiūtė, A., & Pivoriūnas, A. (2016) · Pharmacological Research · doi:10.1016/j.phrs.2016.02.002 · Cited by 95
miR-15b and miR-21 as Circulating Biomarkers for Diagnosis of Glioma
D’Urso, P. I., D’Urso, O. F., Gianfreda, C. D., Mezzolla, V., Storelli, C., & Marsigliante, S. (2015) · Current Genomics · doi:10.2174/1389202916666150707155610 · Cited by 95
Extracellular vesicles-mediated noncoding RNAs transfer in cancer
Ma, P., Pan, Y., Li, W., Sun, C., Liu, J., Xu, T., & Shu, Y. (2017) · Journal of Hematology & Oncology · doi:10.1186/s13045-017-0426-y · Cited by 93
Role of extracellular vesicles in tumour microenvironment
Tao, S., & Guo, S. (2020) · Cell Communication and Signaling · doi:10.1186/s12964-020-00643-5 · Cited by 102
Exosomes and Extracellular Vesicles as Emerging Theranostic Platforms in Cancer Research
Ailuno, G., Baldassari, S., Lai, F., Florio, T., & Caviglioli, G. (2020) · Cells · doi:10.3390/cells9122569 · Cited by 96
Exosomes and Cell Communication: From Tumour-Derived Exosomes and Their Role in Tumour Progression to the Use of Exosomal Cargo for Cancer Treatment
Nicolini, A., Ferrari, P., & Biava, P. M. (2021) · Cancers · doi:10.3390/cancers13040822 · Cited by 98
Recent advances in understanding the complexities of metastasis
Chitty, J. L., Filipe, E. C., Lucas, M. C., Herrmann, D., Cox, T. R., & Timpson, P. (2018) · F1000Research · doi:10.12688/f1000research.15064.2 · Cited by 97
Chronic myelogenous leukemia cells remodel the bone marrow niche via exosome-mediated transfer of miR-320
Gao, X., Wan, Z., Wei, M., Dong, Y., Zhao, Y., Chen, X., Li, Z., Qin, W., Yang, G., & Liu, L. (2019) · Theranostics · doi:10.7150/thno.34813 · Cited by 94
Tumor-derived exosomal components: the multifaceted roles and mechanisms in breast cancer metastasis
Tan, Y., Luo, X., Lv, W., Hu, W., Zhao, C., Xiong, M., Yi, Y., Wang, D., Wang, Y., Wang, H., et al. (2021) · Cell Death and Disease · doi:10.1038/s41419-021-03825-2 · Cited by 95
Snail-regulated exosomal microRNA-21 suppresses NLRP3 inflammasome activity to enhance cisplatin resistance
Cheng, H.-Y., Hsieh, C.-H., Lin, P., Chen, Y.-T., Hsu, D. S., Tai, S., Chu, P., & Yang, M. (2022) · Journal for ImmunoTherapy of Cancer · doi:10.1136/jitc-2022-004832 · Cited by 94
Biogenesis, delivery, and function of extracellular RNA
Patton, J. G., Franklin, J. L., Weaver, A. M., Vickers, K. C., Zhang, B., Coffey, R. J., Ansel, K. M., Blelloch, R. H., Goga, A., Huang, B., et al. (2015) · Journal of Extracellular Vesicles · doi:10.3402/jev.v4.27494 · Cited by 92
Breast Cancer-Derived Extracellular Vesicles: Characterization and Contribution to the Metastatic Phenotype
Green, T. M., Alpaugh, M. L., Barsky, S. H., Rappa, G., & Lorico, A. (2015) · BioMed Research International · doi:10.1155/2015/634865 · Cited by 91
“…enhancement of breast cancer cells is regulated through exosomal miR-105, which can target tight junctions in primary human microvascular endothelial cells (HMVEC), resulting in the increased permeability of cell monolayers, the destruction of vascular structures, and induced HMVEC migration [162].”
Emerging roles of exosomes in cancer invasion and metastasis
Soung, Y. H., Nguyen, T., Cao, H., Lee, J. S., & Chung, J. (2016) · BMB Reports · doi:10.5483/bmbrep.2016.49.1.239 · Cited by 96
Management of Cancer Cachexia: Attempting to Develop New Pharmacological Agents for New Effective Therapeutic Options
Marceca, G. P., Londhe, P., & Calore, F. (2020) · Frontiers in Oncology · doi:10.3389/fonc.2020.00298 · Cited by 92
Epiregulin Promotes Lung Metastasis of Salivary Adenoid Cystic Carcinoma
Yang, W., Yang, L., Zhao, F., Chen, C., Xu, L., Fu, J., Li, S., & Ge, X. (2017) · Theranostics · doi:10.7150/thno.19712 · Cited by 89
“, by triggering angiogenesis and increasing vascular permeability for conditioning pre-metastatic sites in distant organs (14,18-20).”
Background
The role of extracellular vesicles in the physiological and pathological regulation of the blood–brain barrier
Busatto, S., Morad, G., Guo, P., & Moses, M. A. (2021) · FASEB BioAdvances · doi:10.1096/fba.2021-00045 · Cited by 93
The clinical relevance of circulating, exosomal miRNAs as biomarkers for cancer
Schwarzenbach, H. (2015) · Expert Review of Molecular Diagnostics · doi:10.1586/14737159.2015.1069183 · Cited by 89
Physical nanoscale conduit-mediated communication between tumour cells and the endothelium modulates endothelial phenotype
Connor, Y., Tekleab, S., Nandakumar, S., Walls, C., Tekleab, Y., Husain, A., Gadish, O., Sabbisetti, V. S., Kaushik, S., Sehrawat, S., et al. (2015) · Nature Communications · doi:10.1038/ncomms9671 · Cited by 89
“Indeed, not every endothelial cell is transformed, but as outlined in a recent study the alteration of a fraction of endothelial niche cells is sufficient to open ‘gates’ in these natural barriers for extravasation of cancer cells, thereby facilitating metastasis 17 .”
Embryonic Stem Cell–Derived mmu-miR-291a-3p Inhibits Cellular Senescence in Human Dermal Fibroblasts Through the TGF-β Receptor 2 Pathway
Bae, Y., Son, Y., Kim, C., Kim, K. S., Hyun, S. H., Woo, H. G., Jee, B. A., Choi, J., Sung, H., Choi, H.-C., et al. (2018) · The Journals of Gerontology Series A · doi:10.1093/gerona/gly208 · Cited by 95
Exosomes as Emerging Drug Delivery and Diagnostic Modality for Breast Cancer: Recent Advances in Isolation and Application
Kumar, D. N., Chaudhuri, A., Aqil, F., Dehari, D., Munagala, R., Singh, S. K., Gupta, R. C., & Agrawal, A. K. (2022) · Cancers · doi:10.3390/cancers14061435 · Cited by 90
MicroRNA-424 impairs ubiquitination to activate STAT3 and promote prostate tumor progression
Dallavalle, C., Albino, D., Civenni, G., Merulla, J., Ostano, P., Grand, M. M., Rossi, S., Losa, M., D’Ambrosio, G., Sessa, F., et al. (2016) · Journal of Clinical Investigation · doi:10.1172/jci86505 · Cited by 88
“Furthermore, miR-424 was shown to be overexpressed and to exert oncogenic functions in breast cancer (30).”
The functions and clinical applications of tumor-derived exosomes
Shao, Y., Shen, Y., Chen, T., Xu, F., Chen, X., & Zheng, S. S. (2016) · Oncotarget · doi:10.18632/oncotarget.11177 · Cited by 90
Exosomal MicroRNAs in Breast Cancer towards Diagnostic and Therapeutic Applications
Sempere, L. F., Keto, J. L., & Fabbri, M. (2017) · Cancers · doi:10.3390/cancers9070071 · Cited by 89
Exosomes in postshock mesenteric lymph are key mediators of acute lung injury triggering the macrophage activation via Toll‐like receptor 4
Kojima, M., Gimenes-Júnior, J. A., Chan, T. W., Eliceiri, B. P., Baird, A., Costantini, T. W., & Coimbra, R. S. M. (2017) · The FASEB Journal · doi:10.1096/fj.201700488r · Cited by 87
Modifying the Tumour Microenvironment: Challenges and Future Perspectives for Anticancer Plasma Treatments
Privat‐Maldonado, A., Bengtson, C., Razzokov, J., Smits, E., & Bogaerts, A. (2019) · Cancers · doi:10.3390/cancers11121920 · Cited by 90
Mast cells-derived MiR-223 destroys intestinal barrier function by inhibition of CLDN8 expression in intestinal epithelial cells
Li, M., Zhao, J., Cao, M., Liu, R., Chen, G., Li, S., Xie, Y., Xie, J., Cheng, Y., Huang, L., et al. (2020) · Biological Research · doi:10.1186/s40659-020-00279-2 · Cited by 88
Exosome as a Delivery Vehicle for Cancer Therapy
Moon, B., & Chang, S. (2022) · Cells · doi:10.3390/cells11030316 · Cited by 88
eNOS expression and NO release during hypoxia is inhibited by miR-200b in human endothelial cells
Janaszak‐Jasiecka, A., Siekierzycka, A., Bartoszewska, S., Serocki, M., Dobrucki, L. W., Collawn, J. F., Kalinowski, L., & Bartoszewski, R. (2018) · Angiogenesis · doi:10.1007/s10456-018-9620-y · Cited by 85
Exosomal miRNAs in Lung Diseases: From Biologic Function to Therapeutic Targets
Guiot, J., Struman, I., Louis, E. J., Louis, R. E., Malaise, M., & Njock, M. (2019) · Journal of Clinical Medicine · doi:10.3390/jcm8091345 · Cited by 84
Cancer-cell-secreted miR-122 suppresses O-GlcNAcylation to promote skeletal muscle proteolysis
Yan, W., Cao, M., Ruan, X., Jiang, L., Lee, S. Y., Lemanek, A., Ghassemian, M., Pizzo, D. P., Wan, Y., Qiao, Y., et al. (2022) · Nature Cell Biology · doi:10.1038/s41556-022-00893-0 · Cited by 84
miR-509 suppresses brain metastasis of breast cancer cells by modulating RhoC and TNF-α
Xing, F., Sharma, S., Liu, Y., Mo, Y.-Y., Wu, K., Zhang, Y., Pochampally, R. R., Martinez, L. A., Lo, H., & Watabe, K. (2015) · Oncogene · doi:10.1038/onc.2014.412 · Cited by 84
Exosome-transmitted miRNA-335-5p promotes colorectal cancer invasion and metastasis by facilitating EMT via targeting RASA1
Sun, X., Lin, F., Sun, W., Zhu, W., Fang, D., Luo, L., Li, S., Zhang, W., & Jiang, L. (2021) · Molecular Therapy — Nucleic Acids · doi:10.1016/j.omtn.2021.02.022 · Cited by 87
Exosomes as cell-derivative carriers in the diagnosis and treatment of central nervous system diseases
Shetgaonkar, G. G., Marques, S. M., DCruz, C. E. M., Vibhavari, R. J. A., Kumar, L., & Shirodkar, R. K. (2021) · Drug Delivery and Translational Research · doi:10.1007/s13346-021-01026-0 · Cited by 400
Functional Roles for Exosomal MicroRNAs in the Tumour Microenvironment
Bell, E., & Taylor, M. A. (2016) · Computational and Structural Biotechnology Journal · doi:10.1016/j.csbj.2016.10.005 · Cited by 82
Increasing the immune activity of exosomes: the effect of miRNA-depleted exosome proteins on activating dendritic cell/cytokine-induced killer cells against pancreatic cancer
Que, R., Cheng, L., Ding, G., Wu, Z., & Cao, L. (2016) · Journal of Zhejiang University SCIENCE B · doi:10.1631/jzus.b1500305 · Cited by 82
Exosomes and cancer: from molecular mechanisms to clinical applications
Jafari, A., Babajani, A., Abdollahpour‐Alitappeh, M., Ahmadi, N., & Rezaei–Tavirani, M. (2021) · Medical Oncology · doi:10.1007/s12032-021-01491-0 · Cited by 86
Exosomes Interactions with the Blood–Brain Barrier: Implications for Cerebral Disorders and Therapeutics
Osaid, Z., Haider, M. A., Hamoudi, R., & Harati, R. (2023) · International Journal of Molecular Sciences · doi:10.3390/ijms242115635 · Cited by 89
“Exosomes are involved in the regulation of multiple features of malignancy in tumors [13,69].”
Background
Exosomes in cancer theranostic: Diamonds in the rough
Cordonnier, M., Chanteloup, G., Isambert, N., Seigneuric, R., Fumoleau, P., Garrido, C., & Gobbo, J. (2017) · Cell Adhesion & Migration · doi:10.1080/19336918.2016.1250999 · Cited by 88
Exosomes released from pancreatic cancer cells enhance angiogenic activities via dynamin-dependent endocytosis in endothelial cells in vitro
Chiba, M., Kubota, S., Sato, K., & Monzen, S. (2018) · Scientific Reports · doi:10.1038/s41598-018-30446-1 · Cited by 82
Exosomal microRNA Biomarkers: Emerging Frontiers in Colorectal and Other Human Cancers
Tovar-Camargo, O. A., Toden, S., & Goel, A. (2016) · Expert Review of Molecular Diagnostics · doi:10.1586/14737159.2016.1156535 · Cited by 82
The Role of Cancer-Derived Exosomes in Tumorigenicity & Epithelial-to-Mesenchymal Transition
Blackwell, R. H., Foreman, K. E., & Gupta, G. N. (2017) · Cancers · doi:10.3390/cancers9080105 · Cited by 84
Exosomes in lung cancer diagnosis and treatment. From the translating research into future clinical practice
Masaoutis, C., Mihailidou, C., Tsourouflis, G. S., & Theocharis, S. E. (2018) · Biochimie · doi:10.1016/j.biochi.2018.05.014 · Cited by 81
Exosomal lncRNA‑ATB activates astrocytes that promote glioma cell invasion
Bian, E., Chen, E., Xu, Y., Yang, Z., Tang, F. R., Ma, C., Wang, H., & Zhao, B. (2018) · International Journal of Oncology · doi:10.3892/ijo.2018.4644 · Cited by 81
“Following incubation, the cells were processed as previously described (27). miRNA transfection and plasmid construction. miR-204-3p mimic (sequence: GCUGGGAAGGCAAAGGGACGU) and negative control (NC) were designed and synthesized by RiboBio Co., Ltd. (Guangzhou, China). miRNA was transfected into…”
Syndecan-1 facilitates breast cancer metastasis to the brain
Sayyad, M. R., Puchalapalli, M., Vergara, N. G., Wangensteen, S. M., Moore, M., Mu, L., Edwards, C., Anderson, A., Kall, S. L., Sullivan, M. E., et al. (2019) · Breast Cancer Research and Treatment · doi:10.1007/s10549-019-05347-0 · Cited by 81
Non-coding RNAs as potential therapeutic targets in breast cancer
Tomar, D., Yadav, A. S., Kumar, D., Bhadauriya, G., & Kundu, G. C. (2019) · Biochimica et Biophysica Acta (BBA) - Gene Regulatory Mechanisms · doi:10.1016/j.bbagrm.2019.04.005 · Cited by 82
Anti-Angiogenic Effects of Phytochemicals on miRNA Regulating Breast Cancer Progression
Varghese, E., Líšková, A., Kubatka, P., Samuel, S. M., & Büsselberg, D. (2020) · Biomolecules · doi:10.3390/biom10020191 · Cited by 80
Long Noncoding RNA MRPL23-AS1 Promotes Adenoid Cystic Carcinoma Lung Metastasis
Chen, C., Fu, M., Du, Z., Zhao, F., Yang, W., Xu, L., Li, H., & Ge, X. (2020) · Cancer Research · doi:10.1158/0008-5472.can-19-0819 · Cited by 81
Exosomes and organ-specific metastasis
Zhao, L., Ma, X., & Yu, J. (2021) · Molecular Therapy — Methods & Clinical Development · doi:10.1016/j.omtm.2021.05.016 · Cited by 82
Exosomes: a promising avenue for cancer diagnosis beyond treatment
Wang, Z., Wang, Q., Qin, F., & Chen, J. (2024) · Frontiers in Cell and Developmental Biology · doi:10.3389/fcell.2024.1344705 · Cited by 66
Extracellular Vesicles in Cancer Metastasis: Potential as Therapeutic Targets and Materials
Kogure, A., Yoshioka, Y., & Ochiya, T. (2020) · International Journal of Molecular Sciences · doi:10.3390/ijms21124463 · Cited by 82
Brain metastases-derived extracellular vesicles induce binding and aggregation of low-density lipoprotein
Busatto, S., Yang, Y., Walker, S. A., Davidovich, I., Lin, W., Lewis‐Tuffin, L. J., Anastasiadis, P. Z., Sarkaria, J. N., Talmon, Y., Wurtz, G. A., et al. (2020) · Journal of Nanobiotechnology · doi:10.1186/s12951-020-00722-2 · Cited by 83
Exosomes in the Tumor Microenvironment: From Biology to Clinical Applications
da Costa, V. R., Araldi, R. P., Vigerelli, H., D’Ámelio, F., Mendes, T. B., Gonzaga, V. F., Policiquio, B. D. O., Colozza‐Gama, G. A., Valverde, C. W., & Kerkis, I. (2021) · Cells · doi:10.3390/cells10102617 · Cited by 80
Exosomes as critical mediators of cell-to-cell communication in cancer pathogenesis and their potential clinical application
Liu, S., Sun, P., Li, Y., Liu, S., & Lu, Y. (2019) · Translational Cancer Research · doi:10.21037/tcr.2019.01.03 · Cited by 81
Leptin Modulates Exosome Biogenesis in Breast Cancer Cells: An Additional Mechanism in Cell-to-Cell Communication
Giordano, C., Gelsomino, L., Barone, I., Panza, S., Augimeri, G., Bonofiglio, D., Rovito, D., Naimo, G. D., Leggio, A., Catalano, S., et al. (2019) · Journal of Clinical Medicine · doi:10.3390/jcm8071027 · Cited by 79
Exosomic microRNAs in the Tumor Microenvironment
Neviani, P., & Fabbri, M. (2015) · Frontiers in Medicine · doi:10.3389/fmed.2015.00047 · Cited by 78
Plasma miRNA Profiles in Pregnant Women Predict Infant Outcomes following Prenatal Alcohol Exposure
Balaraman, S., Schafer, J. J., Tseng, A. M., Wertelecki, W., Yevtushok, L., Zymak‐Zakutnya, N., Chambers, C., & Miranda, R. C. (2016) · PLoS ONE · doi:10.1371/journal.pone.0165081 · Cited by 83
Antisense oligonucleotides targeting lncRNA AC104041.1 induces antitumor activity through Wnt2B/β-catenin pathway in head and neck squamous cell carcinomas
Li, M., Ding, X., Zhang, Y., Li, X., Zhou, H., Li, Y., Li, Y., Yang, P., Zhang, X., Hu, J., et al. (2020) · Cell Death and Disease · doi:10.1038/s41419-020-02820-3 · Cited by 78
Examining the evidence for extracellular RNA function in mammals
Gruner, H. N., & McManus, M. T. (2021) · Nature Reviews Genetics · doi:10.1038/s41576-021-00346-8 · Cited by 76
microRNAs as Potential Biomarkers in Adrenocortical Cancer: Progress and Challenges
Cherradi, N. (2016) · Frontiers in Endocrinology · doi:10.3389/fendo.2015.00195 · Cited by 77
The Current and Future Treatment of Brain Metastases
Hardesty, D. A., & Nakaji, P. (2016) · Frontiers in Surgery · doi:10.3389/fsurg.2016.00030 · Cited by 79
Characteristics of pre-metastatic niche: the landscape of molecular and cellular pathways
Wang, H., Pan, J., Barsky, L., Jacob, J. C., Zheng, Y., Gao, C., Wang, S., Zhu, W., Sun, H., Lu, L., et al. (2021) · Molecular Biomedicine · doi:10.1186/s43556-020-00022-z · Cited by 81
Exosomes: A New Pathway for Cancer Drug Resistance
Zhong, Y., Li, H., Li, P., Chen, Y., Zhang, M., Yuan, Z., Zhang, Y., Xu, Z., Luo, G. Q., Fang, Y., et al. (2021) · Frontiers in Oncology · doi:10.3389/fonc.2021.743556 · Cited by 77
Advances in the analysis of single extracellular vesicles: A critical review
Hilton, S. H., & White, I. M. (2021) · Sensors and Actuators Reports · doi:10.1016/j.snr.2021.100052 · Cited by 74
Exosome-mediated remodeling of the tumor microenvironment: From local to distant intercellular communication
Huang, Y., Kanada, M., Ye, J., Deng, Y., He, Q., Lei, Z., Chen, Y., Li, Y., Qin, P., Zhang, J., et al. (2022) · Cancer Letters · doi:10.1016/j.canlet.2022.215796 · Cited by 76
Role of the Exosome in Ovarian Cancer Progression and Its Potential as a Therapeutic Target
Nakamura, K., Sawada, K., Kobayashi, M., Miyamoto, M., Shimizu, A., Yamamoto, M., Kinose, Y., & Kimura, T. (2019) · Cancers · doi:10.3390/cancers11081147 · Cited by 80
Exosomal miRNAs: the tumor's trojan horse in selective metastasis
Bayat, M., & Nahand, J. S. (2024) · Molecular Cancer · doi:10.1186/s12943-024-02081-0 · Cited by 81
“…is implicated in the extracellular pro-tumorigenic characteristic and is correlated with a worse prognosis in TNBCs. MiR-105 was character-istically secreted by memory B cell (MBC) and was a potent migration regulator through targeting the tight junction protein zona occluden-1 (ZO-1) [164].”
Background
Extracellular Vesicles: Role in Inflammatory Responses and Potential Uses in Vaccination in Cancer and Infectious Diseases
Campos, J. H. C., Soares, R. P., Ribeiro, K. S., Andrade, A. C., Batista, W. L., & Torrecilhas, A. C. (2015) · Journal of Immunology Research · doi:10.1155/2015/832057 · Cited by 80
“Interestingly, it is possible to detect miR-105 in the blood circulation before the metastasis establishment reinforcing its potential role as a diagnostic biomarker [20].”
Background
Therapeutic implications of cellular and molecular biology of cancer stem cells in melanoma
Kumar, D., Gorain, M., Kundu, G., & Kundu, G. C. (2017) · Molecular Cancer · doi:10.1186/s12943-016-0578-3 · Cited by 78
Exosomes: Biogenesis, Composition, Functions, and Their Role in Pre-metastatic Niche Formation
Patil, A. A., & Rhee, W. J. (2019) · Biotechnology and Bioprocess Engineering · doi:10.1007/s12257-019-0170-y · Cited by 75
The multifaceted role of extracellular vesicles in metastasis: Priming the soil for seeding
Pultz, B. D. A., da Luz, F. A. C., Faria, S. S., de Souza, L. P. M., Tavares, P. C. B., Alonso‐Goulart, V., Fontes, W., Goulart, L. R., & Silva, M. J. B. (2017) · International Journal of Cancer · doi:10.1002/ijc.30595 · Cited by 73
Proteinase-activated Receptor 2 Promotes Cancer Cell Migration through RNA Methylation-mediated Repression of miR-125b
Yang, L., Ma, Y., Han, W., Li, W., Cui, L., Zhao, X., Tian, Y., Zhou, Z., Wang, W., & Wang, H. (2015) · Journal of Biological Chemistry · doi:10.1074/jbc.m115.667717 · Cited by 72
Metastatic breast cancer cells overexpress and secrete miR-218 to regulate type I collagen deposition by osteoblasts
Liu, X., Cao, M., Palomares, M. R., Wu, X., Li, A., Yan, W., Fong, M., Chan, W.-C., & Wang, S. E. (2018) · Breast Cancer Research · doi:10.1186/s13058-018-1059-y · Cited by 74
Exosome-delivered and Y RNA-derived small RNA suppresses influenza virus replication
Liu, Y.-M., Tseng, C.-H., Chen, Y., Yu, W., Ho, M.-Y., Ho, C.-Y., Lai, M. M. C., & Su, W. (2019) · Journal of Biomedical Science · doi:10.1186/s12929-019-0553-6 · Cited by 73
Exosome-mediated microenvironment dysregulation in leukemia
Kumar, B., García, M., Murakami, J. L., & Chen, C. (2015) · Biochimica et Biophysica Acta (BBA) - Molecular Cell Research · doi:10.1016/j.bbamcr.2015.09.017 · Cited by 75
Exosomes derived from M1 macrophages aggravate neointimal hyperplasia following carotid artery injuries in mice through miR-222/CDKN1B/CDKN1C pathway
Wang, Z., Zhu, H., Shi, H., Zhao, H., Gao, R., Weng, X., Liu, R., Li, X., Zou, Y., Hu, K., et al. (2019) · Cell Death and Disease · doi:10.1038/s41419-019-1667-1 · Cited by 72
MicroRNA Regulation of Endothelial Junction Proteins and Clinical Consequence
Zhuang, Y., Hu, P., Mastej, V., & Chen, W. (2016) · Mediators of Inflammation · doi:10.1155/2016/5078627 · Cited by 72
Exosomes and breast cancer: a comprehensive review of novel therapeutic strategies from diagnosis to treatment
Wu, C., Du, S., Zhang, J., Liang, A.-L., & Liu, Y. (2016) · Cancer Gene Therapy · doi:10.1038/cgt.2016.69 · Cited by 73
The contributions of cancer cell metabolism to metastasis
Pascual, G., Domínguez, D., & Benitah, S. A. (2018) · Disease Models & Mechanisms · doi:10.1242/dmm.032920 · Cited by 74
“Tumours also secrete metastasis-promoting exosomes that contain various proteins, mRNAs and microRNAs, to establish a distant pro-metastatic niche (Costa-Silva et al., 2015; Ghajar et al., 2013; Obenauf et al., 2015; Peinado et al., 2012; Zhou et al., 2014; Zomer et al., 2015).”
Exosome-Mediated Signaling in Epithelial to Mesenchymal Transition and Tumor Progression
Conigliaro, A., & Cicchini, C. (2018) · Journal of Clinical Medicine · doi:10.3390/jcm8010026 · Cited by 74
Communication in tiny packages: Exosomes as means of tumor-stroma communication
Daßler‐Plenker, J., Küttner, V., & Egeblad, M. (2020) · Biochimica et Biophysica Acta (BBA) - Reviews on Cancer · doi:10.1016/j.bbcan.2020.188340 · Cited by 72
The emerging roles of exosomes in anti-cancer drug resistance and tumor progression: An insight towards tumor-microenvironment interaction
Jena, B. C., & Mandal, M. (2020) · Biochimica et Biophysica Acta (BBA) - Reviews on Cancer · doi:10.1016/j.bbcan.2020.188488 · Cited by 71
The role and therapeutic potential of MSC-derived exosomes in osteoarthritis
Bao, C., & He, C. (2021) · Archives of Biochemistry and Biophysics · doi:10.1016/j.abb.2021.109002 · Cited by 73
Micro RNA ‐708‐3p mediates metastasis and chemoresistance through inhibition of epithelial‐to‐mesenchymal transition in breast cancer
Lee, J., Guan, W., Han, S., Hong, D., Kim, L.-S., & Kim, H. (2018) · Cancer Science · doi:10.1111/cas.13588 · Cited by 71
Biological functions and clinical applications of exosomal non-coding RNAs in hepatocellular carcinoma
Li, C., & Xu, X. (2019) · Cellular and Molecular Life Sciences · doi:10.1007/s00018-019-03215-0 · Cited by 70
Liquid biopsies to occult brain metastasis
Rehman, A. U., Κhan, P., Maurya, S. K., Siddiqui, J. A., Santamaria‐Barria, J. A., Batra, S. K., & Nasser, M. W. (2022) · Molecular Cancer · doi:10.1186/s12943-022-01577-x · Cited by 72
MicroRNA-105 suppresses cell proliferation and inhibits PI3K/AKT signaling in human hepatocellular carcinoma
Shen, G., Rong, X., Zhao, J., Yang, X., Li, H., Jiang, H., Zhou, Q., Ji, T., Huang, S., Zhang, J., et al. (2014) · Carcinogenesis · doi:10.1093/carcin/bgu208 · Cited by 70
Exosomes: mobile platforms for targeted and synergistic signaling across cell boundaries
Vyas, N., & Dhawan, J. (2016) · Cellular and Molecular Life Sciences · doi:10.1007/s00018-016-2413-9 · Cited by 71
Brain Metastasis OrganotropismPreprint
Yuzhalin, A. E., & Yu, D. (2019) · Cold Spring Harbor Perspectives in Medicine · doi:10.1101/cshperspect.a037242 · Cited by 71
The Impact of Extracellular Vesicle-Encapsulated Circulating MicroRNAs in Lung Cancer Research
Fujita, Y., Kuwano, K., Ochiya, T., & Takeshita, F. (2014) · BioMed Research International · doi:10.1155/2014/486413 · Cited by 69
Osteoclast-derived apoptotic bodies show extended biological effects of parental cell in promoting bone defect healing
Ma, Q., Liang, M., Limjunyawong, N., Dan, Y., Xing, J., Li, J., Xu, J., & Dou, C. (2020) · Theranostics · doi:10.7150/thno.45170 · Cited by 70
MicroRNA Derived from Circulating Exosomes as Noninvasive Biomarkers for Diagnosing Renal Cell Carcinoma
Xiao, C., Lai, W., Zhu, W., & Wang, H. (2020) · OncoTargets and Therapy · doi:10.2147/ott.s271606 · Cited by 69
Tumor-derived exosomes: Nanovesicles made by cancer cells to promote cancer metastasis
Chen, H., Chengalvala, V., Hu, H., & Sun, D. (2021) · Acta Pharmaceutica Sinica B · doi:10.1016/j.apsb.2021.04.012 · Cited by 72
miR-105-5p regulates PD-L1 expression and tumor immunogenicity in gastric cancer
Miliotis, C., & Slack, F. J. (2021) · Cancer Letters · doi:10.1016/j.canlet.2021.05.037 · Cited by 68
The Breast Tumor Microenvironment: A Key Player in Metastatic Spread
Terceiro, L. E. L., Edechi, C. A., Ikeogu, N. M., Nickel, B. E., Hombach‐Klonisch, S., Sharif, T., Leygue, E., & Myal, Y. (2021) · Cancers · doi:10.3390/cancers13194798 · Cited by 69
hnRNPA2B1-Mediated Extracellular Vesicles Sorting of miR-122-5p Potentially Promotes Lung Cancer Progression
Li, C., Qin, F., Wang, W., Ni, Y., Gao, M., Guo, M., & Sun, G. (2021) · International Journal of Molecular Sciences · doi:10.3390/ijms222312866 · Cited by 69
“Oncogenic EV miRNAs promote the formation of a pre-metastatic microenvironment, altering the microenvironment of distant organs to be more suitable for seeding of metastatic cancer cells [30,31].”
Background

Authors: Zhou, W., Fong, M. Y., Min, Y., Somlo, G., Liu, L., Palomares, M. R., Yu, Y., Chow, A., O’Connor, S. T. F., Chin, A. R., Yen, Y., Wang, Y., Marcusson, E. G., Chu, P., Wu, J., Wu, X., Li, A. X., Li, Z., Gao, H., Ren, X., Boldin, M. P., Lin, P. C., & Wang, S. E.
Affiliations: City Of Hope National Medical Center (US)
National Cancer Institute (US)
Regulus Therapeutics (United States) (US)
Tianjin Medical University Cancer Institute and Hospital (CN)
Corresponding author: Wang, Shizhen Emily
ORCID: Zhou, Weiying
Liu, Liang
Palomares, Melanie R.
Yu, Yang
Chow, Amy
Yen, Yun
Wang, Yafan
Marcusson, Eric G.
Wu, Jun
Wu, Xiwei
Li, Zhuo
Gao, Hanlin
Ren, Xiubao
Boldin, Mark P.
Wang, Shizhen Emily
Venue: Cancer Cell
Publisher: Elsevier BV
Published: 2014-04
Volume: 25
Issue: 4
Pages: 501-515
ISSN: 1535-6108 (ISSN-L)
DOI: 10.1016/j.ccr.2014.03.007
PMC: PMC4016197
OpenAlex: W2143839116
Cited by: 1,476
References: 62
Citations by year: 2026: 61 · 2025: 91 · 2024: 113 · 2023: 145 · 2022: 164 · 2021: 175 · 2020: 148 · 2019: 152 · 2018: 118 · 2017: 111 · 2016: 97 · 2015: 72 · 2014: 28
FWCI: 32.89
Type: journal article
Language: en
Open access: bronze
doi.org
Licence: www.elsevier.com/tdm/userlicense/1.0/ (tdm)
www.elsevier.com/open-access/userlicense/1.0/ (vor, 378 d)
Locations: Cancer Cell (publishedVersion)
PubMed (publishedVersion)
Europe PMC (PubMed Central) (acceptedVersion)
PubMed Central (acceptedVersion)
eScholarship (California Digital Library) (submittedVersion)
Funders: American Association for Cancer Research
Breast Cancer Research Foundation (12-60-26-WANG)
Celgene
National Institutes of Health
National Key Research and Development Program of China (2012CB9333004)
National Cancer Institute (P30CA-33572, R01CA166020, R01CA163586, P30CA033572)
Topics: Life Sciences › Biochemistry, Genetics and Molecular Biology › Cancer Research › MicroRNA in disease regulation
Life Sciences › Biochemistry, Genetics and Molecular Biology › Molecular Biology › Extracellular vesicles in disease
Life Sciences › Neuroscience › Neurology › Barrier Structure and Function Studies
Keywords: miR-105, metastasis, breast cancer, ZO-1, tight junctions, endothelial barrier integrity, exosomes, vascular permeability, metastatic progression
MeSH terms: Breast Neoplasms, Cell Movement, Endothelium, Vascular, Female, Humans, Neoplasm Metastasis, Biomarkers, Tumor, MicroRNAs, Cell Line, Tumor, Cell Growth Processes

About these checks

Registry, retraction, Cites and statistics results are computed, not judged, with one exception: a printed reference that no index lists is read once by a model before it counts as a citation error. Claims are extracted by a model and kept only when their quote appears verbatim in the text; each cited source is then checked, with a model’s help, for whether it says what the claim relies on. Those verdicts can be wrong — read the claim’s quote and the cited source before relying on one.

Statistics and arithmetic are recomputed, not judged.

Confidence bands are shown only for fields calibrated on our annotated test set. None is calibrated yet, so no band is shown.

What counts as a claim ›How we measure confidence ›How we check this ›

Are you an author, or do you see a problem with this page? Request a review

Cancer-Secreted miR-105 Destroys Vascular Endothelial Barriers to Promote Metastasis

Abstract

Overview

Integrity signals

Verification

Claims the paper makes

Claims other papers make about this one

Self-check

Citations

Cites

Cited by

Related

Metadata

Record

About these checks