The DOI matches its Crossref record; 102 of the 102 references it cites were found in a registry or an index; none of the 21 sources its claims cite is checked for support yet.
Targeted Degradation of CTCF Decouples Local Insulation of Chromosome Domains from Genomic Compartmentalization
Open accessPublished version of a preprint
Abstract
Summary The molecular mechanisms underlying folding of mammalian chromosomes remain poorly understood. The transcription factor CTCF is a candidate regulator of chromosomal structure. Using the auxin-inducible degron system in mouse embryonic stem cells, we show that CTCF is absolutely and dose-dependently required for looping between CTCF target sites and insulation of topologically associating domains (TADs). Restoring CTCF reinstates proper architecture on altered chromosomes, indicating a powerful instructive function for CTCF in chromatin folding. CTCF remains essential for TAD organization in non-dividing cells. Surprisingly, active and inactive genome compartments remain properly segregated upon CTCF depletion, revealing that compartmentalization of mammalian chromosomes emerges independently of proper insulation of TADs. Further, our data support that CTCF mediates transcriptional insulator function through enhancer-blocking but not as a direct barrier to heterochromatin spreading. Beyond defining the functions of CTCF in chromosome folding these results provide new fundamental insights into the rules governing mammalian genome organization.
Overview
AI snapshot
Written from the paper’s full text.
TL;DR
Acute auxin-inducible degradation of CTCF in mouse embryonic stem cells shows that CTCF is required for CTCF-site looping and TAD insulation but not for A/B compartmentalization. The paper separates local TAD insulation from higher-order genome compartmentalization and supports CTCF as an enhancer blocker rather than a direct H3K27me3 barrier.
Key findings
- CTCF depletion abolished CTCF-anchored loops and caused loss of insulation at >80% of TAD boundaries; 1000 persistent CTCF-less boundaries (18% of initial boundaries) remained, and restoring CTCF re-established architecture.
- A/B compartments remained properly segregated after CTCF depletion, with only a minor reproducible ~10% reduction in compartmentalization strength; contact-frequency scaling with genomic distance did not change.
- Insulation defects were dose-dependent: cells with around 15% residual CTCF preserved more insulation than completely depleted cells, helping explain milder RNAi phenotypes that leave 10–15% CTCF.
- RNA-seq showed 370 differentially expressed genes at day 1 and 4996 at day 4; >80% of early down-regulated genes had CTCF bound within 1 kb of the TSS, while up-regulated genes were closer to active enhancers and more often separated from them by a TAD boundary. CTCF depletion did not trigger H3K27me3 spreading.
Methods
- Endogenous CTCF was tagged at both Ctcf alleles with an auxin-inducible degron (AID) in E14Tg2a mouse embryonic stem cells, with Tir1 expression and 500 µM auxin/IAA for acute, reversible depletion; cells were also differentiated into neural precursor cells and resting astrocytes.
- Chromosome conformation was assayed by 5C at the Xic and by Hi-C at 20 kb/100 kb resolution, alongside ChIP-seq, ChIP-exo, RNA-seq time courses, 3D DNA FISH, Western blotting, flow cytometry, and proliferation assays.
- Analyses included insulation-score boundary calling, A/B compartment eigenvector analysis, differential expression, CTCF motif orientation, and integration with CTCF/Cohesin loop anchors and enhancer annotations.
Limitations
- The paper states that comparing Hi-C and FISH is limited because Hi-C read numbers are normalized between samples while FISH distances are absolute; it also notes that RNA-seq does not directly measure ongoing transcription rates and that limited Hi-C resolution prevents robust identification of small TADs.
- The paper states that Tir1 transgene variegation upon differentiation limited analyses in committed cells, that CTCF-AID NPC subclones did not survive freeze-thawing, and that insulation did not reform after auxin washout in resting astrocytes.
- The text makes evident that most experiments rely on mESCs and selected loci/cell types, that the AID fusion caused basal CTCF levels about 2–3-fold lower than parental cells, and that prolonged depletion produces secondary effects, so the study focuses on acute depletion during at least two days.
Model-written summary. Check it against the paper before relying on it.
Integrity signals
Registry
Cites
Statistics
Verification
Claims the paper makes
0 of 21 cited sources checked · 0 supported · 0 flagged
A result the paper reports from its own data — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“Surprisingly, active and inactive genome compartments remain properly segregated upon CTCF depletion, revealing that compartmentalization of mammalian chromosomes emerges independently of proper insulation of TADs.”
- Also stated in: § Disruption of Local Insulation Does Not Affect Higher-Order Chromosome Folding · hedged
“Contact maps (Figure 4A) as well as compartment signal (Imakaev et al., 2012) indicated that compartmentalization and genomic location of the transitions between A-and B- compartments are maintained after CTCF depletion (Figure 4B-C and S4A).”
§ Targeted degradation of CTCF decouples local insulation of chromosome domains from genomic compartmentalization > Abstract
Load-bearingStrength:plain· not yet calibratedTests✓ Asserted: passes✓ Checkable: passes✓ Load-bearing: passes✓ Based: passes- Also stated in: § Disruption of Local Insulation Does Not Affect Higher-Order Chromosome Folding · hedged
A result the paper reports from its own data — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“The fact that in our data CTCF does not bind the majority (80%) of TSS of genes up-regulated after 1 day suggests CTCF normally represses them indirectly.”
§ Targeted degradation of CTCF decouples local insulation of chromosome domains from genomic compartmentalization > Results > CTCF and transcriptional regulation
Load-bearingStrength:hedged· not yet calibratedTests✓ Asserted: passes✓ Checkable: passes✓ Load-bearing: passes✓ Based: passesA result the paper reports from its own data — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“We detected a minor but reproducible reduction (∼10%) in the strength of compartmentalization upon CTCF depletion (Figure S4B).”
§ Targeted degradation of CTCF decouples local insulation of chromosome domains from genomic compartmentalization > Results > Disruption of Local Insulation Does Not Affect Higher-Order Chromosome Folding
Tests✓ Asserted: passes✓ Checkable: passes✓ Load-bearing: passes✓ Based: passesA result the paper reports from its own data — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“Taking advantage of the Smc1a HiChIP data we noticed that promoters of mis-regulated genes are more often close to loop anchors than promoters of non-regulated genes (Figure S6D), while the distribution is similar outside of the anchors.”
§ Targeted degradation of CTCF decouples local insulation of chromosome domains from genomic compartmentalization > Results > CTCF and transcriptional regulation
Tests✓ Asserted: passes✓ Checkable: passes✓ Load-bearing: passes✓ Based: passesA result the paper reports from its own data — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“Strikingly, the orientation of the CTCF motif at these TSSs is almost systematically in direct orientation with the direction of transcription (90% of unequivocal sites, Figure 6C and Supplementary Table 7).”
§ Targeted degradation of CTCF decouples local insulation of chromosome domains from genomic compartmentalization > Results > CTCF and transcriptional regulation
Strength:boosted· not yet calibratedCausal:correlational· not yet calibratedTests✓ Asserted: passes✓ Checkable: passes? Load-bearing: unclear✓ Based: passesIn the paper
“consistent with previous boundary-deletion experiments (Ji et al., 2016), TAD boundaries separate further apart in the three-dimensional space of the nucleus (Figure S3L).”
§ Targeted degradation of CTCF decouples local insulation of chromosome domains from genomic compartmentalization > Results > CTCF Depletion Triggers Dramatic Loss of TAD Insulation
What the sources say
- Not checked yetcites Ji et al., 2016
Strength:plain· not yet calibratedCausal:direct· not yet calibratedTests✓ Asserted: passes✓ Checkable: passes? Load-bearing: unclear✓ Based: passesA result the paper reports from its own data — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“Intra-TAD FISH distances were unaffected by CTCF depletion, indicating that loss of CTCF does not trigger general chromatin compaction.”
- Also stated in: § CTCF Binding Is Not a Direct Impediment to H3K27me3 Spreading in mESCs · plain
“Overall chromosome compaction and organization are however not affected.”
§ Targeted degradation of CTCF decouples local insulation of chromosome domains from genomic compartmentalization > Results > CTCF Depletion Triggers Dramatic Loss of TAD Insulation
Load-bearingStrength:plain· not yet calibratedTests✓ Asserted: passes✓ Checkable: passes✓ Load-bearing: passes✓ Based: passes- Also stated in: § CTCF Binding Is Not a Direct Impediment to H3K27me3 Spreading in mESCs · plain
A result the paper reports from its own data — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“The enrichment level in persistent peaks was severely reduced (Figure S2D-E), indicating that CTCF occupancy is lost or considerably lower at all of its binding sites after depletion.”
§ Targeted degradation of CTCF decouples local insulation of chromosome domains from genomic compartmentalization > Results > Auxin Treatment Severely Depletes CTCF from Chromatin
Tests✓ Asserted: passes✓ Checkable: passes✓ Load-bearing: passes✓ Based: passesA result the paper reports from its own data — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“From these 1000 CTCF-less residual boundaries 609 (61%) had at least one CTCF ChIP-seq peak +/- 1 bin (20kb) prior to depletion, suggesting that CTCF binding at these sites is not what initially drove local insulation.”
§ Targeted degradation of CTCF decouples local insulation of chromosome domains from genomic compartmentalization > Results > Disruption of Local Insulation Does Not Affect Higher-Order Chromosome Folding
Tests✓ Asserted: passes✓ Checkable: passes✓ Load-bearing: passes✓ Based: passesIn the paper
“As reported previously the AID fusion led to slight constitutive destabilization (Morawska and Ulrich, 2013), so that basal CTCF levels were about 2–3-fold less in the AID-eGFP fusion line compared to the untagged parental line (Figure 1B and C).”
§ Targeted degradation of CTCF decouples local insulation of chromosome domains from genomic compartmentalization > Results > Acute CTCF Depletion with the Auxin-Inducible Degron System
What the sources say
- Not checked yetcites Morawska and Ulrich, 2013
Strength:plain· not yet calibratedCausal:direct· not yet calibratedTests✓ Asserted: passes✓ Checkable: passes? Load-bearing: unclear✓ Based: passes
- It may state two separate claims as one. 24
- Probably not a substantial claim. 23
A result the paper reports from its own data — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“After removing those that displayed residual CTCF binding by ChIP-seq we identified 1000 persistent CTCF-less boundaries (18% of initial boundaries), where insulation was much less affected by CTCF depletion (Figure 3B).”
§ Targeted degradation of CTCF decouples local insulation of chromosome domains from genomic compartmentalization > Results > CTCF Depletion Triggers Dramatic Loss of TAD Insulation
Load-bearingStrength:plain· not yet calibratedTests✓ Asserted: passes✓ Checkable: passes✓ Load-bearing: passes✓ Based: passesIt may state two separate claims as one.
A result the paper reports from its own data — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“Integration with CTCF Chip-exo data revealed that over 80% of the early down-regulated genes had CTCF bound within 1kb of the transcription start site (TSS) prior to depletion, as opposed to less than 20% of the up-regulated genes (Figure 6B).”
§ Targeted degradation of CTCF decouples local insulation of chromosome domains from genomic compartmentalization > Results > CTCF and transcriptional regulation
Tests✓ Asserted: passes✓ Checkable: passes✓ Load-bearing: passes✓ Based: passesIt may state two separate claims as one.
A result the paper reports from its own data — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“Washing off auxin led to reformation of insulated TADs in mESCs and NPCs but not resting astrocytes.”
§ Targeted degradation of CTCF decouples local insulation of chromosome domains from genomic compartmentalization > Results > Loss of CTCF also Triggers Misfolding in Non-Cycling Cells
Tests✓ Asserted: passes✓ Checkable: passes✓ Load-bearing: passes✓ Based: passesIt may state two separate claims as one.
A result the paper reports from its own data — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“Auxin washoff after a 2-day treatment did not completely restore the transcriptome, with most (252 out of 278, 90%) of the differentially expressed genes remaining up-regulated compared to untreated cells (Figure 6A-B).”
§ Targeted degradation of CTCF decouples local insulation of chromosome domains from genomic compartmentalization > Results > CTCF and transcriptional regulation
Load-bearingStrength:plain· not yet calibratedTests✓ Asserted: passes✓ Checkable: passes✓ Load-bearing: passes✓ Based: passesIt may state two separate claims as one.
A result the paper reports from its own data — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“with around half of the dysregulated being down-regulated and half up-regulated at each time-point.”
§ Targeted degradation of CTCF decouples local insulation of chromosome domains from genomic compartmentalization > Results > CTCF and transcriptional regulation
Strength:plain· not yet calibratedTests✓ Asserted: passes✓ Checkable: passes✗ Load-bearing: fails✓ Based: passesProbably not a substantial claim. The paper’s conclusions may not depend on it.
A result the paper reports from its own data — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“CTCF depletion was maximal as early as 3h45 after adding auxin (Figure 1E).”
- Also stated in: § Acute CTCF Depletion with the Auxin-Inducible Degron System · plain
“Recovery initiated readily after washoff and was half complete by 15h (Figure 1E).”
§ Targeted degradation of CTCF decouples local insulation of chromosome domains from genomic compartmentalization > Results > Acute CTCF Depletion with the Auxin-Inducible Degron System
Strength:plain· not yet calibratedTests✓ Asserted: passes✓ Checkable: passes? Load-bearing: unclear✓ Based: passesIt may state two separate claims as one.
- Also stated in: § Acute CTCF Depletion with the Auxin-Inducible Degron System · plain
A result the paper reports from its own data — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“Restoring CTCF reinstates proper architecture on altered chromosomes, indicating a powerful instructive function for CTCF in chromatin folding.”
- Also stated in: § CTCF is required for accumulating chromatin loops at CTCF sites · plain
“In contrast, auxin-mediated depletion of CTCF led to complete disappearance of these 5C peaks while auxin washoff restored them (Figure S2I).”
§ Targeted degradation of CTCF decouples local insulation of chromosome domains from genomic compartmentalization > Abstract
Tests✓ Asserted: passes✓ Checkable: passes✓ Load-bearing: passes✓ Based: passesIt may state two separate claims as one.
- Also stated in: § CTCF is required for accumulating chromatin loops at CTCF sites · plain
A result the paper reports from its own data — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“Importantly, CTCF depletion in mESCs did not block cells in a specific phase of the cell cycle, and did not induce DNA damage or aneuploidy (Supplementary figures 1D-E).”
§ Targeted degradation of CTCF decouples local insulation of chromosome domains from genomic compartmentalization > Results > Acute CTCF Depletion with the Auxin-Inducible Degron System
Load-bearingStrength:plain· not yet calibratedTests✓ Asserted: passes✓ Checkable: passes✓ Load-bearing: passes✓ Based: passesIt may state two separate claims as one.
A result the paper reports from its own data — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“Folding defects appeared somewhat less pronounced in differentiated cells, correlating with switching of a large portion of the region surveyed into a lamina associated domain (LAD) – and presumably B compartment (Figure 5A-D).”
§ Targeted degradation of CTCF decouples local insulation of chromosome domains from genomic compartmentalization > Results > Loss of CTCF also Triggers Misfolding in Non-Cycling Cells
Strength:hedged· not yet calibratedCausal:correlational· not yet calibratedTests✓ Asserted: passes✓ Checkable: passes? Load-bearing: unclear✓ Based: passesIt may state two separate claims as one.
In the paper
“In contrast, auxin-mediated degradation of CTCF prevented subcloning of CTCF-AID cells, recapitulating the full CTCF knockout phenotype in mESCs (Sleutels et al., 2012) (Figure 1D).”
§ Targeted degradation of CTCF decouples local insulation of chromosome domains from genomic compartmentalization > Results > Acute CTCF Depletion with the Auxin-Inducible Degron System
What the sources say
- Not checked yetcites Sleutels et al., 2012 source
Tests✓ Asserted: passes✓ Checkable: passes✓ Load-bearing: passes✓ Based: passesIt may state two separate claims as one.
A result the paper reports from its own data — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“Loss of CTCF led to loss of insulation at most boundaries (>80%, Figure 3B).”
§ Targeted degradation of CTCF decouples local insulation of chromosome domains from genomic compartmentalization > Results > CTCF Depletion Triggers Dramatic Loss of TAD Insulation
Tests✓ Asserted: passes✓ Checkable: passes✓ Load-bearing: passes✓ Based: passesIt may state two separate claims as one.
A result the paper reports from its own data — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“We noticed that at the promoter of the immediately down-regulated genes CTCF is bound slightly upstream of the TSS (around 60bp) and demarcates the beginning of the nucleosome-depleted region (Figure 6C).”
§ Targeted degradation of CTCF decouples local insulation of chromosome domains from genomic compartmentalization > Results > CTCF and transcriptional regulation
Tests✓ Asserted: passes✓ Checkable: passes✓ Load-bearing: passes✓ Based: passesIt may state two separate claims as one.
A result the paper reports from its own data — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“On a more global scale, we observed a slight but significant decrease in overall H3K27me3 levels (Figure S7B).”
§ Targeted degradation of CTCF decouples local insulation of chromosome domains from genomic compartmentalization > Results > CTCF Binding Is Not a Direct Impediment to H3K27me3 Spreading in mESCs
Strength:plain· not yet calibratedCausal:direct· not yet calibratedTests✓ Asserted: passes✓ Checkable: passes✗ Load-bearing: fails✓ Based: passesProbably not a substantial claim. The paper’s conclusions may not depend on it.
A result the paper reports from its own data — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“Auxin in itself was neutral to untagged mESCs (Figure 1D and E), with no differential gene activity detected after up to 4 days of treatment (Supplementary tables 2 and 3).”
§ Targeted degradation of CTCF decouples local insulation of chromosome domains from genomic compartmentalization > Results > Acute CTCF Depletion with the Auxin-Inducible Degron System
Load-bearingStrength:plain· not yet calibratedTests✓ Asserted: passes✓ Checkable: passes✓ Load-bearing: passes✓ Based: passesIt may state two separate claims as one.
A result the paper reports from its own data — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“Basal CTCF-AID-eGFP levels were slightly lower (1.5-2 fold) than when Tir1 was inserted at Rosa26 or randomly (Figure S3C)”
§ Targeted degradation of CTCF decouples local insulation of chromosome domains from genomic compartmentalization > Method Details > Gene targeting
Strength:plain· not yet calibratedCausal:correlational· not yet calibratedTests✓ Asserted: passes✓ Checkable: passes✗ Load-bearing: fails✓ Based: passesProbably not a substantial claim. The paper’s conclusions may not depend on it.
In the paper
“We observed equivalent CTCF depletion efficiency with the AID* as with the original full-length 231 amino-acid tag (Nishimura et al., 2009) (data not shown).”
§ Targeted degradation of CTCF decouples local insulation of chromosome domains from genomic compartmentalization > Method Details > Plasmid Construction
What the sources say
- Not checked yetcites Nishimura et al., 2009 source
Strength:plain· not yet calibratedTests✓ Asserted: passes✓ Checkable: passes✗ Load-bearing: fails✓ Based: passesProbably not a substantial claim. The paper’s conclusions may not depend on it.
A result the paper reports from its own data — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“The Tir1 transgene variegated upon differentiation, which we overcame by first converting CTCF-AID mESCs into self-renewing Neural Precursor Cells (NPCs), subcloning NPCs and then selecting clonal lines that retained homogenous CTCF degradation upon auxin treatment.”
- Also stated in: § Gene targeting · plain
“Indeed our CTCF-AID lines down-regulated Tir1 during differentiation, even when targeted at Rosa26, leading to variegation of auxin response and limiting our analyses in committed cells that can be subcloned, such as neural progenitors.”
§ Targeted degradation of CTCF decouples local insulation of chromosome domains from genomic compartmentalization > Experimental Model and Subject Details > Neural progenitor cells and astrocytes
Strength:plain· not yet calibratedCausal:direct· not yet calibratedTests✓ Asserted: passes✓ Checkable: passes? Load-bearing: unclear✓ Based: passesIt may state two separate claims as one.
- Also stated in: § Gene targeting · plain
A result the paper reports from its own data — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“We noticed that only a handful of resistant clones were recovered, suggesting sub-optimal targeting – either because of the sgRNA or the targeting construct.”
§ Targeted degradation of CTCF decouples local insulation of chromosome domains from genomic compartmentalization > Method Details > Gene targeting
Strength:hedged· not yet calibratedCausal:correlational· not yet calibratedTests✓ Asserted: passes✓ Checkable: passes✗ Load-bearing: fails✓ Based: passesProbably not a substantial claim. The paper’s conclusions may not depend on it.
A result the paper reports from its own data — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“We noticed that Tir1 targeting with the Tigre targeting vector was at least 5-fold more efficient than with our Rosa26 targeting vector.”
§ Targeted degradation of CTCF decouples local insulation of chromosome domains from genomic compartmentalization > Method Details > Gene targeting
Strength:plain· not yet calibratedCausal:correlational· not yet calibratedTests✓ Asserted: passes✓ Checkable: passes✗ Load-bearing: fails✓ Based: passesProbably not a substantial claim. The paper’s conclusions may not depend on it.
In the paper
“These changes enable proceeding through the 3C protocol in a single tube per sample, allow handling of over 20 samples in parallel, reduce the amount of cells needed by a factor 5 to 10 and cut down the time needed to complete the protocol from 8 days (Nora et al. 2012) to 4 days.”
§ Targeted degradation of CTCF decouples local insulation of chromosome domains from genomic compartmentalization > Method Details > Chromosome Conformation Capture Carbon-Copy (5C)
What the sources say
- Not checked yetcites Nora et al. 2012 source
Strength:plain· not yet calibratedCausal:direct· not yet calibratedTests✓ Asserted: passes✓ Checkable: passes✗ Load-bearing: fails✓ Based: passesProbably not a substantial claim. The paper’s conclusions may not depend on it. It may state two separate claims as one.
A result the paper reports from its own data — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“We noticed the dual nickase underperformed for Rosa26 and recommend using a single nuclease strategy approach with the first sgRNA only.”
§ Targeted degradation of CTCF decouples local insulation of chromosome domains from genomic compartmentalization > Method Details > Plasmid Construction
Strength:plain· not yet calibratedTests✓ Asserted: passes✓ Checkable: passes✗ Load-bearing: fails✓ Based: passesProbably not a substantial claim. The paper’s conclusions may not depend on it.
A conclusion the paper draws from its own results — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“The emerging model is that Cohesin packages the chromatin fiber while CTCF defines focal boundaries by constrains this packaging activity.”
§ Targeted degradation of CTCF decouples local insulation of chromosome domains from genomic compartmentalization > Discussion > TAD Insulation and Transcriptional Regulation
Tests✓ Asserted: passes✓ Checkable: passes✓ Load-bearing: passes✓ Based: passesIt may state two separate claims as one.
A conclusion the paper draws from its own results — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“While this is compatible with compartment transition or transcription participating in the maintenance of CTCF-independent insulation, either of these features alone is not sufficient to drive CTCF-independent insulation since most boundaries associated with them are affected by CTCF depletion (Supplementary Table 6).”
§ Targeted degradation of CTCF decouples local insulation of chromosome domains from genomic compartmentalization > Results > Disruption of Local Insulation Does Not Affect Higher-Order Chromosome Folding
Load-bearingStrength:plain· not yet calibratedTests✓ Asserted: passes✓ Checkable: passes✓ Load-bearing: passes✓ Based: passesIt may state two separate claims as one.
A conclusion the paper draws from its own results — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“Notably, the extrusion model accurately describes mammalian chromosome folding at the sub-megabase scale but does not account for the segregation of genomic compartments, and the direct molecular drivers of CTCF-independent higher-order compartmentalization remain to be defined.”
§ Targeted degradation of CTCF decouples local insulation of chromosome domains from genomic compartmentalization > Discussion > Local Insulation and A/B Compartmentalization Are Molecularly Separable Principles of Mammalian Genome Folding
Load-bearingStrength:plain· not yet calibratedTests✓ Asserted: passes✓ Checkable: passes✓ Load-bearing: passes✓ Based: passesIt may state two separate claims as one.
In the paper
“This would explain why depleting CTCF does not affect how the frequency of chromosomal contacts scales overall with genomic distance, as opposed to altering factors that control Cohesin turnover on chromatin, such as Nipbl (Schwarzer et al., 2016).”
§ Targeted degradation of CTCF decouples local insulation of chromosome domains from genomic compartmentalization > Discussion > TAD Insulation and Transcriptional Regulation
What the sources say
- Not checked yetcites Schwarzer et al., 2016
Load-bearingStrength:hedged· not yet calibratedTests✓ Asserted: passes✓ Checkable: passes✓ Load-bearing: passes✓ Based: passesIt may state two separate claims as one.
A conclusion the paper draws from its own results — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“These changes are likely indirect effects as they are not restricted to the vicinity of CTCF sites, and may be accounted for by 2-fold transcriptional down-regulation of the essential PRC2 component EED (Supplementary Table 3).”
§ Targeted degradation of CTCF decouples local insulation of chromosome domains from genomic compartmentalization > Results > CTCF Binding Is Not a Direct Impediment to H3K27me3 Spreading in mESCs
Strength:hedged· not yet calibratedCausal:conditional· not yet calibratedTests✓ Asserted: passes✓ Checkable: passes? Load-bearing: unclear✓ Based: passesIt may state two separate claims as one.
What the paper did — it cites no source for this, so there is none to check. The quote shows it is in the paper.
In the paper
“The relative efficiency of Hi-C ligation product formation and biotin fill-in was defined as the proportion of ligation product digested with NheI and varied from 50 to 80% in different Hi-C libraries.”
§ Targeted degradation of CTCF decouples local insulation of chromosome domains from genomic compartmentalization > Method Details > Hi-C
Strength:plain· not yet calibratedTests✓ Asserted: passes✓ Checkable: passes✗ Load-bearing: fails✓ Based: passesProbably not a substantial claim. The paper’s conclusions may not depend on it.
What the paper did — it cites no source for this, so there is none to check. The quote shows it is in the paper.
In the paper
“this analysis suggested the optimal threshold of 0.3, where the specificity of loop anchor recall dropped 3-fold.”
§ Targeted degradation of CTCF decouples local insulation of chromosome domains from genomic compartmentalization > Quantification and Statistical Analysis > Hi-C analysis
Strength:hedged· not yet calibratedCausal:correlational· not yet calibratedTests✓ Asserted: passes✓ Checkable: passes✗ Load-bearing: fails✓ Based: passesProbably not a substantial claim. The paper’s conclusions may not depend on it.
What the paper did — it cites no source for this, so there is none to check. The quote shows it is in the paper.
In the paper
“It indicated that the majority of the ligation products have been digested by NheI and validated that the libraries were mainly constituted of true ligation products.”
§ Targeted degradation of CTCF decouples local insulation of chromosome domains from genomic compartmentalization > Method Details > Hi-C
Strength:hedged· not yet calibratedTests✓ Asserted: passes✓ Checkable: passes✗ Load-bearing: fails✓ Based: passesProbably not a substantial claim. The paper’s conclusions may not depend on it. It may state two separate claims as one.
What the paper did — it cites no source for this, so there is none to check. The quote shows it is in the paper.
In the paper
“Over 95% of cells had one knock-in allele, of which 20% were homozygous.”
§ Targeted degradation of CTCF decouples local insulation of chromosome domains from genomic compartmentalization > Method Details > Gene targeting
Strength:plain· not yet calibratedTests✓ Asserted: passes✓ Checkable: passes✗ Load-bearing: fails✓ Based: passesProbably not a substantial claim. The paper’s conclusions may not depend on it. It may state two separate claims as one.
What the paper did — it cites no source for this, so there is none to check. The quote shows it is in the paper.
In the paper
“Rosa26 PCR genotyping revealed this clone had undergone random insertion of the Tir1 cassette.”
§ Targeted degradation of CTCF decouples local insulation of chromosome domains from genomic compartmentalization > Method Details > Gene targeting
Strength:plain· not yet calibratedSingle caseTests✓ Asserted: passes✓ Checkable: passes✗ Load-bearing: fails✓ Based: passesProbably not a substantial claim. The paper’s conclusions may not depend on it.
What the paper did — it cites no source for this, so there is none to check. The quote shows it is in the paper.
In the paper
“The clone analyzed here was homozygous for the integration and the puro cassette was still present in the final cell line.”
§ Targeted degradation of CTCF decouples local insulation of chromosome domains from genomic compartmentalization > Method Details > Plasmid Construction
Strength:plain· not yet calibratedSingle caseTests✓ Asserted: passes✓ Checkable: passes✗ Load-bearing: fails✓ Based: passesProbably not a substantial claim. The paper’s conclusions may not depend on it. It may state two separate claims as one.
What the paper did — it cites no source for this, so there is none to check. The quote shows it is in the paper.
In the paper
“Dissociation, wahs and Flow buffers were supplemented with auxin, when appropriate, to avoid re-expression of the CTCF-AID-eGFP fusion.”
§ Targeted degradation of CTCF decouples local insulation of chromosome domains from genomic compartmentalization > Method Details > Flow Cytometry
Strength:hedged· not yet calibratedCausal:direct· not yet calibratedTests✓ Asserted: passes✓ Checkable: passes✗ Load-bearing: fails✓ Based: passesProbably not a substantial claim. The paper’s conclusions may not depend on it.
What the paper did — it cites no source for this, so there is none to check. The quote shows it is in the paper.
In the paper
“Negative controls (no ligase, no template, no 5C oligonucleotide) were included during each experiments to ensure the absence of contamination.”
§ Targeted degradation of CTCF decouples local insulation of chromosome domains from genomic compartmentalization > Method Details > Chromosome Conformation Capture Carbon-Copy (5C)
Strength:plain· not yet calibratedTests✓ Asserted: passes✓ Checkable: passes✗ Load-bearing: fails✓ Based: passesProbably not a substantial claim. The paper’s conclusions may not depend on it.
In the paper
“For peak calling we followed the guidelines described in (Thomas et al., 2016).”
§ Targeted degradation of CTCF decouples local insulation of chromosome domains from genomic compartmentalization > Quantification and Statistical Analysis > ChIP-seq Analysis
What the sources say
- Not checked yetcites Thomas et al., 2016 source
Strength:plain· not yet calibratedTests✓ Asserted: passes✓ Checkable: passes✗ Load-bearing: fails✓ Based: passesProbably not a substantial claim. The paper’s conclusions may not depend on it.
What the paper did — it cites no source for this, so there is none to check. The quote shows it is in the paper.
In the paper
“The CTCF-AID NPC subclones did not survive freeze and thawing.”
§ Targeted degradation of CTCF decouples local insulation of chromosome domains from genomic compartmentalization > Experimental Model and Subject Details > Neural progenitor cells and astrocytes
Strength:plain· not yet calibratedTests✓ Asserted: passes✓ Checkable: passes✗ Load-bearing: fails✓ Based: passesProbably not a substantial claim. The paper’s conclusions may not depend on it.
None of the sources cited for this claim have been checked yet.
In the paper
“We used the smallest functional truncation of the AID tag (AID*, 44 amino-acids), initially developed in yeast (Morawska and Ulrich, 2013), shorter than the mini-AID (67 amino-acids (Kubota et al., 2013)).”
§ Targeted degradation of CTCF decouples local insulation of chromosome domains from genomic compartmentalization > Method Details > Plasmid Construction
What the sources say
- Not checked yetcites Morawska and Ulrich, 2013
- Not checked yetcites Kubota et al., 2013 source
Strength:plain· not yet calibratedTests✓ Asserted: passes✓ Checkable: passes✗ Load-bearing: fails✓ Based: passesProbably not a substantial claim. The paper’s conclusions may not depend on it. It may state two separate claims as one.
What the paper did — it cites no source for this, so there is none to check. The quote shows it is in the paper.
In the paper
“Half of the clones were found to have undergone FlpO-mediated recombination. When homozygous both alleles always underwent recombination.”
§ Targeted degradation of CTCF decouples local insulation of chromosome domains from genomic compartmentalization > Method Details > Gene targeting
Strength:plain· not yet calibratedCausal:correlational· not yet calibratedTests✓ Asserted: passes✓ Checkable: passes✗ Load-bearing: fails✓ Based: passesProbably not a substantial claim. The paper’s conclusions may not depend on it. It may state two separate claims as one.
What the paper did — it cites no source for this, so there is none to check. The quote shows it is in the paper.
In the paper
“The consensus peak list was obtained by retaining peaks that overlapped for at least 1bp between biological replicates.”
§ Targeted degradation of CTCF decouples local insulation of chromosome domains from genomic compartmentalization > Quantification and Statistical Analysis > ChIP-seq Analysis
Strength:plain· not yet calibratedTests✓ Asserted: passes✓ Checkable: passes✗ Load-bearing: fails✓ Based: passesProbably not a substantial claim. The paper’s conclusions may not depend on it.
What the paper did — it cites no source for this, so there is none to check. The quote shows it is in the paper.
In the paper
“FPKM provided in Supplementary Table 3 are means from 3 independent biological replicates.”
§ Targeted degradation of CTCF decouples local insulation of chromosome domains from genomic compartmentalization > Quantification and Statistical Analysis > RNA-seq Analysis
Strength:plain· not yet calibratedTests✓ Asserted: passes✓ Checkable: passes✗ Load-bearing: fails✓ Based: passesProbably not a substantial claim. The paper’s conclusions may not depend on it.
What the paper did — it cites no source for this, so there is none to check. The quote shows it is in the paper.
In the paper
“We selected the clone with the fewest GFP-positive cells (<1%) after 24h of auxin treatment.”
§ Targeted degradation of CTCF decouples local insulation of chromosome domains from genomic compartmentalization > Method Details > Gene targeting
Tests✓ Asserted: passes✓ Checkable: passes✓ Load-bearing: passes✓ Based: passesProbably not a substantial claim.
Claims other papers make about this one
Each is checked against this paper’s own text: does it say what the citing paper says it does?
The source backs part of the claim, not all of it — or backs it for a different population, condition or comparison.
In the citing paper
“Depleting RAD21 or CCCTC-binding factor (CTCF) also down-regulated Car2 (fig. S12C) (7, 30)”
From Synergy between regulatory elements can render cohesin dispensable for distal enhancer function (2026) · cites this paper as [30]
Experimental — accuracy not yet measuredThe source backs part of the claim, not all of it — or backs it for a different population, condition or comparison.
In the citing paper
“Finally, the temporary disruption of 3D loops on a genome-wide scale through cohesin depletion was found to have minimal lasting effect on gene expression155,156.”
From Towards a comprehensive catalogue of validated and target-linked human enhancers (2020) · cites this paper as [156]
Experimental — accuracy not yet measuredThe source backs part of the claim, not all of it — or backs it for a different population, condition or comparison.
In the citing paper
“Surprisingly however, deletion or degradation of cohesin or CTCF in differentiated cells has only mild effects on gene expression [344–349].”
From Transcriptional enhancers and their communication with gene promoters (2021) · cites this paper as [346]
Experimental — accuracy not yet measuredThe source backs part of the claim, not all of it — or backs it for a different population, condition or comparison.
In the citing paper
“The A/B compartment structure does not disappear (and is in fact even strengthened) upon cohesin/CTCF depletion [344, 346–348], but, like TADs, dissolves in mitosis [459].”
From Transcriptional enhancers and their communication with gene promoters (2021) · cites this paper as [346]
Experimental — accuracy not yet measuredThe source backs part of the claim, not all of it — or backs it for a different population, condition or comparison.
In the citing paper
“rapid depletion of cohesin or CTCF quickly abolishes TADs but, as mentioned above, has only relatively mild effects on gene expression [301, 345–347, 448].”
From Transcriptional enhancers and their communication with gene promoters (2021) · cites this paper as [346]
Experimental — accuracy not yet measured
The cited source says what the claim attributes to it.
In the citing paper
“Convergent binding sites for the versatile transcription factor CTCF (CCCTC-binding factor) located at TAD borders [46] block the movement of loop extruders [47,48,49].”
From Enhancer Function in the 3D Genome (2023) · cites this paper as [47]
In the citing paper
“Our data is consistent with a previous report that genome compartmentalization is preserved after depletion of cohesin (Seitan et al., 2013) or CTCF (Nora et al., 2017).”
From Cohesin Loss Eliminates All Loop Domains (2017) · cites this paper as Nora et al., 2017
In the citing paper
“Our data for cohesin depletion is consistent with is study.”
From Cohesin Loss Eliminates All Loop Domains (2017) · cites this paper as Nora et al., 2017
In the citing paper
“loop extrusion mediated by cohesin and CTCF mediates the formation of chromatin loops and self-interacting Topologically Associating Domains (TADs)”
From Neuronal DNA double-strand breaks lead to genome structural variations and 3D genome disruption in neurodegeneration (2023) · cites this paper as [86]
In the citing paper
“recent evidence indicates that domains and compartment formation can be at least partially uncoupled and may result from different biological phenomena (Nora et al., 2017).”
From Multiscale 3D Genome Rewiring during Mouse Neural Development (2017) · cites this paper as Nora et al., 2017
In the citing paper
“It is known that architectural proteins such as CTCF and cohesin play a role (Haarhuis et al., 2017, Nora et al., 2017, Phillips-Cremins et al., 2013)”
From Multiscale 3D Genome Rewiring during Mouse Neural Development (2017) · cites this paper as Nora et al., 2017
In the citing paper
“complementary polymer simulation studies and Hi-C studies employing acute depletion of CTCF and cohesin, which also support such a dynamic model.”
From Recent evidence that TADs and chromatin loops are dynamic structures (2018) · cites this paper as [10]
In the citing paper
“Finally, ∼18% of TAD boundaries appear to be partially resistant to CTCF loss,10 suggesting that additional boundary factors, such as active promoters4 since engaged RNA Pol II can block cohesin extrusion46 as well as alternative architectural factors, may also play a role.”
From Recent evidence that TADs and chromatin loops are dynamic structures (2018) · cites this paper as [10]
In the citing paper
“Likewise, CTCF loss has only a small effect on epigenomic compartments,10 whereas cohesin loss increases the degree of epigenomic compartmentalization ∼2-fold.11,13”
From Recent evidence that TADs and chromatin loops are dynamic structures (2018) · cites this paper as [10]
In the citing paper
“In conclusion, recent studies10–15 employing induced CTCF and cohesin degradation now strongly support a model where cohesin forms TADs and CTCF establishes TAD boundaries.”
From Recent evidence that TADs and chromatin loops are dynamic structures (2018) · cites this paper as [10]
In the citing paper
“Consistent with their different roles, CTCF loss has essentially no effect on genome-averaged contact probability at any distance scale,10 whereas cohesin loss significantly reduces contact probability at the scale of tens to hundreds of kilobases,11”
From Recent evidence that TADs and chromatin loops are dynamic structures (2018) · cites this paper as [10]
In the citing paper
“In accordance with the extrusion model, TADs and well-defined Hi-C loops largely disappear when either CTCF10,14 or cohesin11,13–15 is strongly depleted, but for different reasons.”
From Recent evidence that TADs and chromatin loops are dynamic structures (2018) · cites this paper as [10]
In the citing paper
“In summary, CTCF and cohesin are required for chromatin looping,10–15 form a biochemically stable protein-complex and both bind chromatin at loop anchors.”
From Recent evidence that TADs and chromatin loops are dynamic structures (2018) · cites this paper as [10]
In the citing paper
“Thus, chromatin is still compacted and extruded by cohesin, but without sharp boundaries, TADs disappear in Hi-C maps.10,14”
From Recent evidence that TADs and chromatin loops are dynamic structures (2018) · cites this paper as [10]
In the citing paper
“Since multiple studies show that TADs and chromatin loops disappear without CTCF10,14 and cohesin,11,13–15 we reasoned that the most stable protein of CTCF and cohesin should set an upper limit on the stability of TADs and chromatin loops.”
From Recent evidence that TADs and chromatin loops are dynamic structures (2018) · cites this paper as [10]
In the citing paper
“although CTCF and cohesin both appear absolutely required for the formation of most TADs10-15”
From Recent evidence that TADs and chromatin loops are dynamic structures (2018) · cites this paper as [10]
In the citing paper
“Notably, a key advantage of dynamic loop extrusion models is that they can explain recent perturbation experiments where CTCF binding sites have been added or deleted9,49-51 and also explain the loss of either CTCF or cohesin.10-15”
From Recent evidence that TADs and chromatin loops are dynamic structures (2018) · cites this paper as [10]
In the citing paper
“(∼18% of TAD boundaries were not sensitive to CTCF loss10 and could have different dynamics)”
From Recent evidence that TADs and chromatin loops are dynamic structures (2018) · cites this paper as [10]
Self-check
Percentages, sums and reported differences re-computed from the paper’s own numbers.
Each contradiction between two passages listed here was confirmed by an independent check.
RecJf digestion step specifies lambda exonuclease
MinorThe step is described as RecJf exonuclease digestion and uses RecJf buffer, but the enzyme specified for that step is lambda exonuclease.
“RecJf exonuclease digestion was performed by resuspending the beads in 100μL 1× RecJf exonuclease buffer”
“supplemented with 30U lambda exonuclease (NEB) and incubating at 37°C for 30min.”
CTCF tag placement differs between Results and Methods
MinorThe Results say the AID-eGFP tag was introduced at the Ctcf stop codon, but the gene-targeting Methods say it was knocked in at the N-terminus of CTCF.
“we targeted the stop codon of both Ctcf alleles to introduce a 44–amino acid version of the AID tag”
“To knock in the AID-eGFP cassette at the N-terinus of CTCF E14Tg2a passage 19 were transfected by microporation”
Different Tir1 targeting vectors specified for cell line #1
MinorThe plasmid-construction Methods identify pEN113 as the Tir1 vector for cell line #1, whereas the gene-targeting Methods say pEN114 was used to introduce Tir1 into the line subsequently identified as #1.
“The Tir1 expression vector (pEN113) for the cell line analyzed by Hi-C (#1) was assembled”
“To knock in the Tir1-expressing cassette one homozygous CTCF-AID-eGFP clone was transfected as described above using a 100μL tip format and pEN114 as the targeting construct.”
Citations
Cites
NIH Image to ImageJ: 25 years of image analysis
Schneider, C. A., Rasband, W. S., & Eliceiri, K. W. (2012) · Nature Methods · doi:10.1038/nmeth.2089 · Cited by 64,638
Fast gapped-read alignment with Bowtie 2
Langmead, B., & Salzberg, S. L. (2012) · Nature Methods · doi:10.1038/nmeth.1923 · Cited by 56,400
STAR: ultrafast universal RNA-seq aligner
Dobin, A., Davis, C. A., Schlesinger, F., Drenkow, J., Zaleski, C., Jha, S., Batut, P., Chaisson, M., & Gingeras, T. R. (2013) · Bioinformatics · doi:10.1093/bioinformatics/bts635 · Cited by 51,709
BEDTools: a flexible suite of utilities for comparing genomic features
Quinlan, A. R., & Hall, I. M. (2010) · Bioinformatics · doi:10.1093/bioinformatics/btq033 · Cited by 27,437
Trapnell, C., Williams, B. A., Pertea, G., Mortazavi, A., Kwan, G., van Baren, M. J., Salzberg, S. L., Wold, B. J., & Pachter, L. (2010) · Nature Biotechnology · doi:10.1038/nbt.1621 · Cited by 15,556
Multiplex Genome Engineering Using CRISPR/Cas Systems
Cong, L., Ran, F. A., Cox, D., Lin, S., Barretto, R., Habib, N., Hsu, P. D., Wu, X., Jiang, W., Marraffini, L. A., et al. (2013) · Science · doi:10.1126/science.1231143 · Cited by 15,339
A 3D Map of the Human Genome at Kilobase Resolution Reveals Principles of Chromatin Looping
Rao, S. S. P., Huntley, M. H., Durand, N. C., Stamenova, E. K., Bochkov, I. D., Robinson, J. T., Sanborn, A. L., Machol, I., Omer, A. D., Lander, E. S., et al. (2014) · Cell · doi:10.1016/j.cell.2014.11.021 · Cited by 9,212
Comprehensive Mapping of Long-Range Interactions Reveals Folding Principles of the Human Genome
Lieberman-Aiden, E., van Berkum, N. L., Williams, L., Imakaev, M., Ragoczy, T., Telling, A., Amit, I., Lajoie, B. R., Sabo, P. J., Dorschner, M. O., et al. (2009) · Science · doi:10.1126/science.1181369 · Cited by 8,898
Self-citationTopological domains in mammalian genomes identified by analysis of chromatin interactions
Dixon, J. R., Selvaraj, S., Yue, F., Kim, A., Li, Y., Shen, Y., Hu, M., Liu, J. S., & Ren, B. (2012) · Nature · doi:10.1038/nature11082 · Cited by 6,829
FIMO: scanning for occurrences of a given motif
Grant, C. E., Bailey, T. L., & Noble, W. S. (2011) · Bioinformatics · doi:10.1093/bioinformatics/btr064 · Cited by 4,247
Flagged first, then by citations
Cited by
Sorted by citations
Items 301–400 of 1,001
CTCF counter-regulates cardiomyocyte development and maturation programs in the embryonic heart
Gómez-Velázquez, M., Badía-Careaga, C., Lechuga‐Vieco, A. V., Nieto-Arellano, R., Tena, J. J., Rollán, I., Álvarez, A., Torroja, C., Caceres, E., Roy, A. R., et al. (2017) · PLoS Genetics · doi:10.1371/journal.pgen.1006985 · Cited by 75
A super-sensitive auxin-inducible degron system with an engineered auxin-TIR1 pair
Nishimura, K., Yamada, R., Hagihara, S., Iwasaki, R., Uchida, N., Kamura, T., Takahashi, K. U., Torii, K. U., & Fukagawa, T. (2020) · Nucleic Acids Research · doi:10.1093/nar/gkaa748 · Cited by 66
High-resolution structural genomics reveals new therapeutic vulnerabilities in glioblastomaPreprint
Johnston, M. J. G., Nikolić, A., Ninkovic, N., Guilhamon, P., Cavalli, F. M. G., Seaman, S., Zemp, F. J., Lee, J., Abdelkareem, A. O., Ellestad, K. I., et al. (2019) · Genome Research · doi:10.1101/gr.246520.118 · Cited by 68
“maintenance of domains, but it has no effect on the organization of compartments (Nora et al., 2017).”
BackgroundMammalian DNA Replication TimingPreprint
Vouzas, A. E., & Gilbert, D. M. (2021) · Cold Spring Harbor Perspectives in Biology · doi:10.1101/cshperspect.a040162 · Cited by 71
Zhou, Q., Yu, M., Tirado-Magallanes, R., Li, B., Kong, L., Guo, M., Tan, Z. H., Lee, S., Chai, L., Numata, A., et al. (2021) · Nature Communications · doi:10.1038/s41467-020-20282-1 · Cited by 79
Epigenetic control of transcriptional regulation in pluripotency and early differentiation
Gökbuget, D., & Blelloch, R. H. (2019) · Development · doi:10.1242/dev.164772 · Cited by 73
Order and disorder: abnormal 3D chromatin organization in human disease
Anania, C., & Lupiáñez, D. G. (2019) · Briefings in Functional Genomics · doi:10.1093/bfgp/elz028 · Cited by 74
“However, as exposed previously, the utilization of protein degradation systems provided a novel approach to overcome this important issue [34, 35].”
BackgroundFranke, M., de la Calle‐Mustienes, E., Neto, A., Almuedo‐Castillo, M., Irastorza-Azcárate, I., Acemel, R. D., Tena, J. J., Santos-Pereira, J. M., & Gómez-Skármeta, J. L. (2021) · Nature Communications · doi:10.1038/s41467-021-25604-5 · Cited by 71
Epigenomes in Cardiovascular Disease
Rosa‐Garrido, M., Chapski, D. J., & Vondriska, T. M. (2018) · Circulation Research · doi:10.1161/circresaha.118.311597 · Cited by 73
“…of chromatin structural proteins like CTCF. Cohesin and CTCF knockout animals and cells indicate these proteins are involved in TAD maintenance, 191,198,199 but these proteins alone are not the whole story: embryonic stem cells 198 with only 4% normal CTCF protein levels still exhibited TADs and…”
Chromatin Architecture in the Fly: Living without CTCF/Cohesin Loop Extrusion?
Matthews, N. E., & White, R. A. (2019) · BioEssays · doi:10.1002/bies.201900048 · Cited by 67
Visualizing transcription: key to understanding gene expression dynamics
Brouwer, I., & Lenstra, T. L. (2019) · Current Opinion in Chemical Biology · doi:10.1016/j.cbpa.2019.05.031 · Cited by 73
Tracing DNA paths and RNA profiles in cultured cells and tissues with ORCA
Mateo, L. J., Sinnott-Armstrong, N., & Boettiger, A. N. (2021) · Nature Protocols · doi:10.1038/s41596-020-00478-x · Cited by 65
Zuo, W., Chen, G., Gao, Z., Li, S., Chen, Y., Huang, C., Chen, J., Chen, Z., Lei, M., & Bian, Q. (2021) · Nature Communications · doi:10.1038/s41467-021-26033-0 · Cited by 63
Chromatin remodeling complexes regulate genome architecture in Arabidopsis
Yang, T., Wang, D., Tian, G., Sun, L., Yang, M., Yin, X., Xiao, J. Y., Sheng, Y., Zhu, D., He, H., et al. (2022) · The Plant Cell · doi:10.1093/plcell/koac117 · Cited by 71
Chromatin jets define the properties of cohesin-driven in vivo loop extrusion.
Guo, Y., Al-Jibury, E., Garcia-Millan, R., Ntagiantas, K., King, J. W. D., Nash, A. J., Galjart, N., Lenhard, B., Rueckert, D., Fisher, A., et al. (2022) · Molecules and Cells · doi:10.1016/j.molcel.2022.09.003 · Cited by 69
TADs: Dynamic structures to create stable regulatory functions
da Costa-Nunes, J. A., & Noordermeer, D. (2023) · Current Opinion in Structural Biology · doi:10.1016/j.sbi.2023.102622 · Cited by 83
How the Genome Folds: The Biophysics of Four-Dimensional Chromatin Organization
Parmar, J. J., Woringer, M., & Zimmer, C. (2019) · Annual Review of Biophysics · doi:10.1146/annurev-biophys-052118-115638 · Cited by 74
“On the other hand, both cohesin and CTCF depletion only show minor effects on gene expression over a 6 hour window, suggesting that on a population scale, transcription is already potentiated and proceeds as before, even in the absence of TAD delimitation (83, 97).”
BackgroundLong-range Pitx2c enhancer–promoter interactions prevent predisposition to atrial fibrillation
Zhang, M., Hill, M. C., Kadow, Z. A., Suh, J. H., Tucker, N. R., Hall, A. W., Tran, T. T., Swinton, P. S., Leach, J. P., Margulies, K. B., et al. (2019) · Proceedings of the National Academy of Sciences · doi:10.1073/pnas.1907418116 · Cited by 72
“Pitx2 Enhancer–Promoter Interactions Are Mediated by CTCF. TAD boundaries are commonly CTCF-rich (37, 38).”
Matthews, B. J., & Waxman, D. J. (2018) · eLife · doi:10.7554/elife.34077 · Cited by 66
The anti-cancer drugs curaxins target spatial genome organization
Kantidze, O. L., Luzhin, A. V., Nizovtseva, E. V., Safina, A. F., Valieva, M. E., Golov, A. K., Velichko, A. K., Lyubitelev, A. V., Feofanov, A. V., Gurova, K. V., et al. (2019) · Nature Communications · doi:10.1038/s41467-019-09500-7 · Cited by 73
Mechanisms of Enhancer-Promoter Interactions in Higher Eukaryotes
Georgiev, P. G., & Kyrchanova, O. (2021) · International Journal of Molecular Sciences · doi:10.3390/ijms22020671 · Cited by 72
“TADs are architectural chromatin units that define regulatory landscapes, and genes tend to be coregulated during cell differentiation when they are located within the same TAD [59–61].”
BackgroundInfluentialWhole-genome doubling drives oncogenic loss of chromatin segregation
Lambuta, R. A., Nanni, L., Liu, Y., Díaz-Miyar, J., Iyer, A., Tavernari, D., Katanayeva, N., Ciriello, G., & Oricchio, E. (2023) · Nature · doi:10.1038/s41586-023-05794-2 · Cited by 74
Lamina-Dependent Stretching and Unconventional Chromosome Compartments in Early C. elegans Embryos
Sawh, A. N., Shafer, M. E. R., Su, J.-H., Zhuang, X., Wang, S., & Mango, S. E. (2020) · Molecular Cell · doi:10.1016/j.molcel.2020.02.006 · Cited by 65
“Cohesin and CCCTCbinding factor (CTCF) promote looping to form TADs but suppress some compartments (Nora et al., 2017; Nuebler et al., 2018; Schwarzer et al., 2017).”
BackgroundChen, L.-F., Long, H. K., Park, M., Swigut, T., Boettiger, A. N., & Wysocka, J. (2023) · Molecular Cell · doi:10.1016/j.molcel.2023.03.009 · Cited by 66
Transcription factors: building hubs in the 3D space
Giammartino, D. C. D., Polyzos, A., & Apostolou, E. (2020) · Cell Cycle · doi:10.1080/15384101.2020.1805238 · Cited by 67
Gu, B., Comerci, C. J., McCarthy, D. G., Saurabh, S., Moerner, W. E., & Wysocka, J. (2020) · Molecular Cell · doi:10.1016/j.molcel.2020.10.001 · Cited by 66
“Genetic studies have demonstrated that, at the population-level, acutely perturbing CTCF and/or the cohesin complex affects loop and TAD structures (Haarhuis et al., 2017; Nora et al., 2017; Rao et al., 2017; Wutz et al., 2017).”
BackgroundCTCF is a barrier for 2C-like reprogramming
Olbrich, T., Vega-Sendino, M., Tillo, D., Wu, W., Zolnerowich, N., Pavani, R., Tran, A. D., Domingo, C. N., Franco, M., Markiewicz-Potoczny, M., et al. (2021) · Nature Communications · doi:10.1038/s41467-021-25072-x · Cited by 63
Self-citationBRD2 compartmentalizes the accessible genome
Xie, L., Dong, P., Qi, Y., Hsieh, T.-H. S., English, B. P., Jung, S., Chen, X., Marzio, M. D., Casellas, R. C., Chang, H. Y., et al. (2022) · Nature Genetics · doi:10.1038/s41588-022-01044-9 · Cited by 66
“pAG-Tn5 was ordered from EpiCypher (15-1017).”
A walk through the SMC cycle: From catching DNAs to shaping the genome
Oldenkamp, R., & Rowland, B. D. (2022) · Molecular Cell · doi:10.1016/j.molcel.2022.04.006 · Cited by 68
Zagelbaum, J., Schooley, A., Zhao, J., Schrank, B. R., Callén, E., Zha, S., Gottesman, M. E., Nussenzweig, A., Rabadán, R., Dekker, J., et al. (2022) · Nature Structural & Molecular Biology · doi:10.1038/s41594-022-00893-6 · Cited by 74
Self-citationSignaling by Steroid Hormones in the 3D Nuclear Space
Dily, F. L., & Beato, M. (2018) · International Journal of Molecular Sciences · doi:10.3390/ijms19020306 · Cited by 76
Three-dimensional chromatin in disease: What holds us together and what drives us apart?
Ibrahim, D. M., & Mundlos, S. (2020) · Current Opinion in Cell Biology · doi:10.1016/j.ceb.2020.01.003 · Cited by 70
CTCF as a regulator of alternative splicing: new tricks for an old player
Alharbi, A. B., Schmitz, U., Bailey, C. G., & Rasko, J. E. J. (2021) · Nucleic Acids Research · doi:10.1093/nar/gkab520 · Cited by 68
The interdependence of gene-regulatory elements and the 3D genome
Vermunt, M. W., Zhang, D., & Blobel, G. A. (2018) · The Journal of Cell Biology · doi:10.1083/jcb.201809040 · Cited by 72
Nonlinear control of transcription through enhancer-promoter interactions
Zuin, J., Roth, G., Zhan, Y., Cramard, J., Redolfi, J., Piskadlo, E., Mach, P., Kryzhanovska, M., Tihanyi, G., Kohler, H., et al. (2021) · doi:10.1101/2021.04.22.440891 · Cited by 67
See, Y. X., Chen, K., & Fullwood, M. J. (2022) · Genome Research · doi:10.1101/gr.276313.121 · Cited by 64
Froberg, J. E., Pinter, S. F., Kriz, A. J., Jégu, T., & Lee, J. T. (2018) · Nature Communications · doi:10.1038/s41467-018-07446-w · Cited by 68
Single-cell profiling of transcriptome and histone modifications with EpiDamID
Rang, F. J., de Luca, K. L., de Vries, S. S., Valdes‐Quezada, C., Boele, E., Nguyen, P. D., Guerreiro, I. M., Sato, Y., Kimurâ, H., Bakkers, J., et al. (2022) · Molecular Cell · doi:10.1016/j.molcel.2022.03.009 · Cited by 63
Galupa, R., Nora, E. P., Worsley-Hunt, R., Picard, C., Gard, C., van Bemmel, J. G., Servant, N., Zhan, Y., Marjou, F. E., Johanneau, C., et al. (2019) · Molecular Cell · doi:10.1016/j.molcel.2019.10.030 · Cited by 71
“To explore a possible role for these sites in mediating the regulation of Xist by LinxP/LinxE, we deleted a large intronic interval containing the CTCF sites in male ESCs (DLinx-int1, 51 kb) and mice (DLinx-CBS, 25 kb) (Figure 4A).”
BackgroundMethodInfluentialSelf-citationEstablishment and evolution of heterochromatin
Liu, J., Ali, M., & Zhou, Q. (2020) · Annals of the New York Academy of Sciences · doi:10.1111/nyas.14303 · Cited by 74
Defining the relative and combined contribution of CTCF and CTCFL to genomic regulation
Nishana, M., Ha, C. J., Rodriguez-Hernaez, J., Ranjbaran, A., Chio, E., Nora, E. P., Badri, S., Kloetgen, A., Bruneau, B. G., Tsirigos, A., et al. (2020) · Genome biology · doi:10.1186/s13059-020-02024-0 · Cited by 62
“Further details of the vector are described elsewhere [7].”
BackgroundMethodResultInfluentialSelf-citationThree-dimensional folding dynamics of the Xenopus tropicalis genome
Niu, L., Shen, W., Shi, Z., Tan, Y., He, N., Wan, J., Sun, J., Zhang, Y., Huang, Y., Wang, W., et al. (2021) · Nature Genetics · doi:10.1038/s41588-021-00878-z · Cited by 63
Cohesin: behind dynamic genome topology and gene expression reprogramming
Perea-Resa, C., Wattendorf, L., Marzouk, S., & Blower, M. D. (2021) · Trends in Cell Biology · doi:10.1016/j.tcb.2021.03.005 · Cited by 63
Vos, E. S. M., Valdes‐Quezada, C., Huang, Y., Allahyar, A., Verstegen, M. J. A. M., Felder, A.-K., van der Vegt, F., Uijttewaal, E. C. H., Krijger, P. H. L., & de Laat, W. L. (2021) · Molecular Cell · doi:10.1016/j.molcel.2021.06.008 · Cited by 61
Chang, L., Ghosh, S., Papale, A., Luppino, J. M., Miranda, M., Piras, V., Degrouard, J., Edouard, J., Poncelet, M., Lecouvreur, N., et al. (2023) · Nature Communications · doi:10.1038/s41467-023-41265-y · Cited by 63
“The CTCF-AID line was a gift from Elphège P. Nora (UCSF, San Francisco, USA), Benoit Bruneau (Gladstone Institutes, San Francisco, USA) and Maxim Greenberg (Institut Jacques Monod, Paris, France) (Nora et al, 2017).”
MethodKumar, S., Kaur, S., Seem, K., Kumar, S., & Mohapatra, T. (2021) · Frontiers in Cell and Developmental Biology · doi:10.3389/fcell.2021.774719 · Cited by 70
Essential role of Cp190 in physical and regulatory boundary formation
Kaushal, A., Dorier, J., Wang, B., Mohana, G., Taschner, M., Cousin, P., Waridel, P., Iseli, C., Semenova, A., Restrepo, S., et al. (2022) · Science Advances · doi:10.1126/sciadv.abl8834 · Cited by 64
CTCF organizes inter-A compartment interactions through RYBP-dependent phase separation
Wei, C., Jia, L., Huang, X., Tan, J., Wang, M., Niu, J., Hou, Y., Sun, J.-Y., Zeng, P., Wang, J., et al. (2022) · Cell Research · doi:10.1038/s41422-022-00676-0 · Cited by 55
“Therefore, we speculated that RYBP facilitates the phase separation of CTCF.”
BackgroundMethodInfluentialThe 10-nm chromatin fiber and its relationship to interphase chromosome organization
Hansen, J. C., Connolly, M., McDonald, C. J., Pan, A., Pryamkova, A., Ray, K. P., Seidel, E., Tamura, S., Rogge, R. A., & Maeshima, K. (2017) · Biochemical Society Transactions · doi:10.1042/bst20170101 · Cited by 66
Disruption of nuclear speckles reduces chromatin interactions in active compartments
Hu, S., Lv, P., Yan, Z., & Wen, B. (2019) · Epigenetics & Chromatin · doi:10.1186/s13072-019-0289-2 · Cited by 60
LDB1 establishes multi-enhancer networks to regulate gene expression
Aboreden, N. G., Lam, J. C., Goel, V. Y., Wang, S., Wang, X., Midla, S. C., Quijano, A., Keller, C. A., Giardine, B. M., Hardison, R. C., et al. (2025) · Molecular Cell · doi:10.1016/j.molcel.2024.11.037 · Cited by 61
Spatial Organization of Chromatin: Emergence of Chromatin Structure During Development
Ghosh, R. P., & Meyer, B. J. (2021) · Annual Review of Cell and Developmental Biology · doi:10.1146/annurev-cellbio-032321-035734 · Cited by 60
An integrated view of the structure and function of the human 4D nucleome
Dekker, J., Oksuz, B. A., Zhang, Y., Wang, Y., Minsk, M. K., Kuang, S., Yang, L., Gibcus, J. H., Krietenstein, N., Rando, O. J., et al. (2025) · Nature · doi:10.1038/s41586-025-09890-3 · Cited by 64
“Saddle plots were generated as follows 49 : the interaction matrix of an experiment was sorted based on the eigenvector values from lowest to highest (B to A).”
Self-citationPredicting CTCF-mediated chromatin loops using CTCF-MP
Zhang, R., Wang, Y., Yang, Y., Zhang, Y., & Ma, J. (2018) · Bioinformatics · doi:10.1093/bioinformatics/bty248 · Cited by 62
“Through CTCF depletion, a recent work directly demonstrated that CTCF has critical roles in forming chromatin loops and establishing insulation between topologically associating domains (TADs) [10].”
BackgroundGambetta, M. C., & Furlong, E. E. M. (2018) · Genetics · doi:10.1534/genetics.118.301350 · Cited by 61
“Guide RNAs close to the START (ATTTGTCCATAGGAATGCCA) and STOP codons (CGAGGTCGATGGCGCTTCCC) of the CTCF open reading frame were cloned into pCFD3 vectors (Port et al. 2014).”
MethodClarkson, C. T., Deeks, E. A., Samarista, R., Mamayusupova, H., Zhurkin, V. B., & Teif, V. B. (2019) · Nucleic Acids Research · doi:10.1093/nar/gkz908 · Cited by 63
“RNA-seq data was downloaded from the GEO GSE98671 (7) and mapped with TopHat (52) to the mm9 genome.”
MethodData-Driven Polymer Model for Mechanistic Exploration of Diploid Genome Organization
Qi, Y., Reyes, A., Johnstone, S. E., Aryee, M. J., Bernstein, B., & Zhang, B. (2020) · Biophysical Journal · doi:10.1016/j.bpj.2020.09.009 · Cited by 57
Acute depletion of CTCF rewires genome-wide chromatin accessibility
Xu, B., Wang, H., Wright, S., Hyle, J. W., Zhang, Y., Shao, Y., Niu, M., Fan, Y., Rosikiewicz, W., Djekidel, M. N., et al. (2021) · Genome biology · doi:10.1186/s13059-021-02466-0 · Cited by 57
CTCF–CTCF loops and intra-TAD interactions show differential dependence on cohesin ring integrity
Liu, Y., & Dekker, J. (2022) · Nature Cell Biology · doi:10.1038/s41556-022-00992-y · Cited by 74
Self-citationRAG Chromatin Scanning During V(D)J Recombination and Chromatin Loop Extrusion are Related Processes
Lin, S. G., Ba, Z., Alt, F. W., & Zhang, Y. (2018) · Advances in immunology · doi:10.1016/bs.ai.2018.07.001 · Cited by 62
Full circle: a brief history of cohesin and the regulation of gene expression
Horsfield, J. A. (2022) · FEBS Journal · doi:10.1111/febs.16362 · Cited by 57
Lee, D. P., Tan, W. L. W., Anene-Nzelu, C. G., Lee, C. J. M., Li, P. Y., Luu, T. D. A., Chan, C. X., Tiang, Z., Ng, S. L., Huang, X., et al. (2019) · Circulation · doi:10.1161/circulationaha.118.036726 · Cited by 61
The genome-wide multi-layered architecture of chromosome pairing in early Drosophila embryos
Erceg, J., Abed, J. A., Goloborodko, A. A., Lajoie, B. R., Fudenberg, G., Abdennur, N. A., Imakaev, M., McCole, R. B., Nguyen, S. C., Saylor, W., et al. (2019) · Nature Communications · doi:10.1038/s41467-019-12211-8 · Cited by 59
Self-citationArchitectural RNA in chromatin organization
Thakur, J., & Henikoff, S. (2020) · Biochemical Society Transactions · doi:10.1042/bst20191226 · Cited by 62
Viets, K., Sauria, M. E. G., Chernoff, C., Viales, R. R., Echterling, M., Anderson, C., Tran, S., Dove, A., Goyal, R., Voortman, L., et al. (2019) · Developmental Cell · doi:10.1016/j.devcel.2019.09.007 · Cited by 59
“Studies that dissolve or rearrange TADs (Ghavi-Helm et al., 2019; Nora et al., 2017; Rao et al., 2017; Schwarzer et al., 2017) find relatively minor effects on gene expression, suggesting that TADs may play additional roles beyond the maintenance of transcriptional activity.”
BackgroundHigher-Order Chromosomal Structures Mediate Genome Function
Jerković, I., Szabo, Q., Bantignies, F., & Cavalli, G. (2019) · Journal of Molecular Biology · doi:10.1016/j.jmb.2019.10.014 · Cited by 57
Defining Functionally Relevant Spatial Chromatin Domains: It is a TAD Complicated
Sikorska, N., & Sexton, T. (2019) · Journal of Molecular Biology · doi:10.1016/j.jmb.2019.12.006 · Cited by 65
Zhu, Y., Yu, J., Gu, J., Xue, C., Zhang, L., Chen, J., & Shen, L. (2021) · Nucleic Acids Research · doi:10.1093/nar/gkab1069 · Cited by 59
“We further examined the effect of CTCF and cohesin removal on all 2C genes by reanalyzing published RNA-seq datasets of ESCs with acute protein degradation of CTCF or RAD21 (12,15).”
InfluentialBrahma safeguards canalization of cardiac mesoderm differentiation
Hota, S. K., Rao, K. S., Blair, A. P., Khalilimeybodi, A., Hu, K. M., Thomas, R., So, K., Kameswaran, V., Xu, J., Polacco, B. J., et al. (2022) · Nature · doi:10.1038/s41586-021-04336-y · Cited by 60
“The BRM-AID strain was constructed according to a previously-described strategy 36 .”
Self-citationThe multifaceted roles of cohesin in cancer
Nardo, M. D., Pallotta, M. M., & Musio, A. (2022) · Journal of Experimental & Clinical Cancer Research · doi:10.1186/s13046-022-02321-5 · Cited by 62
Enhancer-gene specificity in development and disease
Pachano, T., Haro, E., & Rada-Iglesias, Á. (2022) · Development · doi:10.1242/dev.186536 · Cited by 57
Kaiser, V., & Semple, C. (2017) · Genome Biology · doi:10.1186/s13059-018-1483-4 · Cited by 52
Engineering 3D genome organization
Wang, H., Han, M., & Qi, L. S. (2021) · Nature Reviews Genetics · doi:10.1038/s41576-020-00325-5 · Cited by 62
Regulation of 3D chromatin organization by CTCF
Xiang, J., & Corces, V. G. (2020) · Current Opinion in Genetics & Development · doi:10.1016/j.gde.2020.10.005 · Cited by 58
“Depletion of either CTCF or the cohesin subunit Rad21 eliminates CTCF loops from the genome based on Hi-C analyses [4,72].”
BackgroundChromatin Conformation in Development and Disease
Boltsis, I., Grosveld, F. G., Giraud, G., & Kolovos, P. (2021) · Frontiers in Cell and Developmental Biology · doi:10.3389/fcell.2021.723859 · Cited by 59
Molecular architecture of enhancer–promoter interaction
Hamamoto, K., & Fukaya, T. (2022) · Current Opinion in Cell Biology · doi:10.1016/j.ceb.2022.01.003 · Cited by 58
Cavalheiro, G. R., Girardot, C., Viales, R. R., Feng, S., Pollex, T., Cao, T. B. N., Lacour, P., Rabinowitz, A. H., & Furlong, E. E. M. (2023) · Science Advances · doi:10.1126/sciadv.ade1085 · Cited by 59
Cohesin facilitates zygotic genome activation in zebrafish
Meier, M., Grant, J., Dowdle, A., Thomas, A., Gerton, J. L., Collas, P., O'Sullivan, J. M., & Horsfield, J. A. (2017) · Development · doi:10.1242/dev.156521 · Cited by 60
“Compartmentalization of active and inactive regions of the genome does not depend on CTCF (Nora et al., 2017) or cohesin (Merkenschlager and Nora, 2016).”
BackgroundReorganized 3D Genome Structures Support Transcriptional Regulation in Mouse Spermatogenesis
Luo, Z., Wang, X., Jiang, H., Wang, R., Chen, J., Chen, Y., Xu, Q., Cao, J., Gong, X., Wu, J., et al. (2020) · iScience · doi:10.1016/j.isci.2020.101034 · Cited by 56
Dong, P., Tu, X., Liang, Z., Kang, B., & Zhong, S. (2020) · Journal of Experimental Botany · doi:10.1093/jxb/eraa220 · Cited by 60
Chromatin topology and the timing of enhancer function at the HoxD locus
Rodríguez-Carballo, E., Lopez‐Delisle, L., Willemin, A., Beccari, L. L., Gitto, S., Mascrez, B., & Duboule, D. (2020) · Proceedings of the National Academy of Sciences · doi:10.1073/pnas.2015083117 · Cited by 54
“The precise role(s) of these architectural proteins in gene expression has not yet been completely elucidated and genome-wide depletion either of CTCF, or of the cohesin complex, did not have a pervasive effect on gene expression levels and changes were clearly observed only at some genomic loci (Nora et al., 2017; Ra…”
BackgroundIwasaki, O., Tanizawa, H., Kim, K.-D., Kossenkov, A., Nacarelli, T., Tashiro, S., Majumdar, S., Showe, L. C., Zhang, R., & Noma, K.-I. (2019) · Nature Communications · doi:10.1038/s41467-019-13604-5 · Cited by 58
Crossed wires: 3D genome misfolding in human disease
Norton, H. K., & Phillips-Cremins, J. E. (2017) · Journal of Cell Biology · doi:10.1083/jcb.201611001 · Cited by 57
“Finally, a recent study degrading CTCF on short time scales demonstrated a genome-wide disruption of thousands of loops and hundreds of TAD boundaries genome-wide (Nora et al., 2017).”
Topologically Associating Domains and Regulatory Landscapes in Development, Evolution and Disease
Tena, J. J., & Santos-Pereira, J. M. (2021) · Frontiers in Cell and Developmental Biology · doi:10.3389/fcell.2021.702787 · Cited by 65
Bauer, M., Vidal, E., Zorita, E. V., Üresin, N., Pinter, S. F., Filion, G. J. P., & Payer, B. (2021) · Nature Communications · doi:10.1038/s41467-021-23610-1 · Cited by 54
CTCF looping is established during gastrulation in medaka embryosPreprint
Nakamura, R., Motai, Y., Kumagai, M., Wike, C. L., Nishiyama, H., Nakatani, Y., Durand, N. C., Kondo, K., Kondo, T., Tsukahara, T., et al. (2021) · Genome Research · doi:10.1101/gr.269951.120 · Cited by 56
“that the transcriptional consequences of such treatments are modest (Nora et al. 2017; Rao et al. 2017).”
BackgroundA sequence-based deep learning approach to predict CTCF-mediated chromatin loop
Lv, H., Dao, F., Zulfiqar, H., Su, W., Ding, H., Liu, L., & Lin, H. (2021) · Briefings in Bioinformatics · doi:10.1093/bib/bbab031 · Cited by 55
Soochit, W., Sleutels, F., Stik, G., Bartkuhn, M., Basu, S., Hernández, S. C., Merzouk, S., Vidal, E., Boers, R., Boers, J., et al. (2021) · Nature Cell Biology · doi:10.1038/s41556-021-00722-w · Cited by 55
The chromatin remodeling enzyme Chd4 regulates genome architecture in the mouse brain
Goodman, J. V., Yamada, T., Yang, Y., Kong, L., Wu, D. Y., Zhao, G., Gabel, H. W., & Bonni, A. (2020) · Nature Communications · doi:10.1038/s41467-020-17065-z · Cited by 57
Chromatin architecture reorganization during neuronal cell differentiation in Drosophila genomePreprint
Chathoth, K. T., & Zabet, N. R. (2019) · Genome Research · doi:10.1101/gr.246710.118 · Cited by 56
“The absence of these architectural proteins seems to disrupt TADs architecture unevenly, suggesting there are different types of borders (Zuin et al. 2014; Nora et al. 2017; Schwarzer et al. 2017).”
Taylor, T., Sikorska, N., Shchuka, V. M., Chahar, S., Ji, C., Macpherson, N. N., Moorthy, S. D., de Kort, M. A. C., Mullany, S., Khader, N., et al. (2022) · Genes & Development · doi:10.1101/gad.349489.122 · Cited by 45
ZNF143 is a regulator of chromatin loop
Wen, Z., Huang, Z.-T., Zhang, R., & Peng, C. (2018) · Cell Biology and Toxicology · doi:10.1007/s10565-018-9443-z · Cited by 41
ATP, Mg2+, Nuclear Phase Separation, and Genome Accessibility
Wright, R. H. G., Dily, F. L., & Beato, M. (2019) · Trends in Biochemical Sciences · doi:10.1016/j.tibs.2019.03.001 · Cited by 54
Anderson, E. C., Frankino, P. A., Higuchi‐Sanabria, R., Yang, Q., Bian, Q., Podshivalova, K., Shin, A., Kenyon, C. J., Dillin, A. G., & Meyer, B. J. (2019) · Developmental Cell · doi:10.1016/j.devcel.2019.08.004 · Cited by 51
“Defining the relationship between TAD structure and gene regulation has been challenging because architectural proteins that establish TADs also bind and function at locations other than TAD boundaries, such as promoters, making it unclear whether the transcriptional changes resulting from their depletion are caused e…”
InfluentialAmat, R., Böttcher, R., Dily, F. L., Vidal, E., Quilez, J., Cuartero, Y., Beato, M., de Nadal, E., & Posas, F. (2018) · Genome Research · doi:10.1101/gr.238527.118 · Cited by 58
“Although ablation of either CTCF or RAD21 did not appear to have much an effect on compartment organization (Nora et al. 2017; Rao et al. 2017), another study showed increased interactions between B compartments when the cohesin loading factor Nipbl was deleted (Schwarzer et al. 2017).”
InfluentialThree-dimensional organization and dynamics of the genome
Szałaj, P., & Plewczyński, D. (2018) · Cell Biology and Toxicology · doi:10.1007/s10565-018-9428-y · Cited by 59
“was later shown that this effect was probably related to incomplete CTCF loss (Nora et al. 2017).”
BackgroundMethodInfluentialShowpnil, I. A., Selich‐Anderson, J., Taslim, C., Boone, M. A., Crow, J. C., Theisen, E. R., & Lessnick, S. L. (2022) · Nucleic Acids Research · doi:10.1093/nar/gkac747 · Cited by 59
“Alterations to CTCF binding have been previously shown to disrupt TAD boundaries (62,63).”
BackgroundPathology and immunohistochemistry study of Newcastle disease field case in chicken in Indonesia
Etriwati, E., Ratih, D., Handharyani, E., & Setiyaningsih, S. (2017) · Veterinary World · doi:10.14202/vetworld.2017.1066-1071 · Cited by 54
Physical principles and new applications of comet assay
Afanasieva, K. S., & Sivolob, A. (2018) · Biophysical Chemistry · doi:10.1016/j.bpc.2018.04.003 · Cited by 54
Song, Y., Liang, Z., Zhang, J., Hu, G.-C., Wang, J.-H., Li, Y.-Y., Guo, R., Dong, X.-T., Babarinde, I. A., Ping, W., et al. (2022) · Cell Reports · doi:10.1016/j.celrep.2022.110626 · Cited by 46
Metadata
- Authors
- Nora, E. P., Goloborodko, A., Valton, A.-L., Gibcus, J. H., Uebersohn, A., Abdennur, N., Dekker, J., Mirny, L. A., & Bruneau, B. G.
- Affiliations
- Gladstone Institutes (US)
- Massachusetts Institute of Technology (US)
- Howard Hughes Medical Institute (US)
- Corresponding author
- Nora, Elphège P.
- Bruneau, Benoit G.
- ORCID
- Venue
- Cell
- Publisher
- Elsevier BV
- Published
- 2017-05
- Volume
- 169
- Issue
- 5
- Pages
- 930-944.e22
- ISSN
- 0092-8674 (ISSN-L)
- PMC
- PMC5538188
- OpenAlex
- W2614144400
- Semantic Scholar
- e8afa0f77d39684b99c6679f6d08fd74cf1d90f5
- Cited by
- 1,709
- References
- 100
- Citations by year
- 2026: 146 · 2025: 162 · 2024: 172 · 2023: 187 · 2022: 204 · 2021: 231 · 2020: 207 · 2019: 196 · 2018: 139 · 2017: 63
- FWCI
- 67.99
- Type
- journal article
- Language
- en
- Open access
- bronze
- doi.org
- Licence
- Locations
- Cell (publishedVersion)
- PubMed (publishedVersion)
- Europe PMC (PubMed Central) (acceptedVersion)
- PubMed Central (acceptedVersion)
- DSpace@MIT (Massachusetts Institute of Technology) (submittedVersion, cc-by-nc-nd)
- eScholarship (California Digital Library) (submittedVersion)
- The Journal of the American Medical Association (JAMA) Network (American Medical Association) (submittedVersion)
- HAL (submittedVersion)
- Funders
- EMBO (ALTF523-2013)
- HSFP
- NIH/National Heart, Lung, and Blood Institute
- Bench to Bassinet Program (U01HL098179)
- Gladstone Institutes
- William H. Younger, Jr
- UCSF-Gladstone Institute of Virology & Immunology Center for AIDS Research (NIH P30 AI027763)
- National Human Genome Research Institute (R01 HG003143, U54 HG007010)
- NIH Common Fund (U54 DK107980, U01 DA 040588)
- Topics
- Life Sciences › Biochemistry, Genetics and Molecular Biology › Molecular Biology › Genomics and Chromatin Dynamics
- Life Sciences › Biochemistry, Genetics and Molecular Biology › Molecular Biology › Chromatin Remodeling and Cancer
- Life Sciences › Biochemistry, Genetics and Molecular Biology › Molecular Biology › Nuclear Structure and Function
- Keywords
- CTCF, topologically associating domains, chromatin insulation, chromosome folding, 3D genome organization, enhancer blocking, heterochromatin spreading, auxin-inducible degron, mouse embryonic stem cells, chromatin looping
- MeSH terms
- CCCTC-Binding Factor, Animals, Cell Cycle, Chromatin, Gene Expression Regulation, Indoleacetic Acids, Repressor Proteins, Transcription, Genetic, Chromosomes, Mammalian, Mice, Embryonic Stem Cells
About these checks
Registry, retraction, Cites and statistics results are computed, not judged, with one exception: a printed reference that no index lists is read once by a model before it counts as a citation error. Claims are extracted by a model and kept only when their quote appears verbatim in the text; each cited source is then checked, with a model’s help, for whether it says what the claim relies on. Those verdicts can be wrong — read the claim’s quote and the cited source before relying on one.
A language model drew the claims from the paper on 2026-10-07, under version 3 of the claim definition (model deepseek-v4.1-flash, prompt extract-v3).
A second model labelled each claim on 2026-10-07 (model jev-1.13-20260917, definition revision gold-guideline-v0.2).
Statistics and arithmetic are recomputed, not judged.
Confidence bands are shown only for fields calibrated on our annotated test set. None is calibrated yet, so no band is shown.
What counts as a claim ›How we measure confidence ›How we check this ›
Are you an author, or do you see a problem with this page? Request a review
