ITS primers with enhanced specificity for basidiomycetes ‐ application to the identification of mycorrhizae and rusts

GARDES, M., BRUNS, T. D.·1993·Molecular Ecology

DOI 10.1111/j.1365-294x.1993.tb00005.x

Open this paper in CoChat — free account

Abstract

We have designed two taxon‐selective primers for the internal transcribed spacer (ITS) region in the nuclear ribosomal repeat unit. These primers, ITS1‐F and ITS4‐B, were intended to be specific to fungi and basidiomycetes, respectively. We have tested the specificity of these primers against 13 species of ascomycetes, 14 of basidiomycetes, and 15 of plants. Our results showed that ITS4‐B, when paired with either a ‘universal’ primer ITS1 or the fungal‐specific primer ITS1‐F, efficiently amplified DNA from all basidiomycetes and discriminated against ascomycete DNAs. The results with plants were not as clearcut. The ITS1‐F/ITS4‐B primer pair produced a small amount of PCR product for certain plant species, but the quantity was in most cases less than that produced by the ‘universal’ ITS primers. However, under conditions where both plant and fungal DNAs were present, the fungal DNA was amplified to the apparent exclusion of plant DNA. ITS1‐F/ITS4‐B preferential amplification was shown to be particularly useful for detection and analysis of the basidiomycete component in ectomycorrhizae and in rust‐infected tissues. These primers can be used to study the structure of ectomycorrhizal communities or the distribution of rusts on alternate hosts.

The claims and statistics of this paper haven’t been checked yet.

Run the check — free, no account needed. It reads the open-access text and checks the sources it cites.

Integrity signals

Registry

Crossref · 10.1111/j.1365-294x.1993.tb00005.x

Cites

Statistics

Claims the paper makes

The claims and statistics of this paper haven’t been checked yet.

Run the check — free, no account needed. It reads the open-access text and checks the sources it cites.

Self-check

Percentages, sums and reported differences re-computed from the paper’s own numbers.

The self-check needs the paper’s full text.

No references could be resolved yet.

Research works printed but not linked: 22

10.2307/3760315 · DOI
10.1101/gr.1.1.51 · DOI · Paper page
10.2307/3760328 · DOI
Bobola MS, 1992, Five major nuclear ribosomal repeats represent a large and variable region of the genomic DNA of Picea rubens and P. mariana, Molecular Biology and Evolution, 9, 125
10.1016/0147-5975(92)90038-S · DOI
DahlbergA.(1991)Ectomycorrhiza in coniferous forest: structure and dynamics of populations and communities.PhD thesis Uppsala.
10.2307/3760071 · DOI
Gardes M., 1991, Rapid characterization of ectomycorrhizae using RFLP pattern of their PCR amplified‐ITS, Mycological Society Newsletter, 41, 14
10.1139/b91-026 · DOI · Paper page
10.1016/S0007-1536(88)80211-0 · DOI
Harley JL, 1983, Mycorrhizal Symbiosis
10.1139/x90-061 · DOI
10.1093/nar/18.4.999 · DOI · Paper page
Lee SB, 1992, Phylogeny of five fungus‐like protoctistan Phytophtora species, inferred from the internal transcribed spacers of ribosomal DNA, Molecular Biology and Evolution, 9, 636
10.1016/0076-6879(87)55023-6 · DOI
10.1016/0885-5765(91)90027-F · DOI
10.1007/BF00351728 · DOI · Paper page
Porter CH, 1991, Species‐diagnostic differences in a ribosomal DNA internal transcribed spacer from the sibling species Anopheles freeborni and Anopheles hermsi (Diptera: Culicidae), American Journal of Tropical Medecineand Hygiene, 45, 271, 10.4269/ajtmh.1991.45.271 · DOI
10.1007/BF01972080 · DOI · Paper page
Simonet P., 1991, Frankia genus‐specific characterization by polymerase chain reaction, Applied and Environmental Microbiology, 57, 3278, 10.1128/aem.57.11.3278-3286.1991 · DOI
10.1093/nar/17.16.6749 · DOI
White TJ, 1990, PCR Protocols: a Guide to Methods and Applications, 315

Diet rapidly and reproducibly alters the human gut microbiome
David, L. A., Maurice, C. F., Carmody, R. N., Gootenberg, D. B., Button, J. E., Wolfe, B. E., Ling, A. V., Devlin, A. S., Varma, Y., Fischbach, M. A., et al. (2014) · Nature · doi:10.1038/nature12820 · Cited by 10,100
Development of the Human Infant Intestinal Microbiota
Palmer, C., Bik, E. M., DiGiulio, D. B., Relman, D. A., & Brown, P. O. (2007) · PLoS Biology · doi:10.1371/journal.pbio.0050177 · Cited by 2,877
Plant diversity increases soil microbial activity and soil carbon storage
Lange, M., Eisenhauer, N., Sierra, C. A., Bessler, H., Engels, C., Griffiths, R. I., Mellado-Vázquez, P. G., Malik, A. A., Roy, J., Scheu, S., et al. (2015) · Nature Communications · doi:10.1038/ncomms7707 · Cited by 1,742
The Colletotrichum gloeosporioides species complex
Weir, B. S., Johnston, P. R., & Damm, U. (2012) · Studies in Mycology · doi:10.3114/sim0011 · Cited by 1,646
Network analysis reveals functional redundancy and keystone taxa amongst bacterial and fungal communities during organic matter decomposition in an arable soil
Banerjee, S., Kirkby, C. A., Schmutter, D., Bissett, A., Kirkegaard, J. A., & Richardson, A. E. (2016) · Soil Biology and Biochemistry · doi:10.1016/j.soilbio.2016.03.017 · Cited by 1,050
The Colletotrichum acutatum species complex
Damm, U., Cannon, P. F., Woudenberg, J. H. C., & Crous, P. W. (2012) · Studies in Mycology · doi:10.3114/sim0010 · Cited by 979
Molecular systematics and phylogeography of the Gibberella fujikuroi species complex
O'Donnell, K., Cigelnik, E., & Nirenberg, H. I. (1998) · Mycologia · doi:10.1080/00275514.1998.12026933 · Cited by 963
Archaea and fungi of the human gut microbiome: correlations with diet and bacterial residents
Hoffmann, C., Dollive, S., Grunberg, S., Chen, J., Li, H., Wu, G. D., Lewis, J. D., & Bushman, F. D. (2013) · PLoS ONE · doi:10.1371/journal.pone.0066019 · Cited by 808
“Archaeal specific 16S rDNA primers and ITS1 fungal primers were adapted from the literature and used to amplify a rDNA 16S fragment; the final PCR cycling conditions were optimized to maximize specificity [51], [52], [38], [40],(Tables S5 and S6).”
Method
Cheese rind communities provide tractable systems for in situ and in vitro studies of microbial diversity
Wolfe, B. E., Button, J. E., Santarelli, M., & Dutton, R. J. (2014) · Cell · doi:10.1016/j.cell.2014.05.041 · Cited by 648
The Colletotrichum dracaenophilum , C. magnum and C. orchidearum species complexes
Damm, U., Sato, T., Alizadeh, A., Groenewald, J. Z., & Crous, P. W. (2019) · Studies in Mycology · doi:10.1016/j.simyco.2018.04.001 · Cited by 274
Production, characterization, and antifungal activity of a biosurfactant produced by Rhodotorula babjevae YS3
Sen, S., Borah, S. N., Bora, A., & Deka, S. (2017) · Microbial Cell Factories · doi:10.1186/s12934-017-0711-z · Cited by 205
“Regions of the rDNA containing the ITS and D1/D2 LSU domains were amplified using different combinations of the primers ITS1-F (CTTGGTCATT TAGAGGAAGTAA) [17], ITS1 (TCCGTAGGTGAACC TGCGG) [18], ITS4 (TCCTCCGCTTATTGATATGC) [18], and TW14 (GCTATCCTGAGGGAAACTT) [19].”
Method
Comparative microbiome analysis of a Fusarium wilt suppressive soil and a Fusarium wilt conducive soil from the Châteaurenard region
Siegel-Hertz, K., Edel-Hermann, V., Chapelle, E., Terrat, S., Raaijmakers, J. M., & Steinberg, C. (2018) · Frontiers in Microbiology · doi:10.3389/fmicb.2018.00568 · Cited by 164
“For fungal identification, the variable internal transcribed spacer 1 (ITS1) region was amplified using specific fungal primers ITS1F (5′-CTTGGTCATTTAGAGGAAGTAA-3′) and ITS2 (5′- GCTGCGTTCTTCATCGATGC-3′; White et al., 1990; Gardes and Bruns, 1993; Buée et al., 2009).”
Method
13C pulse‐labeling assessment of the community structure of active fungi in the rhizosphere of a genetically starch‐modified potato (Solanum tuberosum) cultivar and its parental isoline
Hannula, S. E., Boschker, H. T. S., de Boer, W., & van Veen, J. A. (2012) · New Phytologist · doi:10.1111/j.1469-8137.2012.04089.x · Cited by 153
Effects of biochar addition on greenhouse gas emissions and microbial responses in a short-term laboratory experiment
Yoo, G., & Kang, H. (2012) · Journal of Environmental Quality · doi:10.2134/jeq2011.0157 · Cited by 143
Microbial composition of Kombucha determined using amplicon sequencing and shotgun metagenomics
Arıkan, M., Mitchell, A. L., Finn, R. D., & Gürel, F. (2020) · Journal of Food Science · doi:10.1111/1750-3841.14992 · Cited by 123
An endophytic isolate of the fungus Yarrowia lipolytica produces metabolites that ameliorate the negative impact of salt stress on the physiology of maize
Gul Jan, F., Hamayun, M., Hussain, A., Jan, G., Iqbal, A., Khan, A., & Lee, I.-J. (2019) · BMC Microbiology · doi:10.1186/s12866-018-1374-6 · Cited by 116
Re-Mind the Gap! Insertion—deletion data reveal neglected phylogenetic potential of the nuclear ribosomal internal transcribed spacer (ITS) of Fungi
Nagy, L. G., Kocsubé, S., Csanádi, Z., Kovács, G. M., Petkovits, T., Vágvölgyi, C., & Papp, T. (2012) · PLoS ONE · doi:10.1371/journal.pone.0049794 · Cited by 117
Tongue microbiota and oral health status in community-dwelling elderly adults.
Asakawa, M., Takeshita, T., Furuta, M., Kageyama, S., Takeuchi, K., Hata, J., Ninomiya, T., & Yamashita, Y. (2018) · mSphere · doi:10.1128/msphere.00332-18 · Cited by 113
Competition assays and physiological experiments of soil and phyllosphere yeasts identify Candida subhashii as a novel antagonist of filamentous fungi
Hilber-Bodmer, M., Schmid, M., Ahrens, C. H., & Freimoser, F. M. (2017) · BMC Microbiology · doi:10.1186/s12866-016-0908-z · Cited by 106
“In cases where MALDI-TOF did not allow species identification, the fungal ITS region was amplified with primers ITS1f [50] and ITS4 [51], PCR products were directly used for sequencing, and all isolates were assigned a species hypothesis according to the UNITE database [52, 53] (see also Table 1).”
Method
A novel and efficient fungal delignification strategy based on versatile peroxidase for lignocellulose bioconversion
Kong, W., Fu, X., Wang, L., Alhujaily, A., Zhang, J., Ma, F., Zhang, X., & Yu, H. (2017) · Biotechnology for Biofuels · doi:10.1186/s13068-017-0906-x · Cited by 103
Species of the Colletotrichum acutatum complex associated with anthracnose diseases of fruit in Brazil
Bragança, C. A. D., Damm, U., Baroncelli, R., Massola Júnior, N. S., & Crous, P. W. (2016) · Fungal Biology · doi:10.1016/j.funbio.2016.01.011 · Cited by 102
Diverse species of Colletotrichum associated with grapevine anthracnose in China
Yan, J.-Y., Jayawardena, M. M. R. S., Goonasekara, I. D., Wang, Y., Zhang, W., Liu, M., Huang, J.-B., Wang, Z.-Y., Shang, J.-J., Peng, Y.-L., et al. (2015) · Fungal Diversity · doi:10.1007/s13225-014-0310-9 · Cited by 100
Species of Colletotrichum on Agavaceae
Farr, D. F., Aime, M. C., Rossman, A. Y., & Palm, M. E. (2006) · Mycological Research · doi:10.1016/j.mycres.2006.09.001 · Cited by 95
Revegetation of urban green space rewilds soil microbiotas with implications for human health and urban design
Mills, J. G., Bissett, A., Gellie, N. J. C., Lowe, A. J., Selway, C. A., Thomas, T., Weinstein, P., Weyrich, L. S., & Breed, M. F. (2020) · Restoration Ecology · doi:10.1111/rec.13175 · Cited by 90
The impact of phenotypic and molecular data on the inference of Colletotrichum diversity associated with Musa
Vieira, W. A. S., Lima, W. G., Nascimento, E. S., Michereff, S. J., Câmara, M. P. S., & Doyle, V. P. (2017) · Mycologia · doi:10.1080/00275514.2017.1418577 · Cited by 83
Killer toxin from several food-derived Debaryomyces hansenii strains effective against pathogenic Candida yeasts
Banjara, N., Nickerson, K. W., Suhr, M. J., & Hallen-Adams, H. E. (2016) · International Journal of Food Microbiology · doi:10.1016/j.ijfoodmicro.2016.01.016 · Cited by 79
Microbial Community Analysis of Human Decomposition on Soil
Parkinson, R. A., Dias, K.-R., Horswell, J., Greenwood, P., Banning, N., Tibbett, M., & Vass, A. A. (2008) · Criminal and Environmental Soil Forensics · doi:10.1007/978-1-4020-9204-6_24 · Cited by 79
Probiotic and antifungal attributes of Levilactobacillus brevis MYSN105, isolated from an Indian traditional fermented food Pozha
Somashekaraiah, R., Mottawea, W., Gunduraj, A., Joshi, U., Hammami, R., & Sreenivasa, M. Y. (2021) · Frontiers in Microbiology · doi:10.3389/fmicb.2021.696267 · Cited by 66
Microbial composition and functional diversity differ across urban green infrastructure types
Gill, A. S., Purnell, K., Palmer, M. I., Stein, J., & McGuire, K. L. (2020) · Frontiers in Microbiology · doi:10.3389/fmicb.2020.00912 · Cited by 64
Ultradeep Microbial Communities at 4.4 km within Crystalline Bedrock: Implications for Habitability in a Planetary Context
Purkamo, L., Kietäväinen, R., Nuppunen-Puputti, M., Bomberg, M., & Cousins, C. (2020) · Life · doi:10.3390/life10010002 · Cited by 55
Soil amendments yield persisting effects on the microbial communities - a 7-year study
Reardon, C. L., & Wuest, S. B. (2016) · Applied Soil Ecology · doi:10.1016/j.apsoil.2015.12.013 · Cited by 55
Isolation and characterization of yeasts associated with plants growing in heavy-metal-and arsenic-contaminated soils
Ramos-Garza, J., Bustamante-Brito, R., Ángeles de Paz, G., Medina-Canales, M. G., Vásquez-Murrieta, M. S., Wang, E. T., & Rodríguez-Tovar, A. V. (2016) · Canadian Journal of Microbiology · doi:10.1139/cjm-2015-0226 · Cited by 48
Factors Influencing Distribution of Coccidioides immitis in Soil, Washington State, 2016.
Chow, N. A., Kangiser, D., Gade, L., McCotter, O. Z., Hurst, S., Salamone, A., Wohrle, R., Clifford, W., Kim, S., Salah, Z., et al. (2021) · mSphere · doi:10.1128/msphere.00598-21 · Cited by 46
Ecological restoration of a copper polluted vineyard: long-term impact of farmland abandonment on soil bio-chemical properties and microbial communities
Cavani, L., Manici, L. M., Caputo, F., Peruzzi, E., & Ciavatta, C. (2016) · Journal of Environmental Management · doi:10.1016/j.jenvman.2016.07.050 · Cited by 46
Sphaeropsis sapinea and associated endophytes in Scots pine: Interactions and effect on the host under variable water content
Blumenstein, K., Bußkamp, J., Langer, G. J., Schlößer, R., Parra Rojas, N. M., & Terhonen, E. (2021) · Frontiers in Forests and Global Change · doi:10.3389/ffgc.2021.655769 · Cited by 39
Effect of dry matter content on the microbial community and on the effectiveness of a microbial inoculant to improve the aerobic stability of corn silage
Benjamim da Silva, É., Liu, X., Mellinger, C., Gressley, T. F., Stypinski, J. D., Moyer, N. A., & Kung, L. (2022) · Journal of Dairy Science · doi:10.3168/jds.2021-21515 · Cited by 36
Effects of single-root-grafting, double-root-grafting and compost application on microbial properties of rhizosphere soils in Chinese protected cucumber (Cucumis sativus L.) production systems
Gao, Y., Tian, Y., Liang, X., & Gao, L. (2015) · Scientia Horticulturae · doi:10.1016/j.scienta.2015.02.026 · Cited by 22
Brassicaceous seed meal, root removal, and chemical fumigation vary in their effects on soil quality parameters and Pratylenchus penetrans in a replanted floricane raspberry production system
Rudolph, R. E., Zasada, I. A., Hesse, C., & DeVetter, L. W. (2019) · Applied Soil Ecology · doi:10.1016/j.apsoil.2018.08.024 · Cited by 15
Molecular and phenotypic characterization revealed six Colletotrichum species responsible for anthracnose disease of small cardamom in South India
Chethana, C. S., Chowdappa, P., Biju, C. N., Praveena, R., & Sujatha, A. M. (2016) · European Journal of Plant Pathology · doi:10.1007/s10658-016-0931-9 · Cited by 14
Effectiveness of Nontarped Broadcast Fumigation and Root Removal on Root Lesion Nematode and Fusarium and Pythium Species in a Red Raspberry System
DeVetter, L. W., Watkinson, S., Zasada, I. A., Weiland, J. E., Hesse, C., & Walters, T. W. (2018) · Plant Health Progress · doi:10.1094/php-01-18-0006-rs · Cited by 5

Authors: GARDES, M., & BRUNS, T. D.
Venue: Molecular Ecology
Publisher: Wiley
Published: 1993-04
Volume: 2
Issue: 2
Pages: 113-118
ISSN: 0962-1083 (ISSN-L)
1365-294X
DOI: 10.1111/j.1365-294x.1993.tb00005.x
OpenAlex: W2130889389
Cited by: 10,480
References: 0
FWCI: 31.45
Type: journal article
Language: en
Open access: closed
Licence: onlinelibrary.wiley.com/termsAndConditions#vor (vor, 5492 d)

About these checks

Registry, retraction, Cites and statistics results are computed, not judged, with one exception: a printed reference that no index lists is read once by a model before it counts as a citation error. Claims are extracted by a model and kept only when their quote appears verbatim in the text; each cited source is then checked, with a model’s help, for whether it says what the claim relies on. Those verdicts can be wrong — read the claim’s quote and the cited source before relying on one.

Statistics and arithmetic are recomputed, not judged.

Confidence bands are shown only for fields calibrated on our annotated test set. None is calibrated yet, so no band is shown.

What counts as a claim ›How we measure confidence ›How we check this ›

Are you an author, or do you see a problem with this page? Request a review

Data sources

Bibliographic data: Semantic Scholar, OpenAlex, Crossref.

Contains information from the Semantic Scholar Academic Graph Datasets, made available under the ODC Attribution License (ODC-BY 1.0).

Semantic Scholar’s data is described in: Kinney, R., et al. (2023). The Semantic Scholar Open Data Platform. arXiv:2301.10140.

ITS primers with enhanced specificity for basidiomycetes ‐ application to the identification of mycorrhizae and rusts

Abstract

Overview

Integrity signals

Verification

Claims the paper makes

Self-check

Citations

Cites

Cited by

Metadata

Record

About these checks

Data sources