Cited by 1,121Gut microbiota and healthRuminant Nutrition and Digestive PhysiologyAnimal Nutrition and Physiology

The DOI matches its Crossref record; 82 of the 82 references it cites were found in a registry or an index.

Evaluation of the bacterial diversity in the feces of cattle using 16S rDNA bacterial tag-encoded FLX amplicon pyrosequencing (bTEFAP)

Open access

Dowd, Scot E, Callaway, Todd R, Wolcott, Randall D, Sun, Yan, McKeehan, Trevor, Hagevoort, Robert G, Edrington, Thomas S·2008·BMC Microbiology

DOI 10.1186/1471-2180-8-125PMC PMC2515157

Open this paper in CoChat — free account Open PDF

Abstract

BACKGROUND: The microbiota of an animal's intestinal tract plays important roles in the animal's overall health, productivity and well-being. There is still a scarcity of information on the microbial diversity in the gut of livestock species such as cattle. The primary reason for this lack of data relates to the expense of methods needed to generate such data. Here we have utilized a bacterial tag-encoded FLX 16s rDNA amplicon pyrosequencing (bTEFAP) approach that is able to perform diversity analyses of gastrointestinal populations. bTEFAP is relatively inexpensive in terms of both time and labor due to the implementation of a novel tag priming method and an efficient bioinformatics pipeline. We have evaluated the microbiome from the feces of 20 commercial, lactating dairy cows. RESULTS: Ubiquitous bacteria detected from the cattle feces included Clostridium, Bacteroides, Porpyhyromonas, Ruminococcus, Alistipes, Lachnospiraceae, Prevotella, Lachnospira, Enterococcus, Oscillospira, Cytophage, Anaerotruncus, and Acidaminococcus spp. Foodborne pathogenic bacteria were detected in several of the cattle, a total of 4 cows were found to be positive for Salmonella spp (tentative enterica) and 6 cows were positive for Campylobacter spp. (tentative lanienae). CONCLUSION: Using bTEFAP we have examined the microbiota in the feces of cattle. As these methods continue to mature we will better understand the ecology of the major populations of bacteria the lower intestinal tract. This in turn will allow for a better understanding of ways in which the intestinal microbiome contributes to animal health, productivity and wellbeing.

The claims and statistics of this paper haven’t been checked yet.

Run the check — free, no account needed. It reads the open-access text and checks the sources it cites.

Integrity signals

Registry

Crossref · 10.1186/1471-2180-8-125

Cites

82 of 82 references verified0 citation errors · 0 not checkable

Statistics

Claims the paper makes

The claims and statistics of this paper haven’t been checked yet.

Run the check — free, no account needed. It reads the open-access text and checks the sources it cites.

Claims other papers make about this one

Each is checked against this paper’s own text: does it say what the citing paper says it does?

Self-check

Percentages, sums and reported differences re-computed from the paper’s own numbers.

The self-check needs the paper’s full text.

Basic local alignment search tool
Altschul, S. F., Gish, W., Miller, W., Myers, E. W., & Lipman, D. J. (1990) · Journal of Molecular Biology · doi:10.1006/jmbi.1990.9999 · Cited by 98,669 · cited 2×
“The resulting TC FASTA for each sample was then evaluated using BLASTn [77] against a custom database derived from the RDP-II database [78] and GenBank http://ncbi.”
Method
An obesity-associated gut microbiome with increased capacity for energy harvest
Turnbaugh, P. J., Ley, R. E., Mahowald, M. A., Magrini, V., Mardis, E. R., & Gordon, J. I. (2006) · Nature · doi:10.1038/nature05414 · Cited by 12,444 · cited 1×
“Results and Discussion Recent research related to host physiology (obesity) and the gastrointestinal bacterial populations have sparked a renewed interest in understanding the gut microbiome [26,27].”
Background
Human gut microbes associated with obesity
Ley, R. E., Turnbaugh, P. J., Klein, S., & Gordon, J. I. (2006) · Nature · doi:10.1038/4441022a · Cited by 8,785 · cited 1×
“Results and Discussion Recent research related to host physiology (obesity) and the gastrointestinal bacterial populations have sparked a renewed interest in understanding the gut microbiome [26,27].”
Background
Diversity of the Human Intestinal Microbial Flora
Eckburg, P. B., Bik, E. M., Bernstein, C. N., Purdom, E., Dethlefsen, L., Sargent, M., Gill, S. R., Nelson, K. E., & Relman, D. A. (2005) · Science · doi:10.1126/science.1110591 · Cited by 7,913 · cited 1×
“Information on microbial diversity within the gastrointestinal tract of humans has increased in recent years as a result of 16S rDNA-based analyses [9,10], yet similar data on the microbiomes of livestock is lacking [11,12].”
Background
Food-Related Illness and Death in the United States
Mead, P. S., Slutsker, L., DIETZ, V. J., McCaig, L. F., Bresee, J., Shapiro, C. A., Griffin, P. M., & Tauxe, R. V. (1999) · Emerging infectious diseases · doi:10.3201/eid0505.990502 · Cited by 7,305
CAP3: A DNA Sequence Assembly Program
Huang, X., & Madan, A. (1999) · Genome Research · doi:10.1101/gr.9.9.868 · Cited by 5,261 · cited 3×
“The ace files generated by CAP3 were then processed to generate a secondary FASTA file containing the tentative consensus (TC) sequences of the assembly along with the number of reads integrated into each consensus.”
MethodInfluential
Ecological and Evolutionary Forces Shaping Microbial Diversity in the Human Intestine
Ley, R. E., Peterson, D. A., & Gordon, J. I. (2006) · Cell · doi:10.1016/j.cell.2006.02.017 · Cited by 3,358 · cited 1×
“Information on microbial diversity within the gastrointestinal tract of humans has increased in recent years as a result of 16S rDNA-based analyses [9,10], yet similar data on the microbiomes of livestock is lacking [11,12].”
Background
The Rumen and Its Microbes
Hungate, R. E. (2013) · Elsevier eBooks · doi:10.1016/c2013-0-12555-x · Cited by 3,060
Bacteroides : the Good, the Bad, and the Nitty-Gritty
Wexler, H. M. (2007) · Clinical Microbiology Reviews · doi:10.1128/cmr.00008-07 · Cited by 2,388
Determination of microbial diversity in environmental samples: pitfalls of PCR-based rRNA analysis
von Wintzingerode, F., Göbel, U. B., & Stackebrandt, E. S. (1997) · FEMS Microbiology Reviews · doi:10.1111/j.1574-6976.1997.tb00351.x · Cited by 2,085

Show all 80 references

Sorted by citations

Items 601–700 of 1,000

Methanogenic Archaea in Marcellus Shale: A Possible Mechanism for Enhanced Gas Recovery in Unconventional Shale Resources
Tucker, Y. T., Kotcon, J. B., & Mroz, T. H. (2015) · Environmental Science & Technology · doi:10.1021/acs.est.5b00765 · Cited by 25
Bacterial diversity in a large, temperate, heavily modified river, as determined by pyrosequencing
Schultz, G., Kovatch, J. J., & Anneken, E. (2013) · Aquatic Microbial Ecology · doi:10.3354/ame01646 · Cited by 25
Yucatán in black and red: Linking edaphic analysis and pyrosequencing-based assessment of bacterial and fungal community structures in the two main kinds of soil of Yucatán State
Estrada‐Medina, H., Canto‐Canché, B., Santos-Briones, C. D. L., & O’Connor-Sánchez, A. (2016) · Microbiological Research · doi:10.1016/j.micres.2016.04.007 · Cited by 24
Improvement of carbon usage for phosphorus recovery in EBPR-r and the shift in microbial community
Wong, P. Y., Cheng, K. Y., Krishna, K. C. B., Kaksonen, A. H., Sutton, D. C., & Ginige, M. P. (2018) · Journal of Environmental Management · doi:10.1016/j.jenvman.2018.03.130 · Cited by 25
Survey of Microbial Diversity in Flood Areas during Thailand 2011 Flood Crisis Using High-Throughput Tagged Amplicon Pyrosequencing
Mhuantong, W., Wongwilaiwalin, S., Laothanachareon, T., Eurwilaichitr, L., Tangphatsornruang, S., Suwannasilp, B. B., Limpiyakorn, T., Pattaragulwanit, K., Punmatharith, T., McEvoy, J., et al. (2015) · PLoS ONE · doi:10.1371/journal.pone.0128043 · Cited by 24
“Tagged amplicon pyrosequencing or bacterial tag encoded FLX amplicon pyrosequencing (bTEFAB) has been introduced for high-throughput sequencing of specific target genes, particularly the 16S rRNA gene as a marker for biodiversity [5, 6].”
Method
Chemical Cleaning Techniques for Fouled RO Membranes: Enhancing Fouling Removal and Assessing Microbial Composition
Al‐Belushi, M., Kyaw, H. H., Myint, M. T. Z., Al-Abri, M. Z., & Dobretsov, S. (2024) · Membranes · doi:10.3390/membranes14100204 · Cited by 24
“Cleaning A showed the WCA value ◦ ± ◦ Surface roughness for virgin and Cleaning A and B membranes were not signi ﬁ cantly di ﬀ erent; thus, similar surface we tt ing nature was witnessed (Figure 5).”
BackgroundMethodResultInfluential
Examination of Soil Microbial Communities After Permafrost Thaw Subsequent to an Active Layer Detachment in the High Arctic
Inglese, C. N., Christiansen, C. T., Lamhonwah, D., Moniz, K., Montross, S. N., Lamoureux, S. F., Lafrenière, M. J., Grogan, P., & Walker, V. K. (2017) · Arctic Antarctic and Alpine Research · doi:10.1657/aaar0016-066 · Cited by 24
“…ci ng A rc ha ea l a m oA qP C R a m oA F T G A G T C G T A T T A G A G C T T G G C G 40 95 ° C 15 s 55 ° C 15 s 72 ° C 1 m in qR T- PC R qP C R a m oA R C A C C T A A A T G G C C G C A C A A T 460 / CaRa n. inglese et al. / aRCtiC, antaRCtiC, and alpine ReseaRCh (Dowd et al., 2008) at MR DNA.”
Distribution of Bacteria and Archaea in meromictic tropical Lake Kivu (Africa)
İnceoǧlu, Ö., Llirós, M., García–Armisen, T., Crowe, S., Michiels, C., Darchambeau, F., Descy, J., & Servais, P. (2014) · Aquatic Microbial Ecology · doi:10.3354/ame01737 · Cited by 24
“DNA extractions from each water depth and sampling site were analysed by means of bacterial and archaeal tag-encoded FLX amplicon pyrosequencing (bTEFAP and aTEFAP, respectively) as previously described (Dowd et al. 2008, Callaway et al. 2010).”
Method
Identification of a Ruminococcaceae Species as the Methyl tert-Butyl Ether (MTBE) Degrading Bacterium in a Methanogenic Consortium
Liu, T., Ahn, H., Sun, W., McGuinness, L. R., Kerkhof, L. J., & Häggblom, M. M. (2016) · Environmental Science & Technology · doi:10.1021/acs.est.5b04731 · Cited by 24
Fungal dysbiosis predicts the diagnosis of pediatric Crohn’s disease
Mouzan, M. I. E., Korolev, K. S., Mofarreh, M. A. A., Menon, R., Winter, H. S., Sarkhy, A. A. A., Dowd, S. E., Barrag, A. A., & Assiri, A. A. (2018) · World Journal of Gastroenterology · doi:10.3748/wjg.v24.i39.4510 · Cited by 24
Microbial Enrichment Culture Responsible for the Complete Oxidative Biodegradation of 3-Amino-1,2,4-triazol-5-one (ATO), the Reduced Daughter Product of the Insensitive Munitions Compound 3-Nitro-1,2,4-triazol-5-one (NTO)
Madeira, C. L., Jog, K. V., Vanover, E. T., Brooks, M. D., Taylor, D. K., Sierra‐Álvarez, R., Waidner, L. A., Spain, J. C., Krzmarzick, M. J., & Field, J. A. (2019) · Environmental Science & Technology · doi:10.1021/acs.est.9b04065 · Cited by 24
Agr2-associated ER stress promotes adherent-invasive E. coli dysbiosis and triggers CD103+ dendritic cell IL-23-dependent ileocolitis
Viladomiu, M., Khounlotham, M., Dogan, B., Lima, S. F., Elsaadi, A. M., Cardakli, E. D., Castellanos, J. G., Ng, C., Herzog, J., Schoenborn, A. A., et al. (2022) · Cell Reports · doi:10.1016/j.celrep.2022.111637 · Cited by 24
First insight into the faecal microbiota of the high Arctic muskoxen (Ovibos moschatus)
Flores, A., Bockwoldt, M., Hagen, L. H., Pope, P. B., & Sundset, M. A. (2016) · Microbial Genomics · doi:10.1099/mgen.0.000066 · Cited by 22
“The Firmicutes and Bacteroidetes are also dominant in faeces from the cattle and horse hindgut (Dowd et al. , 2008; Steelman et al. , 2012).”
The acidified drinking water-induced changes in the behavior and gut microbiota of wild-type mice depend on the acidification mode
Whipple, B., Agar, J., Zhao, J., Pearce, D. A., & Kovács, A. (2021) · Scientific Reports · doi:10.1038/s41598-021-82570-0 · Cited by 24
Microbiome diversity of cotton aphids (Aphis gossypii) is associated with host alternation
Ma, Y.-J., He, H.-P., Zhao, H.-M., Xian, Y.-D., Guo, H., Liu, B., & Xue, K. (2021) · Scientific Reports · doi:10.1038/s41598-021-83675-2 · Cited by 23
Inter and intraspecies comparison of the level of selected bacterial phyla in in cattle and sheep based on feces
Szeligowska, N., Cholewińska, P., Czyż, K., Wojnarowski, K., & Janczak, M. (2021) · BMC Veterinary Research · doi:10.1186/s12917-021-02922-w · Cited by 23
“UNIVERSAL EUBACTERIAL GENES [17] 530F (5′-GTC CCA GCM GCN GCG G) 1100R (5′-GGG TTN CGN TCG TTG)”
Background
Lactic acid fermentation of human excreta for agricultural application
Andreev, N., Ronteltap, M., Boincean, B. P., & Lens, P. N. L. (2017) · Journal of Environmental Management · doi:10.1016/j.jenvman.2017.11.072 · Cited by 25
“monosaccharides, oligosaccharides, polysaccharides and lignocelluloses (Dowd et al., 2008).”
Background
Campylobacter jejuni Colonization Is Associated with a Dysbiosis in the Cecal Microbiota of Mice in the Absence of Prominent Inflammation
Lone, A. G., Selinger, L. B., Uwiera, R. R. E., Xu, Y., & Inglis, G. D. (2013) · PLoS ONE · doi:10.1371/journal.pone.0075325 · Cited by 23
“The resulting PCR product was used as template in a second PCR reaction with fusion primers [42].”
Method
Metagenomic investigation of faecal microbiota in sheep and goats of the same ages
Shabana, I., Albakri, N. N., & Bouqellah, N. A. (2020) · Journal of Taibah University for Science · doi:10.1080/16583655.2020.1864930 · Cited by 23
Characterization of fecal microbiota from a Salmonella endemic cattle herd as determined by oligonucleotide fingerprinting of rDNA genes
Patton, T. G., Scupham, A. J., Bearson, S. M. D., & Carlson, S. A. (2008) · Veterinary Microbiology · doi:10.1016/j.vetmic.2008.10.032 · Cited by 23
“Two previous studies examined Holstein feces using 16S rDNA gene sequence analysis (Dowd et al., 2008; Ozutsumi et al., 2005).”
MethodResult
Low pH reduces the virulence of black band disease on Orbicella faveolata
Muller, E. M., Leporacci, N. M., Macartney, K. J., Shea, A. G., Crane, R. E., Hall, E. R., & Ritchie, K. B. (2017) · PLoS ONE · doi:10.1371/journal.pone.0178869 · Cited by 22
Comprehensive analysis of the apple rhizobiome as influenced by different Brassica seed meals and rootstocks in the same soil/plant system
Somera, T. M., Freilich, S., & Mazzola, M. (2020) · Applied Soil Ecology · doi:10.1016/j.apsoil.2020.103766 · Cited by 22
An assessment of the persistence of putative pathogenic bacteria in chloraminated water distribution systems
Krishna, K. C. B., Sathasivan, A., & Ginige, M. P. (2020) · Water Research · doi:10.1016/j.watres.2020.116677 · Cited by 22
Gut Microbiome Composition and Metabolic Status Are Differently Affected by Early Exposure to Unhealthy Diets in a Rat Model
Marco, P. D., Henriques, A. C., Azevedo, R. M. S., Sá, S. I., Cardoso, A., Fonseca, B. M., Barbosa, J., & Leal, S. M. (2021) · Nutrients · doi:10.3390/nu13093236 · Cited by 22
Spoilage Investigation of Chill Stored Meagre (Argyrosomus regius) Using Modern Microbiological and Analytical Techniques
Syropoulou, F., Parlapani, F. F., Anagnostopoulos, D. A., Stamatiou, A., Mallouchos, A., & Boziaris, I. S. (2021) · Foods · doi:10.3390/foods10123109 · Cited by 22
The impact of different diets and genders on fecal microbiota in Hanwoo cattle
Sim, S., Lee, H., Yoon, S., Seon, H., Park, C., & Kim, M. (2022) · Journal of Animal Science and Technology · doi:10.5187/jast.2022.e71 · Cited by 23
Microbiota profile of filleted gilthead seabream (Sparus aurata) during storage at various conditions by 16S rRNA metabarcoding analysis
Anagnostopoulos, D. A., Syropoulou, F., Parlapani, F. F., Tsiartsafis, A., Exadactylos, A., Nychas, G. E., & Boziaris, I. S. (2022) · Food Research International · doi:10.1016/j.foodres.2022.112312 · Cited by 22
Ready-To-Eat Rocket Salads as Potential Reservoir of Bacteria for the Human Microbiome
Mantegazza, G., Gargari, G., Duncan, R., Consalez, F., Taverniti, V., Riso, P., & Guglielmetti, S. (2022) · Microbiology Spectrum · doi:10.1128/spectrum.02970-22 · Cited by 24
“Amplicons were then sequenced using primer 1100R (59-G GGTTNCGNTCGTTG-39) (53).”
Method
Functional-Structural Analysis of Nitrogen-Cycle Bacteria in a Hypersaline Mat from the Omani Desert
Abed, R. M. M., de Beer, D., & Stief, P. (2014) · Geomicrobiology Journal · doi:10.1080/01490451.2014.932033 · Cited by 22
“Tag-encoded FLX amplicon pyrosequencing (bTEFAP) was performed as described before (Dowd et al. 2008a,b) using the GS FLX titanium sequencing kit XLR70.”
Method
Interactions between land-use history and earthworms control gross rates of soil methane production in an overwintering pasture
Bradley, R. L., Chroňáková, A., Elhottová, D., & Šimek, P. (2012) · Soil Biology and Biochemistry · doi:10.1016/j.soilbio.2012.04.025 · Cited by 22
Microbial Communities Associated With Stable Fly (Diptera: Muscidae) Larvae and Their Developmental Substrates
Scully, E. D., Friesen, K., Wienhold, B. J., & Durso, L. M. (2016) · Annals of the Entomological Society of America · doi:10.1093/aesa/saw087 · Cited by 22
Occurrence of anthropozoonotic parasitic infections and faecal microbes in free-ranging sperm whales (Physeter macrocephalus) from the Mediterranean Sea
Hermosilla, C. R., Hirzmann, J., Silva, L. M. R., Brotons, J. M., Cerdà, M., Prenger‐Berninghoff, E., Ewers, C., & Taubert, A. (2018) · Parasitology Research · doi:10.1007/s00436-018-5942-3 · Cited by 22
Raw milk and fecal microbiota of commercial Alpine dairy cows varies with herd, fat content and diet
Albonico, F., Barelli, C., Albanese, D., Manica, M., Partel, E., Rosso, F., Ripellino, S., Pindo, M., Donati, C., Zecconi, A., et al. (2020) · PLoS ONE · doi:10.1371/journal.pone.0237262 · Cited by 23
Putative Effect of Aquifer Recharge on the Abundance and Taxonomic Composition of Endemic Microbial Communities
Smith, R. J., Paterson, J. S., Sibley, C. A., Hutson, J. L., & Mitchell, J. G. (2015) · PLoS ONE · doi:10.1371/journal.pone.0129004 · Cited by 22
“High molecular weight DNA was then sent to the Molecular Research LP (MR DNA; Texas, USA) for 16S rRNA gene based bar-coded pyrosequencing [32].”
Method
Supplementary Materials and Methods
Groenendijk, F. H., Zwart, W. T., Floore, A. N., Akbari, S., & Bernards, R. (2013) · Cited by 22
Effects of water environmental factors and antibiotics on bacterial community in urban landscape lakes
Zhang, Y., Wang, M., Cheng, W., Huang, C., Ren, J., Wan, T., & Gao, K. (2023) · Aquatic Toxicology · doi:10.1016/j.aquatox.2023.106740 · Cited by 21
Determination of adsorption and desorption of DNA molecules on freshwater and marine sediments
Xue, J., & Feng, Y. (2018) · Journal of Applied Microbiology · doi:10.1111/jam.13739 · Cited by 21
“…by faecal Journal of Applied Microbiology 124, 1480--1492 © 2018 The Society for Applied Microbiology1480 contamination in environmental waters (Bernhard and Field 2000a, 2000b; Eckburg et al. 2005; Layton et al. 2006; Dowd et al. 2008; Hattori and Taylor 2009; Durso et al. 2010; Kim et al. 2011).”
Background
Effect of Intense Exercise on the Level of Bacteroidetes and Firmicutes Phyla in the Digestive System of Thoroughbred Racehorses
Górniak, W., Cholewińska, P., Szeligowska, N., Wołoszyńska, M., Soroko, M., & Czyż, K. (2021) · Animals · doi:10.3390/ani11020290 · Cited by 22
“The reference primers were 16S universal eubacterial genes 530F (5′-GTC CCA GCM GCN GCG G) and 1100R (5′-GGG TTN CGN TCG TTG) [29], for the Firmicutes phylum these were 16S 928F-Firm (5′-TGA AAC TYA AAG GAA TTG ACG) and 1040FirmR (5′-ACC ATG CAC CAC CTG TC), and for Bacteroidetes these were 16S 798cfbF (5′-CRA ACA GGA…”
Background
Microbial community composition in the dung of five sympatric European herbivore species
Sun, X., Sitters, J., Ruytinx, J., Wassen, M. J., & Venterink, H. O. (2024) · Ecology and Evolution · doi:10.1002/ece3.11071 · Cited by 21
“…the majority of the data on gut or dung microbial communities of mammalian herbi - vores comes from captive populations associated directly with the production and livelihood of humans (Boshuizen et al., 2021; Dowd et al., 2008 ; Durso et al., 2010 ; Metcalf et al., 2017 ; Stewart et al., 2018 ).”
Background
Effects of constant or dynamic low anode potentials on microbial community development in bioelectrochemical systems
Yan, H., Yates, M. D., & Regan, J. M. (2015) · Applied Microbiology and Biotechnology · doi:10.1007/s00253-015-6907-4 · Cited by 21
“The reverse fusion primer was constructed (5 ′-3 ′) with a biotin molecule, the Roche B linker (CCTATCCCCTGTGTGCCTTGGCAGTCTCAG), and the 519R primer (GTNTTACNGCGGCKGCTG) (Dowd et al. 2008; Ishak et al. 2011; Medina et al. 2011).”
Method
The Influence of DNA Extraction Procedure and Primer Set on the Bacterial Community Analysis by Pyrosequencing of Barcoded 16S rRNA Gene Amplicons
Starke, I. C., Vahjen, W., Pieper, R., & Zentek, J. (2014) · Molecular Biology International · doi:10.1155/2014/548683 · Cited by 21
“Thus, the analysis of the microbiota in the gut of humans [23], pigs [24], and rodents [25, 26] as well as the analysis of cattle feces [27], plant viruses [28], forest soil fungi [29], soils [30, 31], hot springs [32], the atmosphere [33], sea food [34], or even human lymphocyte clonality [35] relied on”
Background
Changes to the rumen bacterial population of sheep with the addition of 2,4,6-trinitrotoluene to their diet
Perumbakkam, S., Mitchell, E. A. D., & Craig, A. M. (2010) · Antonie van Leeuwenhoek · doi:10.1007/s10482-010-9481-x · Cited by 21
“Other minor phyla include Proteobacteria, Actinobacteria, Verrucomicrobia, Fusobacteria, Fibrobacteres, TM7, and Cyanobacteria (Ley et al. 2008; Dowd et al. 2008).”
Background
Seasonal variation in an acid mine drainage microbial community
Auld, R. R., Mykytczuk, N., Leduc, L. G., & Merritt, T. J. S. (2016) · Canadian Journal of Microbiology · doi:10.1139/cjm-2016-0215 · Cited by 21
“The extracted DNA was sent to Research and Testing Laboratories (http://researchandtesting.com/) for sequencing on a Roche 454 FLX/FLX + pyrosequencing platform following a modified version of the amplicon pyrosequencing (bTEFAP) process (Dowd et al. 2008).”
Method
Effects of environmentally relevant concentrations of mixtures of TiO2, ZnO and Ag ENPs on a river bacterial community
Londono, N., Donovan, A. R., Shi, H., Geisler, M. J., & Liang, Y. (2019) · Chemosphere · doi:10.1016/j.chemosphere.2019.05.110 · Cited by 21
High-throughput metagenome analysis of the Sarcoptes scabiei internal microbiota and in-situ identification of intestinal Streptomyces sp.
Swe, P. M., Zakrzewski, M., Waddell, R., Sriprakash, K. S., & Fischer, K. (2019) · Scientific Reports · doi:10.1038/s41598-019-47892-0 · Cited by 21
Impact of acid mine drainage chemistry and microbiology on the development of efficient Fe removal activities
Sharma, S., Lee, M. J., Reinmann, C. S., Pumneo, J., Cutright, T. J., & Senko, J. M. (2020) · Chemosphere · doi:10.1016/j.chemosphere.2020.126117 · Cited by 21
Invasive willows drive instream community structure
McInerney, P., Rees, G. N., Gawne, B., SUTER, P. J., Watson, G., & Stoffels, R. J. (2016) · Freshwater Biology · doi:10.1111/fwb.12778 · Cited by 20
Influence of selected factors on the Firmicutes, Bacteroidetes phyla and the Lactobacillaceae family in the digestive tract of sheep
Cholewińska, P., Wołoszyńska, M., Michalak, M., Czyż, K., Rant, W., Smoliński, J., Wyrostek, A., & Wojnarowski, K. (2021) · Scientific Reports · doi:10.1038/s41598-021-03207-w · Cited by 22
The identification and mechanism of a Scenedesmus spp. causing bio-fouling of an oil field produced water treatment plant
Johnson, R. J., Jurawan, I., Frenzel, M., & Price, A. C. (2015) · International Biodeterioration & Biodegradation · doi:10.1016/j.ibiod.2015.05.023 · Cited by 20
Crohn’s Disease May Be Differentiated Into 2 Distinct Biotypes Based on the Detection of Bacterial Genomic Sequences and Virulence Genes Within Submucosal Tissues
Chiodini, R. J., Dowd, S. E., Davis, B. R., Galandiuk, S., Chamberlin, W., Kuenstner, J. T., McCallum, R. W., & Zhang, J. (2013) · Journal of Clinical Gastroenterology · doi:10.1097/mcg.0b013e31827b4f94 · Cited by 22
Cultivable bacterial diversity and early plant growth promotion by the traditional organic formulations prepared using organic waste materials
Anandham, R., Premalatha, N., Jee, H. J., Weon, H., Kwon, S. W., Krishnamoorthy, R., Gandhi, P. I., Kim, Y. K., & Gopal, N. O. (2015) · International Journal Of Recycling of Organic Waste in Agriculture · doi:10.1007/s40093-015-0107-1 · Cited by 20
“Values are mean ± SE of three replications, and same letters in each treatment are not significantly different from each other at P\ 0.05 according to DMRT cow dung, which includes cultivable and non-cultivable bacteria (Dowd et al. 2008).”
BackgroundInfluential
Probing the Rare Biosphere of the North-West Mediterranean Sea: An Experiment with High Sequencing Effort
Crespo, B. G., Wallhead, P., Logares, R., & Pedrós‐Alió, C. (2016) · PLoS ONE · doi:10.1371/journal.pone.0159195 · Cited by 20
Application of high-throughput pyrosequencing in the analysis of microbiota of food commodities procured from small and large retail outlets in a U.S. metropolitan area – A pilot study
Higgins, D., Pal, C., Sulaiman, I. M., Jia, C., Zerwekh, T., Dowd, S. E., & Banerjee, P. (2017) · Food Research International · doi:10.1016/j.foodres.2017.10.057 · Cited by 20
Assessment of bacterial diversity in Hyalomma aegyptium, H. marginatum and H. excavatum ticks through tag-encoded pyrosequencing
Keskin, A., Bursalı, A., Snow, D. E., Dowd, S. E., & Teki̇n, Ş. (2017) · Experimental and Applied Acarology · doi:10.1007/s10493-017-0186-y · Cited by 20
“Operational taxonomic units (OTUs) were defined after removal of singleton sequences, clustering at 3% divergence (97% similarity) (Dowd et al. 2008a, c; Capone et al. 2011).”
BackgroundMethod
Hydraulic Fracturing Fluid Compositions Induce Differential Enrichment of Soil Bacterial Communities
Lozano, T. M., McCutchan, A. L., & Krzmarzick, M. J. (2018) · Environmental Engineering Science · doi:10.1089/ees.2018.0271 · Cited by 20
“Illumina MiSeq 2 · 300 bp barcoded amplicon sequencing (Dowd et al. , 2008).”
Bacterial community structure of two Mediterranean agricultural soils amended with spent coffee grounds
Vela-Cano, M., Cervera‐Mata, A., Purswani, J., Pozo, C., Delgado, G. A., & González-López, J. (2019) · Applied Soil Ecology · doi:10.1016/j.apsoil.2019.01.006 · Cited by 20
The shape and speciation of Ag nanoparticles drive their impacts on organisms in a lotic ecosystem
Auffan, M., Santaella, C., Brousset, L., Tella, M., Morel, E., Ortet, P., Barakat, M., Chanéac, C., Issartel, J., Angeletti, B., et al. (2020) · Environmental Science Nano · doi:10.1039/d0en00442a · Cited by 20
Dynamics of Seawater Bacterial Communities in a Shellfish Hatchery
Powell, S. M., Chapman, C. C., Bermudes, M., & Tamplin, M. L. (2013) · Microbial Ecology · doi:10.1007/s00248-013-0183-6 · Cited by 20
“Tag-encoded FLX amplicon pyrosequencing of the V1 and V2 regions was carried out by Research and Testing Laboratories (Lubbock, TX) using a Roche 454 FLX instrument with titanium reagents and the primers 28F (5 ′TTTGATCNTGGCTCAG) and 519R (5 ′ GTNTTACNGCGGCKGCTG) as described in [17, 18].”
Suppression of Methane Gas Emissions and Analysis of the Electrode Microbial Community in a Sediment-Based Bio-Electrochemical System
Ueno, Y., & Kitajima, Y. (2014) · Advances in Microbiology · doi:10.4236/aim.2014.45032 · Cited by 20
“Pyrotag Sequencing of 16S rRNA Gene Amplicons PCR amplification of 16S rRNA gene fragments (V4 region) was performed using the primers ad-tag-515F (5’-CGTATCGCCTCCCTCGCGCCATCAGXXXXXX GTGCCAGCMGCCGCGGTAA-3’) and ad-806R (5’CTATGCGCCTTGCCAGCCCGCTCAG GGACTACHVGGGTWTCTAAT) [13], where the underlined sequences are adaptors…”
Method
Characterization of microbial communities in wetland mesocosms receiving caffeine-enriched wastewater
Zhang, D., Luo, J., Lee, Z. M. P., Gersberg, R. M., Liu, Y., Tan, S. K., & Ng, W. J. (2016) · Environmental Science and Pollution Research · doi:10.1007/s11356-016-6586-4 · Cited by 20
Bacteria Associated WithPiezodorus guildinii(Hemiptera: Pentatomidae), With Special Reference to Those Transmitted by Feeding
Husseneder, C., Park, J., Howells, A., Tikhe, C. V., & Davis, J. A. (2016) · Environmental Entomology · doi:10.1093/ee/nvw112 · Cited by 20
Methylmercury Production and Degradation under Light and Dark Conditions in the Water Column of the Hells Canyon Reservoirs, USA
Eckley, C. S., Luxton, T. P., Knightes, C. D., & Shah, V. (2021) · Environmental Toxicology and Chemistry · doi:10.1002/etc.5041 · Cited by 19
“and appropriate primers, Illumina miSeq protocols, sequence analysis, and pipelines were performed as described in the literature (Dowd et al. 2008; Chiodini et al. 2015; Garcia‐Mazcorro et al. 2017).”
Method
Microbiota Succession of Whole and Filleted European Sea Bass (Dicentrarchus labrax) during Storage under Aerobic and MAP Conditions via 16S rRNA Gene High-Throughput Sequencing Approach
Syropoulou, F., Anagnostopoulos, D. A., Parlapani, F. F., Karamani, E. A., Stamatiou, A., Tzokas, K., Nychas, G. E., & Boziaris, I. S. (2022) · Microorganisms · doi:10.3390/microorganisms10091870 · Cited by 19
454-Pyrosequencing Analysis of Bacterial Communities from Autotrophic Nitrogen Removal Bioreactors Utilizing Universal Primers: Effect of Annealing Temperature
González‐Martínez, A., Rodríguez–Sánchez, A., Rodelas, B., Abbas, B. A., Martinez-Toledo, M. V., van Loosdrecht, M. C. M., Osorio, F., & González-López, J. (2015) · BioMed Research International · doi:10.1155/2015/892013 · Cited by 19
“For the purposes of pyrosequencing, reverse primer 1100R was taken, following the literature that has utilized primer 530F for pyrosequencing analysis [21].”
MethodInfluential
Effects of hygienic treatments during slaughtering on microbial dynamics and contamination of sheep meat
Omer, M. K., Hauge, S. J., Østensvik, Ø., Moen, B., Alvseike, O. A., Røtterud, O.-J., Maradona, M. P., Dommersnes, S., Nesteng, O. H., & Nesbakken, T. (2014) · International Journal of Food Microbiology · doi:10.1016/j.ijfoodmicro.2014.11.002 · Cited by 19
Microbial Flora of Cochlear Implants by Gene Pyrosequencing
Antonelli, P. J., & Ojano-Dirain, C. P. (2013) · Otology & Neurotology · doi:10.1097/mao.0b013e3182941101 · Cited by 19
“Amplicon pyrosequencing (bTEFAP) was performed as previously described (10).”
BackgroundMethod
Tracking Bacteria through the Entire Gastrointestinal Tract of a Beef Steer
Durso, L. M., Miller, D. N., Schmidt, T. B., & Callaway, T. R. (2017) · Agricultural & Environmental Letters · doi:10.2134/ael2017.05.0016 · Cited by 19
“Chimeras were removed following denoising and operational taxonomic unit (OTU) generation (97%), and BLASTn was used against a curated GreenGenes database (DeSantis et al., 2006) to assign taxonomies (Dowd et al., 2008).”
Method
Correlated production and consumption of chloromethane in the Arabidopsis thaliana phyllosphere
Haque, M. F. U., Besaury, L., Nadalig, T., Bringel, F., Mutterer, J., Schaller, H., & Vuilleumier, S. (2017) · Scientific Reports · doi:10.1038/s41598-017-17421-y · Cited by 19
Daily variation of the associated microbial community and the Hsp60 expression in the Maldivian seagrass Thalassia hemprichii
Rotini, A., Conte, C., Seveso, D., Montano, S., Galli, P., Vai, M., Migliore, L., & Mejia, A. Y. (2019) · Journal of Sea Research · doi:10.1016/j.seares.2019.101835 · Cited by 19
Fecal bacterial community of finishing beef steers fed ruminally protected and non-protected active dried yeast
Ran, T., Jiao, P., AlZahal, O., Xie, X., Beauchemin, K. A., Niu, D. X., & Yang, W. Z. (2020) · Journal of Animal Science · doi:10.1093/jas/skaa058 · Cited by 19
Evaluation of Changes in the Levels of Firmicutes and Bacteroidetes Phyla of Sheep Feces Depending on the Breed
Cholewińska, P., Wołoszyńska, M., Michalak, M., Czyż, K., Rant, W., & Janczak, M. (2020) · Animals · doi:10.3390/ani10101901 · Cited by 19
“The reference genes were 16S universal eubacterial genes 530F (5′-GTC CCA GCM GCN GCG G) and 1100R (5′-GGG TTN CGN TCG TTG) [14], for the Firmicutes phylum these were 16S 928F-Firm (5′-TGA AAC TYA AAG GAA TTG ACG) and 1040FirmR (5′-ACC ATG CAC CAC CTG TC), and for Bacteroidetes these were 16S 798cfbF (5′-CRA ACA GGA T…”
Background
Comparative analysis of bacterial community-metagenomics in coastal Gulf of Mexico sediment microcosms following exposure to Macondo oil (MC252)
Koo, H., Mojib, N., THACKER, R. W., & Bej, A. K. (2014) · Antonie van Leeuwenhoek · doi:10.1007/s10482-014-0268-3 · Cited by 19
“Pyrosequencing was performed on hypervariable V3–V5 segment of the bacterial 16S rRNA gene (Dowd et al. 2008), which was first PCR amplified”
BackgroundMethod
Analysis of the microbial diversity in faecal material of the endangered blue whale, Balaenoptera musculus
Guass, O., Haapanen, L. M., Dowd, S. E., Širović, A., & McLaughlin, R. W. (2016) · Antonie van Leeuwenhoek · doi:10.1007/s10482-016-0698-1 · Cited by 19
“Pyrosequencing for bacterial and fungal organisms bTEFAP Ò was originally described by Dowd et al. (2008) and has been used to determine the bacteria present in the faecal material of a variety of animals, including cattle (Dowd et al. 2008; Callaway et al. 2010; Hristov et al. 2012), cats and dogs…”
Method
Diversity and structure of a bacterial community in grassland soils disturbed by sheep grazing, in the Loess Plateau of northwestern China.
Gou, Y., Nan, Z.-B., & Hou, F.-J. (2015) · Genetics and Molecular Research · doi:10.4238/2015.december.15.5 · Cited by 16
A novel approach to probe host-pathogen interactions of bovine digital dermatitis, a model of a complex polymicrobial infection
Marcatili, P., Nielsen, M. W., Sicheritz‐Pontén, T., Jensen, T. K., Schafer‐Nielsen, C., Boyé, M., Nielsen, M., & Schou, K. K. (2016) · BMC Genomics · doi:10.1186/s12864-016-3341-7 · Cited by 19
“At the genus level, Bacteroidetes core genes were primarily composed of the genera Alistipes, Odoribacter, Bacteroides, Cytophaga, and Porphyromonas, most of which are ubiquitously found in cattle feces [28] (Additional file 1: Figure S1).”
Background
Assessment of fecal pollution in Lake Pontchartrain, Louisiana
Xue, J., Lin, S., Lamar, F. G., Lamori, J. G., & Sherchan, S. P. (2017) · Marine Pollution Bulletin · doi:10.1016/j.marpolbul.2017.10.053 · Cited by 19
Single-chamber microbial electrochemical cell for CH4production from CO2utilizing a microbial consortium
Giang, H., Zhang, J., Zhu, Z., Suni, I. I., & Liang, Y. (2017) · International Journal of Energy Research · doi:10.1002/er.3931 · Cited by 19
“Operational taxonomic units were defined as clusters at 3% divergence (97% similarity).(27)”
Background
Metagenomics analysis reveals significant modulation of cecal microbiota of broilers fed palm kernel expeller diets
Chen, W. L., Tang, S. G. H., Jahromi, M. F., Candyrine, S. C. L., Idrus, Z., Abdullah, N., & Liang, J. B. (2018) · Poultry Science · doi:10.3382/ps/pey366 · Cited by 19
Seasonality combined with the orientation of surfaces influences the microbial community structure of biofilms in the deep Mediterranean Sea
Bellou, N., Garcia, J. A. L., Colijn, F., & Herndl, G. J. (2019) · Deep Sea Research Part II Topical Studies in Oceanography · doi:10.1016/j.dsr2.2019.104703 · Cited by 18
“Callaway TR. Wolcott RD. Sun Y. McKeehan T. Hagevoort RG. Edrington TS. 2008.”
Background
Effects of various disinfectants on the bacterial load and microbiome of broiler hatching eggs using electrostatic spray
Mohammadi-Aragh, M. K., Linhoss, J. E., & Evans, J. D. (2022) · The Journal of Applied Poultry Research · doi:10.1016/j.japr.2022.100278 · Cited by 18
Microbial community composition and dynamics in a semi-industrial-scale facility operating under the MixAlco™ bioconversion platform
Hollister, E. B., Hammett, A. J. M., Holtzapple, M. T., Gentry, T. J., & Wilkinson, H. H. (2010) · Journal of Applied Microbiology · doi:10.1111/j.1365-2672.2010.04919.x · Cited by 18
“…Clostridium-like organisms are frequently associated with mammalian gut microbial communities and the decomposition of crop residues, municipal solid waste, and other lignocellulosic materials (Chynoweth and Pullammanappallil 1996; Akasaka et al. 2003; Burrell et al. 2004; Dowd et al. 2008).”
Background
Optimization of ozonation combined with integrated fixed-film activated sludge (IFAS) in the treatment of oil sands process-affected water (OSPW)
Huang, C., Shi, Y., El‐Din, M. G., & Liu, Y. (2016) · International Biodeterioration & Biodegradation · doi:10.1016/j.ibiod.2016.04.037 · Cited by 18
CD24 blunts oral squamous cancer development and dampens the functional expansion of myeloid-derived suppressor cells
Fugle, C. W., Zhang, Y., Hong, F., Sun, S., Westwater, C., Rachidi, S., Yu, H. H., Garret-Mayer, E., Kirkwood, K. L., Liu, B., et al. (2016) · OncoImmunology · doi:10.1080/2162402x.2016.1226719 · Cited by 18
“Operational taxonomic units (OTUs) were defined after removal of singleton sequences, clustering at 3% divergence (97% similarity).(58,64) OTUs were then taxonomically classified using BLASTn against a curated Green Genes database(65) and compiled into each taxonomic level into both “counts” and “percentage” files.”
Method
Pyrosequencing based assessment of bacterial diversity in Turkish Rhipicephalus annulatus and Dermacentor marginatus ticks (Acari: Ixodidae)
Teki̇n, Ş., Dowd, S. E., Davinic, M., Bursalı, A., & Keskin, A. (2017) · Parasitology Research · doi:10.1007/s00436-017-5387-0 · Cited by 18
“These ticks were sent to a laboratory where the DNA was extracted as described by Dowd et al. (2008), and diversity analysis performed using 28F-519R primers.”
BackgroundMethod
The impact of rumen cannulation on the microbial community of goat rumens as measured using 16S rRNA high‐throughput sequencing
Wang, L., Wu, D., Yan, T., & Wang, L. (2017) · Journal of Animal Physiology and Animal Nutrition · doi:10.1111/jpn.12676 · Cited by 18
Growth, rumen fermentation and plasma metabolites of Holstein male calves fed fermented corn gluten meal during the postweaning stage
Jiang, X. P., Liu, X., Liu, S., Li, Y., Zhao, H. B., & Zhang, Y. (2019) · Animal Feed Science and Technology · doi:10.1016/j.anifeedsci.2019.01.012 · Cited by 18
Abundance and diversity of diazotrophs in the surface sediments of Kongsfjorden, an Arctic fjord
Jabir, T., Vipindas, P. V., Krishnan, K. P., & Hatha, A. A. M. (2021) · World Journal of Microbiology and Biotechnology · doi:10.1007/s11274-020-02993-1 · Cited by 18
MEAT SCIENCE AND MUSCLE BIOLOGY SYMPOSIUM: Ecological and dietary impactors of foodborne pathogens and methods to reduce fecal shedding in cattle1,2
Callaway, T. R., Edrington, T. S., & Nisbet, D. J. (2014) · Journal of Animal Science · doi:10.2527/jas.2013-7308 · Cited by 18
Resistance of Undisturbed Soil Microbiomes to Ceftriaxone Indicates Extended Spectrum β-Lactamase Activity
Gatica, J., Yang, K., Pagaling, E., Jurkevitch, É., Yan, T., & Cytryn, E. J. (2015) · Frontiers in Microbiology · doi:10.3389/fmicb.2015.01233 · Cited by 18
“DNA was extracted from the microcosm samples with the PowerSoil DNA Isolation kit (MoBio, Laboratories, Carlsbad, CA, USA) using the protocol described by the manufacturer, and amplified with the universal bacterial 16S rRNA gene primers 530F and 1100R as previously described (Dowd et al., 2008a,b).”
Method
High-throughput amplicon sequencing of fungi and microbial eukaryotes associated with the seagrass Halophila stipulacea (Forssk.) Asch. from Al-Leith mangroves, Saudi Arabia
Abdel-Wahab, M. A., Bahkali, A. H., Elgorban, A. M., & Jones, E. B. G. (2021) · Mycological Progress · doi:10.1007/s11557-021-01744-2 · Cited by 17
Characterization and Comparison of the Rumen Luminal and Epithelial Microbiome Profiles Using Metagenomic Sequencing Technique
Stockler, R. M., Hallowell, H. A., Higgins, K. V., Groover, E. S., Hiltbold, E. M., Newcomer, B. W., & Walz, P. H. (2022) · Frontiers in Veterinary Science · doi:10.3389/fvets.2022.799063 · Cited by 17
“16S rDNA Sequencing and Bioinformatic Analysis The bacterial microbiome was analyzed using 16S rRNA gene V4 variable region PCR primers 515/806 in a single-step 30 cycle PCR using a commercially available kit following a published protocol (22).”
Method
Time-dependent microbial shifts during crayfish decomposition in freshwater and sediment under different environmental conditions
Mähler, B., Janssen, K., Lönartz, M. I., Lagos, M., Geisler, T., Rust, J., & Bierbaum, G. (2023) · Scientific Reports · doi:10.1038/s41598-023-28713-x · Cited by 14
Survivability and proliferation of microorganisms in bentonite with implication to radioactive waste geological disposal: strong effect of temperature and negligible effect of pressure
Bartak, D., Bedrníková, E., Kašpar, V., Říha, J., Hlaváčková, V., Večerník, P., Šachlová, Š., & Černá, K. (2023) · World Journal of Microbiology and Biotechnology · doi:10.1007/s11274-023-03849-0 · Cited by 17
“For both PCR runs, EliZyme HS HIFI MIX polymerase (Elizabeth Pharmacon, Czech Republic) and the universal primers 515 F (Dowd et al. 2008) and 802R (Claesson et al. 2010) were used for amplification of the hypervariable V4 region of the 16S rDNA gene.”
Method
Linking Microbial Community Structure to Function in Representative Simulated Systems
Marcus, I. M., Wilder, H., Quazi, S. J., & Walker, S. L. (2013) · Applied and Environmental Microbiology · doi:10.1128/aem.03461-12 · Cited by 17
“These DNA samples were then shipped to the Research and Testing Laboratory (Lubbock, TX) for bacterial tag-encoded FLX amplicon pyrosequencing (bTEFAP) using Gray28F (5= GAGTTTGATCNTGGCTCAG) and Gray519r (5= GTNTTA CNGCGGCKGCTG) (39).”
Method
Bacterial tag encoded FLX titanium amplicon pyrosequencing (bTEFAP) based assessment of prokaryotic diversity in metagenome of Lonar soda lake, India
Dudhagara, P. R., Ghelani, A., Patel, R. K., Chaudhari, R., & Bhatt, S. (2015) · Genomics Data · doi:10.1016/j.gdata.2015.01.010 · Cited by 17
“Metagenome sequencing was done by the 16S rDNA bacterial tag-encoded FLX amplicon pyrosequencing (bTEFAP) method [19].”
Method
High Phosphate Concentrations Accelerate Bacterial Peptide Decomposition in Hypoxic Bottom Waters of the Northern Gulf of Mexico
Liu, Z., & Liu, S. (2015) · Environmental Science & Technology · doi:10.1021/acs.est.5b03039 · Cited by 18
The stable microbiome of inter and sub-tidal anemone species under increasing pCO2
Muller, E. M., Fine, M., & Ritchie, K. B. (2016) · Scientific Reports · doi:10.1038/srep37387 · Cited by 17
Ale beer containing free and immobilized Lactobacillus brevis, a potential delivery system for probiotics
Calumba, K. F., Reyes, V., Bonilla, F., Villasmil, E., & Sathivel, S. (2021) · Food Production Processing and Nutrition · doi:10.1186/s43014-021-00051-3 · Cited by 17
“Beer samples with FLB and ILB were analyzed for bacterial and fungal diversity using bacterial tag-encoded FLX amplicon pyrosequencing (bTEFAP) as described previously by Dowd et al. (2008) (MR DNA, Shallowater, TX, USA).”
MethodInfluential
In situ estimates of iron-oxidation and accretion rates for iron-oxidizing bacterial mats at Lō’ihi Seamount
Emerson, D., Scott, J. J., Leavitt, A., Fleming, E. J., & Moyer, C. L. (2017) · Deep Sea Research Part I Oceanographic Research Papers · doi:10.1016/j.dsr.2017.05.011 · Cited by 17
PCR-RFLP Detection and Genogroup Identification of Piscirickettsia salmonis in Field Samples
Aravena, P., Pulgar, R., Ortíz-Severín, J., Maza, F. R., Gaete, A., Martínez, S., Serón, E., González, M., & Cambiazo, V. (2020) · Pathogens · doi:10.3390/pathogens9050358 · Cited by 17
“The 16S rDNA raw amplicon sequences were processed and analyzed following the previously described protocols [61,62].”
Method

Authors: Dowd, S. E., Callaway, T. R., Wolcott, R. D., Sun, Y., McKeehan, T., Hagevoort, R. G., & Edrington, T. S.
Affiliations: Agricultural Research Service (US)
Corresponding author: Dowd, Scot E
ORCID: Dowd, Scot E
Callaway, Todd R
Edrington, Thomas S
Venue: BMC Microbiology
Publisher: Springer Science and Business Media LLC
Published: 2008
Volume: 8
Issue: 1
Pages: 125
ISSN: 1471-2180 (ISSN-L)
DOI: 10.1186/1471-2180-8-125
PMC: PMC2515157
OpenAlex: W2105807803
Cited by: 1,121
References: 80
Citations by year: 2026: 16 · 2025: 23 · 2024: 32 · 2023: 32 · 2022: 45 · 2021: 65 · 2020: 52 · 2019: 60 · 2018: 68 · 2017: 105 · 2016: 116 · 2015: 121 · 2014: 129 · 2013: 99 · 2012: 75
FWCI: 11.37
Type: journal article
Language: en
Open access: gold
doi.org
Licence: cc-by
Locations: BMC Microbiology (publishedVersion, cc-by)
PubMed Central (publishedVersion, cc-by)
PubMed (publishedVersion)
DOAJ (DOAJ: Directory of Open Access Journals) (submittedVersion)
Funders: U.S. Department of Agriculture
Topics: Life Sciences › Biochemistry, Genetics and Molecular Biology › Molecular Biology › Gut microbiota and health
Life Sciences › Agricultural and Biological Sciences › Animal Science and Zoology › Ruminant Nutrition and Digestive Physiology
Life Sciences › Agricultural and Biological Sciences › Animal Science and Zoology › Animal Nutrition and Physiology
Keywords: fecal microbiota, bacterial diversity, dairy cattle, Clostridium, Bacteroides, Ruminococcus, Lachnospiraceae, foodborne pathogens, Salmonella, Campylobacter, gut microbiota
MeSH terms: Animals, Bacteria, Cattle, DNA, Bacterial, DNA, Ribosomal, Feces, Female, RNA, Ribosomal, 16S, Polymerase Chain Reaction, Sequence Analysis, DNA, Gastrointestinal Tract, Biodiversity

About these checks

Registry, retraction, Cites and statistics results are computed, not judged, with one exception: a printed reference that no index lists is read once by a model before it counts as a citation error. Claims are extracted by a model and kept only when their quote appears verbatim in the text; each cited source is then checked, with a model’s help, for whether it says what the claim relies on. Those verdicts can be wrong — read the claim’s quote and the cited source before relying on one.

Statistics and arithmetic are recomputed, not judged.

Confidence bands are shown only for fields calibrated on our annotated test set. None is calibrated yet, so no band is shown.

What counts as a claim ›How we measure confidence ›How we check this ›

Are you an author, or do you see a problem with this page? Request a review

Evaluation of the bacterial diversity in the feces of cattle using 16S rDNA bacterial tag-encoded FLX amplicon pyrosequencing (bTEFAP)

Abstract

Overview

Integrity signals

Verification

Claims the paper makes

Claims other papers make about this one

Self-check

Citations

Cites

Cited by

Related

Metadata

Record

About these checks