Cited by 1,121Gut microbiota and healthRuminant Nutrition and Digestive PhysiologyAnimal Nutrition and Physiology

The DOI matches its Crossref record; 82 of the 82 references it cites were found in a registry or an index.

Evaluation of the bacterial diversity in the feces of cattle using 16S rDNA bacterial tag-encoded FLX amplicon pyrosequencing (bTEFAP)

Open access

Dowd, Scot E, Callaway, Todd R, Wolcott, Randall D, Sun, Yan, McKeehan, Trevor, Hagevoort, Robert G, Edrington, Thomas S·2008·BMC Microbiology

DOI 10.1186/1471-2180-8-125PMC PMC2515157

Open this paper in CoChat — free account Open PDF

Abstract

BACKGROUND: The microbiota of an animal's intestinal tract plays important roles in the animal's overall health, productivity and well-being. There is still a scarcity of information on the microbial diversity in the gut of livestock species such as cattle. The primary reason for this lack of data relates to the expense of methods needed to generate such data. Here we have utilized a bacterial tag-encoded FLX 16s rDNA amplicon pyrosequencing (bTEFAP) approach that is able to perform diversity analyses of gastrointestinal populations. bTEFAP is relatively inexpensive in terms of both time and labor due to the implementation of a novel tag priming method and an efficient bioinformatics pipeline. We have evaluated the microbiome from the feces of 20 commercial, lactating dairy cows. RESULTS: Ubiquitous bacteria detected from the cattle feces included Clostridium, Bacteroides, Porpyhyromonas, Ruminococcus, Alistipes, Lachnospiraceae, Prevotella, Lachnospira, Enterococcus, Oscillospira, Cytophage, Anaerotruncus, and Acidaminococcus spp. Foodborne pathogenic bacteria were detected in several of the cattle, a total of 4 cows were found to be positive for Salmonella spp (tentative enterica) and 6 cows were positive for Campylobacter spp. (tentative lanienae). CONCLUSION: Using bTEFAP we have examined the microbiota in the feces of cattle. As these methods continue to mature we will better understand the ecology of the major populations of bacteria the lower intestinal tract. This in turn will allow for a better understanding of ways in which the intestinal microbiome contributes to animal health, productivity and wellbeing.

The claims and statistics of this paper haven’t been checked yet.

Run the check — free, no account needed. It reads the open-access text and checks the sources it cites.

Integrity signals

Registry

Crossref · 10.1186/1471-2180-8-125

Cites

82 of 82 references verified0 citation errors · 0 not checkable

Statistics

Claims the paper makes

The claims and statistics of this paper haven’t been checked yet.

Run the check — free, no account needed. It reads the open-access text and checks the sources it cites.

Claims other papers make about this one

Each is checked against this paper’s own text: does it say what the citing paper says it does?

Self-check

Percentages, sums and reported differences re-computed from the paper’s own numbers.

The self-check needs the paper’s full text.

Basic local alignment search tool
Altschul, S. F., Gish, W., Miller, W., Myers, E. W., & Lipman, D. J. (1990) · Journal of Molecular Biology · doi:10.1006/jmbi.1990.9999 · Cited by 98,669 · cited 2×
“The resulting TC FASTA for each sample was then evaluated using BLASTn [77] against a custom database derived from the RDP-II database [78] and GenBank http://ncbi.”
Method
An obesity-associated gut microbiome with increased capacity for energy harvest
Turnbaugh, P. J., Ley, R. E., Mahowald, M. A., Magrini, V., Mardis, E. R., & Gordon, J. I. (2006) · Nature · doi:10.1038/nature05414 · Cited by 12,444 · cited 1×
“Results and Discussion Recent research related to host physiology (obesity) and the gastrointestinal bacterial populations have sparked a renewed interest in understanding the gut microbiome [26,27].”
Background
Human gut microbes associated with obesity
Ley, R. E., Turnbaugh, P. J., Klein, S., & Gordon, J. I. (2006) · Nature · doi:10.1038/4441022a · Cited by 8,785 · cited 1×
“Results and Discussion Recent research related to host physiology (obesity) and the gastrointestinal bacterial populations have sparked a renewed interest in understanding the gut microbiome [26,27].”
Background
Diversity of the Human Intestinal Microbial Flora
Eckburg, P. B., Bik, E. M., Bernstein, C. N., Purdom, E., Dethlefsen, L., Sargent, M., Gill, S. R., Nelson, K. E., & Relman, D. A. (2005) · Science · doi:10.1126/science.1110591 · Cited by 7,913 · cited 1×
“Information on microbial diversity within the gastrointestinal tract of humans has increased in recent years as a result of 16S rDNA-based analyses [9,10], yet similar data on the microbiomes of livestock is lacking [11,12].”
Background
Food-Related Illness and Death in the United States
Mead, P. S., Slutsker, L., DIETZ, V. J., McCaig, L. F., Bresee, J., Shapiro, C. A., Griffin, P. M., & Tauxe, R. V. (1999) · Emerging infectious diseases · doi:10.3201/eid0505.990502 · Cited by 7,305
CAP3: A DNA Sequence Assembly Program
Huang, X., & Madan, A. (1999) · Genome Research · doi:10.1101/gr.9.9.868 · Cited by 5,261 · cited 3×
“The ace files generated by CAP3 were then processed to generate a secondary FASTA file containing the tentative consensus (TC) sequences of the assembly along with the number of reads integrated into each consensus.”
MethodInfluential
Ecological and Evolutionary Forces Shaping Microbial Diversity in the Human Intestine
Ley, R. E., Peterson, D. A., & Gordon, J. I. (2006) · Cell · doi:10.1016/j.cell.2006.02.017 · Cited by 3,358 · cited 1×
“Information on microbial diversity within the gastrointestinal tract of humans has increased in recent years as a result of 16S rDNA-based analyses [9,10], yet similar data on the microbiomes of livestock is lacking [11,12].”
Background
The Rumen and Its Microbes
Hungate, R. E. (2013) · Elsevier eBooks · doi:10.1016/c2013-0-12555-x · Cited by 3,060
Bacteroides : the Good, the Bad, and the Nitty-Gritty
Wexler, H. M. (2007) · Clinical Microbiology Reviews · doi:10.1128/cmr.00008-07 · Cited by 2,388
Determination of microbial diversity in environmental samples: pitfalls of PCR-based rRNA analysis
von Wintzingerode, F., Göbel, U. B., & Stackebrandt, E. S. (1997) · FEMS Microbiology Reviews · doi:10.1111/j.1574-6976.1997.tb00351.x · Cited by 2,085

Show all 80 references

Sorted by citations

Items 101–200 of 1,000

Insights into the bovine rumen plasmidome
Kav, A. B., Sasson, G., Jami, E., Doron‐Faigenboim, A., Benhar, I., & Mizrahi, I. (2012) · Proceedings of the National Academy of Sciences · doi:10.1073/pnas.1116410109 · Cited by 150
“The tagging and sequencing protocol was as described previously (62).”
Method
A bacterial filter protects and structures the gut microbiome of an insect
Lanan, M., Rodrigues, P. A. P., Agellon, A. B., Jansma, P. L., & Wheeler, D. E. (2016) · The ISME Journal · doi:10.1038/ismej.2015.264 · Cited by 147
“DNA was sent to Research and Testing Laboratories, Lubbock, TX, USA for Roche 454 FLXTitanium pyrosequencing (Roche Applied Science, Indianapolis, IN, USA), using the 28F-519R bacterial assay for the V1-V3 variable regions of the16S rDNA gene (Dowd et al., 2008).”
Method
Microbial Dysbiosis in Pediatric Patients with Crohn's Disease
Kaakoush, N. O., Day, A. S., Huinao, K. D., Leach, S. T., Lemberg, D. A., Dowd, S. E., & Mitchell, H. M. (2012) · Journal of Clinical Microbiology · doi:10.1128/jcm.01396-12 · Cited by 147
Bacterial diversity in surgical site infections: not just aerobic cocci any more
Wolcott, R. D., Gontcharova, V., Sun, Y., Zischakau, A., & Dowd, S. E. (2009) · Journal of Wound Care · doi:10.12968/jowc.2009.18.8.43630 · Cited by 146
Composition and Seasonal Variation of Rhipicephalus turanicus and Rhipicephalus sanguineus Bacterial Communities
Lalzar, I., Harrus, S., Mumcuoğlu, K. Y., & Gottlieb, Y. (2012) · Applied and Environmental Microbiology · doi:10.1128/aem.00323-12 · Cited by 146
How different is the composition of the fouling layer of wastewater reuse and seawater desalination RO membranes?
Khan, M. T., Busch, M., Molina, V. G., Emwas, A.-H. M., Aubry, C., & Croué, J. (2014) · Water Research · doi:10.1016/j.watres.2014.04.020 · Cited by 144
Host-specific adaptation governs the interaction of the marine diatom, Pseudo-nitzschia and their microbiota
Sison-Mangus, M. P., Jiang, S. C., Tran, K. N., & Kudela, R. M. (2013) · The ISME Journal · doi:10.1038/ismej.2013.138 · Cited by 149
“Bacterial DNA extraction and 16S rDNA pyrosequencing were carried out using the protocol described in Dowd et al. (2008) and Sun et al. (2011) (see Supplementary Information).”
Method
Host signature effect on plant root‐associated microbiomes revealed through analyses of resident vs . active communities
Ofek, M., Goldman-Voronov, M., Hadar, Y., & Minz, D. (2013) · Environmental Microbiology · doi:10.1111/1462-2920.12228 · Cited by 140
Performance and bacterial community dynamics of a CANON bioreactor acclimated from high to low operational temperatures
González‐Martínez, A., Rodríguez–Sánchez, A., García-Ruiz, M. J., Muñoz-Palazón, B., Cortés-Lorenzo, C., Osorio, F., & Vahala, R. (2015) · Chemical Engineering Journal · doi:10.1016/j.cej.2015.11.081 · Cited by 141
An Insight Into the Microbiome of theAmblyomma maculatum(Acari: Ixodidae)
Budachetri, K., Browning, R. E., Adamson, S. W., Dowd, S. E., Chao, C., Ching, W., & Karim, S. (2014) · Journal of Medical Entomology · doi:10.1603/me12223 · Cited by 137
“DNA from Þeld collected and laboratory colony-raised tick tissues was used for bacterial tag-encoded titanium amplicon pyrosequencing (bTETAP; Dowd et al. 2008a,b).”
BackgroundMethod
Deep metagenome and metatranscriptome analyses of microbial communities affiliated with an industrial biogas fermenter, a cow rumen, and elephant feces reveal major differences in carbohydrate hydrolysis strategies
Güllert, S., Fischer, M. A., Turaev, D., Noebauer, B., Ilmberger, N., Wemheuer, B., Alawi, M., Rattei, T., Daniel, R., Schmitz, R. A., et al. (2016) · Biotechnology for Biofuels · doi:10.1186/s13068-016-0534-x · Cited by 144
“Within this framework, it is noteworthy that our fermenter was also fed with cow manure and chicken manure that both contain high levels of the Bacteroidetes [59, 60].”
Background
Dietary differences are reflected on the gut prokaryotic community structure of wild and commercially reared sea bream (Sparus aurata)
Kormas, K. A., Meziti, A., Mente, E., & Frentzos, A. (2014) · MicrobiologyOpen · doi:10.1002/mbo3.202 · Cited by 147
“Samples of wild fish of similar weights were taken for comparisons.”
BackgroundMethod
Evaluation of the bacterial diversity of Pressure ulcers using bTEFAP pyrosequencing
Smith, D. M., Snow, D. E., Rees, E., Zischkau, A. M., Hanson, J. D., Wolcott, R. D., Sun, Y., White, J. S., G, S. K. C., & Dowd, S. E. (2010) · BMC Medical Genomics · doi:10.1186/1755-8794-3-41 · Cited by 141
“Sequences were depleted of any non-bacterial ribosome sequences and definite chimeras using custom software described previously [53] and the Black Box Chimera Check software B2C2 (described and freely available at http://www.”
The Potential of Class II Bacteriocins to Modify Gut Microbiota to Improve Host Health
Umu, Ö. C. O., Bäuerl, C., Oostindjer, M., Pope, P. B., Hernández, P. E., Pérez‐Martínez, G., & Diep, D. B. (2016) · PLoS ONE · doi:10.1371/journal.pone.0164036 · Cited by 144
Bacterial Community Structure Along Moisture Gradients in the Parafluvial Sediments of Two Ephemeral Desert Streams
Zeglin, L. H., Dahm, C. N., Barrett, J., Gooseff, M. N., Fitpatrick, S. K., & Takacs‐Vesbach, C. D. (2010) · Microbial Ecology · doi:10.1007/s00248-010-9782-7 · Cited by 135
“We also produced 3,000 200bp 454 FLX 16S rRNA gene sequences (V1–V3 region [22]) for amplicons produced using each reverse primer from genomic DNA from one Lower Onyx River and one Rio Salado sample to ascertain that data acquired using different primers were in fact comparable.”
Method
Key determinants of the fungal and bacterial microbiomes in homes
Kettleson, E. M., Adhikari, A., Vesper, S. J., Coombs, K., Indugula, R., & Reponen, T. A. (2015) · Environmental Research · doi:10.1016/j.envres.2015.02.003 · Cited by 135
Faecal microbiota in lean and obese dogs
Handl, S., German, A. J., Holden, S. L., Dowd, S. E., Steiner, J. M., Heilmann, R. M., Grant, R. W., Swanson, K. S., & Suchodolski, J. S. (2013) · FEMS Microbiology Ecology · doi:10.1111/1574-6941.12067 · Cited by 137
A Survey of Bacterial Diversity From Successive Life Stages of Black Soldier Fly (Diptera: Stratiomyidae) by Using 16S rDNA Pyrosequencing
Zheng, L., Crippen, T. L., Singh, B., Tarone, A. M., Dowd, S. E., Yu, Z., Wood, T. K., & Tomberlin, J. K. (2013) · Journal of Medical Entomology · doi:10.1603/me12199 · Cited by 140
Pyrosequencing Analysis of the Apical Root Canal Microbiota
Siqueira, J. F., Jr., Alves, F. R. F., & Rôças, I. N. (2011) · Journal of Endodontics · doi:10.1016/j.joen.2011.08.012 · Cited by 135
“Bacterial tag-encoded FLX-titanium amplicon pyrosequencing was performed by using primers 28f and 519r as described elsewhere (11, 15, 16).”
Method
Vaginal Microbiome Characterization of Nellore Cattle Using Metagenomic Analysis
Laguardia-Nascimento, M., Branco, K. M. G. R., Gasparini, M. R., Giannattasio-Ferraz, S., Leite, L. R., Araújo, F. M. G., Salim, A. C. M., Nicoli, J. R., Oliveira, G., & Barbosa‐Stancioli, E. F. (2015) · PLoS ONE · doi:10.1371/journal.pone.0143294 · Cited by 134
“Eight OTUs have been found in some portion of bovine GIT or feces: Bacteroides [19,20,26,27], Clostridium [21,26–28], Ruminococcus [26,27,29], Rikenella [30], Alistipes [26], Bacillus [31], Eubacterium [27,31,32] and Prevotella [12,21,26,27].”
Background
Spatial variability of particle-attached and free-living bacterial diversity in surface waters from the Mackenzie River to the Beaufort Sea (Canadian Arctic)
Ortega‐Retuerta, E., Joux, F., Jeffrey, W. H., & Ghiglione, J. (2013) · Biogeosciences · doi:10.5194/bg-10-2747-2013 · Cited by 133
“4 Bacterial diversity by pyrosequencing Bacterial tag-encoded FLX amplicon pyrosequencing (bTEFAP) was performed as described previously using Gray28F (5′TTTGATCNTGGCTCAG) and Gray519r 5 (5′GTNTTACNGCGGCKGCTG) (Dowd et al., 2008) amplifying 400 bp of the V6 region of the 16S rRNA gene.”
Method
Effect of Origanum vulgare L. leaves on rumen fermentation, production, and milk fatty acid composition in lactating dairy cows
Hristov, A. N., Lee, C., Cassidy, T. W., Heyler, K. S., Tekippe, J., Varga, G. A., Corl, B. A., & Brandt, R. C. (2012) · Journal of Dairy Science · doi:10.3168/jds.2012-5975 · Cited by 130
Chemolithotrophy in the continental deep subsurface: Sanford Underground Research Facility (SURF), USA
Osburn, M. R., LaRowe, D. E., Momper, L., & Amend, J. P. (2014) · Frontiers in Microbiology · doi:10.3389/fmicb.2014.00610 · Cited by 128
“Primers 515 forward and 806 reverse (Caporaso et al., 2011) were used to amplify the hypervariable 4 region of the 16S rDNA gene according to previously described methods (Dowd et al., 2008).”
Method
Sequence-based methods for detecting and evaluating the human gut mycobiome
Haute, M. J. S. V., Banjara, N., & Hallen‐Adams, H. E. (2015) · Letters in Applied Microbiology · doi:10.1111/lam.12539 · Cited by 131
“ITS PCR reactions were performed as described above and samples were sequenced by MR DNA (Shallowater, TX) using tag-encoded FLX amplicon pyrosequencing on 454/Roche GS FLX Sequencer technology (Dowd et al. 2008; Sun et al. 2011).”
Surveying the Microbiome of Ants: Comparing 454 Pyrosequencing with Traditional Methods To Uncover Bacterial Diversity
Kautz, S., Rubin, B. E. R., Russell, J. A., & Moreau, C. S. (2012) · Applied and Environmental Microbiology · doi:10.1128/aem.03107-12 · Cited by 128
“coli is often used as a marker for fecal contamination using cultivation methods but usually comprises less than 1% of the fecal bacterial community (34).”
Method
Performance Characteristics of qPCR Assays Targeting Human- and Ruminant-AssociatedBacteroidetesfor Microbial Source Tracking across Sixteen Countries on Six Continents
Reischer, G. H., Ebdon, J., Bauer, J. M., Schuster, N., Ahmed, W., Åström, J., Blanch, A. R., Blöschl, G., Byamukama, D., Coakley, T., et al. (2013) · Environmental Science & Technology · doi:10.1021/es304367t · Cited by 124
Diversity of the spinach ( Spinacia oleracea ) spermosphere and phyllosphere bacterial communities
López‐Velasco, G., Carder, P. A., Welbaum, G. E., & Ponder, M. A. (2013) · FEMS Microbiology Letters · doi:10.1111/1574-6968.12216 · Cited by 123
“, 2007), intestinal tracts of humans and animals (Dowd et al., 2008), soils (Roesch et al.”
Background
Genomics, evolution, and molecular epidemiology of the Streptococcus bovis / Streptococcus equinus complex (SBSEC)
Jans, C., Meile, L., Lacroix, C., & Stevens, M. J. A. (2014) · Infection Genetics and Evolution · doi:10.1016/j.meegid.2014.09.017 · Cited by 126
Soil Suppressiveness to Fusarium Disease: Shifts in Root Microbiome Associated with Reduction of Pathogen Root Colonization
Klein, E., Ofek, M., Katan, J., Minz, D., & Gamliel, A. (2012) · Phytopathology · doi:10.1094/phyto-12-11-0349 · Cited by 125
Use of Barcoded Pyrosequencing and Shared OTUs To Determine Sources of Fecal Bacteria in Watersheds
Unno, T., Jang, J., Han, D., Kim, J. H., Sadowsky, M. J., Kim, O.-S., Chun, J., & Hur, H.-G. (2010) · Environmental Science & Technology · doi:10.1021/es101500z · Cited by 118
Rational consideration of Akkermansia muciniphila targeting intestinal health: advantages and challenges
Luo, Y., Lan, C., Li, H., Ouyang, Q., Kong, F., Wu, A., Ren, Z., Tian, G., Cai, J., Yu, B., et al. (2022) · npj Biofilms and Microbiomes · doi:10.1038/s41522-022-00338-4 · Cited by 130
Complete chloroform dechlorination by organochlorine respiration and fermentation
Lee, M. J., Low, A., Zemb, O., Koenig, J. C., Michaelsen, A., & Manefield, M. (2011) · Environmental Microbiology · doi:10.1111/j.1462-2920.2011.02656.x · Cited by 119
Effects of fertilization with urban and agricultural organic wastes in a field trial – Prokaryotic diversity investigated by pyrosequencing
Poulsen, P. H. B., Al‐Soud, W. A., Bergmark, L., Magid, J., Hansen, L. H., & Sørensen, S. J. (2012) · Soil Biology and Biochemistry · doi:10.1016/j.soilbio.2011.12.023 · Cited by 124
Wastewater-Enhanced Microbial Corrosion of Concrete Sewers
Jiang, G., Zhou, M., Chiu, T. H., Sun, X., Keller, J., & Bond, P. L. (2016) · Environmental Science & Technology · doi:10.1021/acs.est.6b02093 · Cited by 119
Potential Environmental Factors Affecting Oil-Degrading Bacterial Populations in Deep and Surface Waters of the Northern Gulf of Mexico
Liu, J., Bacosa, H. P., & Liu, Z. (2017) · Frontiers in Microbiology · doi:10.3389/fmicb.2016.02131 · Cited by 118
Phylogenetic, Metabolic, and Taxonomic Diversities Shape Mediterranean Fruit Fly Microbiotas during Ontogeny
Aharon, Y., Pasternak, Z., Ben‐Yosef, M., Behar, A., Lauzon, C. R., Yuval, B., & Jurkevitch, É. (2012) · Applied and Environmental Microbiology · doi:10.1128/aem.02761-12 · Cited by 117
Differences in soil micro‐eukaryotic communities over soil pH gradients are strongly driven by parasites and saprotrophs
Cunha-Dupont, A. Ö., Griffiths, R. I., Bell, T., & Bass, D. (2016) · Environmental Microbiology · doi:10.1111/1462-2920.13220 · Cited by 117
Comparative Metagenomic Analysis of Soil Microbial Communities across Three Hexachlorocyclohexane Contamination Levels
Sangwan, N., Lata, P., Dwivedi, V., Singh, A. K., Niharika, N., Kaur, J., Anand, S., Malhotra, J., Jindal, S., Nigam, A., et al. (2012) · PLoS ONE · doi:10.1371/journal.pone.0046219 · Cited by 117
“Microbial Diversity Estimation In our first taxonomic approach we performed 16S rRNA amplicon pyrosequencing (TEFAP, Tag-Encoded FLX Amplicon Pyrosequencing) for each composite genetic pool using kingdom specific primers (Table S1) targeted at the conserved domains of the rRNA genes [16].”
MethodInfluential
Prospective randomized controlled study on the effects of Saccharomyces boulardii CNCM I-745 and amoxicillin-clavulanate or the combination on the gut microbiota of healthy volunteers
Kabbani, T. A., Pallav, K., Dowd, S. E., Villafuerte-Galvez, J., Vanga, R. R., Castillo, N. E., Hansen, J., Dennis, M., Leffler, D. A., & Kelly, C. P. (2017) · Gut Microbes · doi:10.1080/19490976.2016.1267890 · Cited by 115
Virulence-associated and antibiotic resistance genes of microbial populations in cattle feces analyzed using a metagenomic approach
Durso, L. M., Harhay, G. P., Bono, J. L., & Smith, T. P. L. (2010) · Journal of Microbiological Methods · doi:10.1016/j.mimet.2010.12.008 · Cited by 116
“The bovine fecal microbiota has been characterized using both culture-based and culture-independent methods (Dowd et al., 2008; Durso et al., 2010; McGarvey et al., 2005; Wilssens and Buttiaux, 1958; Wu et al., 2007).”
Method
Core fecal microbiota of domesticated herbivorous ruminant, hindgut fermenters, and monogastric animals
Donnell, M. M. O., Harris, H. M. B., Ross, R. P., & O’Toole, P. W. (2017) · MicrobiologyOpen · doi:10.1002/mbo3.509 · Cited by 118
“Important plant polysaccharide-associated degrading bacteria include Ruminococcus , Prevotella , Butyrivibrio, and Alistipes (Dowd et al., 2008; Kim, Morrison, & Yu, 2011) all of which were identified in this study.”
Multifaceted Plant-Associated Microbes and Their Mechanisms Diminish the Concept of Direct and Indirect PGPRs
Arora, N. K., Tewari, S., & Singh, R. (2013) · Springer eBooks · doi:10.1007/978-81-322-1287-4_16 · Cited by 117
The interplay between Campylobacter and Helicobacter species and other gastrointestinal microbiota of commercial broiler chickens
Kaakoush, N. O., Sodhi, N., Chenu, J. W., Cox, J. M., Riordan, S. M., & Mitchell, H. M. (2014) · Gut Pathogens · doi:10.1186/1757-4749-6-18 · Cited by 114
“Operational taxonomic units (OTU) were defined after removal of singleton sequences (sequences appearing only once in the whole dataset) with clustering set at 3% divergence (97% similarity) [38-42].”
BackgroundMethod
Effect of ciprofloxacin antibiotic on the partial-nitritation process and bacterial community structure of a submerged biofilter
González‐Martínez, A., Rodríguez–Sánchez, A., Martinez-Toledo, M. V., García-Ruiz, M. J., Hontoria, E., Osorio, F., & González-López, J. (2014) · The Science of The Total Environment · doi:10.1016/j.scitotenv.2014.01.012 · Cited by 114
Exploring Microbial Diversity Using 16S rRNA High-Throughput Methods
Armougom, F. (2009) · Journal of Computer Science & Systems Biology · doi:10.4172/jcsb.1000019 · Cited by 124
Relationship between the Rumen Microbiome and Residual Feed Intake-Efficiency of Brahman Bulls Stocked on Bermudagrass Pastures
McCann, J. C., Wiley, L. M., Forbes, T. D. A., Rouquette, F. M., Jr., & Tedeschi, L. O. (2014) · PLoS ONE · doi:10.1371/journal.pone.0091864 · Cited by 122
Characterization of the microbial communities along the gastrointestinal tract of sheep by 454 pyrosequencing analysis
Wang, J., Fan, H., Han, Y., Zhao, J., & Zhou, Z. (2016) · Asian-Australasian Journal of Animal Sciences · doi:10.5713/ajas.16.0166 · Cited by 113
“Rumen contents and feces in ruminants are often used to assess gastrointestinal microbiota [2,3], however, these sections do not represent the composition and diversity of microbiota in the entire gastrointestinal tract.”
Background
Effect of Exclusive Enteral Nutrition on the Microbiota of Children With Newly Diagnosed Crohn's Disease
Kaakoush, N. O., Day, A. S., Leach, S. T., Lemberg, D. A., Nielsen, S. J., & Mitchell, H. M. (2015) · Clinical and Translational Gastroenterology · doi:10.1038/ctg.2014.21 · Cited by 113
Effects of dietary forage to concentrate ratio on nutrient digestibility, ruminal fermentation and rumen bacterial composition in Angus cows
Chen, H., Wang, C., Simujide, H., & Chen, A. (2021) · Scientific Reports · doi:10.1038/s41598-021-96580-5 · Cited by 133
Influence of anode surface chemistry on microbial fuel cell operation
Santoro, C., Babanova, S., Artyushkova, K., Cornejo, J. A., Ista, L. K., Bretschger, O., Marsili, E., Atanassov, P. B., & Schuler, A. J. (2015) · Bioelectrochemistry · doi:10.1016/j.bioelechem.2015.05.002 · Cited by 112
“Bacterial tag-encoded FLX amplicon pyrosequencing was performed as described previously [33] with small modifications to utilize the titanium sequencing platform (Roche Applied Science, Indianapolis, IN).”
Method
Pyrosequencing reveals diverse fecal microbiota in Simmental calves during early development
Klein-Jöbstl, D., Schornsteiner, E., Mann, E., Wagner, M., Drillich, M., & Schmitz‐Esser, S. (2014) · Frontiers in Microbiology · doi:10.3389/fmicb.2014.00622 · Cited by 119
“Recent studies analyzing cattle microbiota almost exclusively focused on the Holstein-Friesian breed (Dowd et al., 2008; Patton et al., 2009; McGarvey et al., 2010; Uyeno et al., 2010; Oikonomou et al., 2013; Malmuthuge et al., 2014).”
Background
Comparison of Rumen and Manure Microbiomes and Implications for the Inoculation of Anaerobic Digesters
Ozbayram, E. G., İnce, O., Ince, B. K., Harms, H., & Kleinsteuber, S. (2018) · Microorganisms · doi:10.3390/microorganisms6010015 · Cited by 118
Cowpea aphid ( Aphis craccivora ) associated with different host plants has different facultative endosymbionts
Brady, C. M., & White, J. A. (2013) · Ecological Entomology · doi:10.1111/een.12020 · Cited by 111
Low Acetate Concentrations Favor Polyphosphate-Accumulating Organisms over Glycogen-Accumulating Organisms in Enhanced Biological Phosphorus Removal from Wastewater
Tu, Y., & Schuler, A. J. (2013) · Environmental Science & Technology · doi:10.1021/es304846s · Cited by 111
Bacteria Mediate Oviposition by the Black Soldier Fly, Hermetia illucens (L.), (Diptera: Stratiomyidae)
Zheng, L., Crippen, T. L., Holmes, L., Singh, B., Pimsler, M. L., Benbow, M. E., Tarone, A. M., Dowd, S., Yu, Z., Vanlaerhoven, S. L., et al. (2013) · Scientific Reports · doi:10.1038/srep02563 · Cited by 110
Self-citation
Kinetic modeling and microbiological study of two-step nitrification in a membrane bioreactor and hybrid moving bed biofilm reactor–membrane bioreactor for wastewater treatment
Leyva‐Díaz, J. C., González‐Martínez, A., González-López, J., Muñío, M. D. M., & Poyatos, J. M. (2014) · Chemical Engineering Journal · doi:10.1016/j.cej.2014.07.136 · Cited by 108
Comparison of bacterial communities of conventional and A-stage activated sludge systems
González‐Martínez, A., Rodríguez–Sánchez, A., Lotti, T., García-Ruiz, M. J., Osorio, F., González-López, J., & van Loosdrecht, M. C. M. (2016) · Scientific Reports · doi:10.1038/srep18786 · Cited by 108
A metagenomic assessment of the bacteria associated with Lucilia sericata and Lucilia cuprina (Diptera: Calliphoridae)
Singh, B., Crippen, T. L., Zheng, L., Fields, A. T., Yu, Z., Ma, Q., Wood, T. K., Dowd, S. E., Flores, M., Tomberlin, J. K., et al. (2014) · Applied Microbiology and Biotechnology · doi:10.1007/s00253-014-6115-7 · Cited by 109
“…for 16S rDNA 454 pyrosequencing using universal bacterial primer pair 27F (5′-GAGTTTGATCNTGGCTCAG) and 519R (5′-GTNTTACNGCGGCKGCTG) by bacterial tagencoded FLX-Titanium pyrosequencing (bTEFAP) method (Dowd et al. 2008) in Genome Sequencer FLX System (Roche, Nutley, NJ, USA).”
Method
Ecological succession among iron-oxidizing bacteria
Fleming, E. J., Cetinić, I., Chan, C. S., King, D. W., & Emerson, D. (2013) · The ISME Journal · doi:10.1038/ismej.2013.197 · Cited by 113
“4–100 ng ml"1) were sent for tagged pyrosequencing of the V4–V6 region to the Research and Testing Laboratory (Lubbock, TX, USA), and processed as described in Dowd et al. (2008). Samples were sequenced on a Roche 454 FLX system with Titanium Chemistry (Roche, Nutley, NJ, USA) using tags, barcodes and primers listed i…”
MethodInfluential
Rumen fermentation and production effects of Origanum vulgare L. leaves in lactating dairy cows
Tekippe, J., Hristov, A. N., Heyler, K. S., Cassidy, T. W., Zheljazkov, V. D., Ferreira, J., Karnati, S. K. R., & Varga, G. A. (2011) · Journal of Dairy Science · doi:10.3168/jds.2010-4095 · Cited by 110
Nutrient supplementation of pinewood biochar for use as a bacterial inoculum carrier
Sun, D., Hale, L. E., & Crowley, D. E. (2016) · Biology and Fertility of Soils · doi:10.1007/s00374-016-1093-9 · Cited by 107
“The remaining sequences were denoised, and operational taxonomic units (OTUs) were defined by clustering at 3 % divergence (97 % similarity) followed by the removal of singleton sequences and chimeras (Dowd et al. 2008).”
Method
Bacterial Communities Associated with Houseflies (Musca domestica L.) Sampled within and between Farms
Bahrndorff, S., de Jonge, N., Skovgård, H., & Nielsen, J. L. (2017) · PLoS ONE · doi:10.1371/journal.pone.0169753 · Cited by 108
Spatial and temporal dynamics of microbial community composition and factors influencing the surface water and sediments of urban rivers
Wang, H., Liu, X., Wang, Y., Zhang, S., Zhang, G., Han, Y., Li, M., & Liu, L. (2022) · Journal of Environmental Sciences · doi:10.1016/j.jes.2021.10.016 · Cited by 106
Comparative Metagenomics of Anode-Associated Microbiomes Developed in Rice Paddy-Field Microbial Fuel Cells
Kouzuma, A., Kasai, T., Nakagawa, G., Yamamuro, A., Abe, T., & Watanabe, K. (2013) · PLoS ONE · doi:10.1371/journal.pone.0077443 · Cited by 106
“PCR amplification of 16S rRNA gene fragments (V1-V3 region) was performed using primers ad-tag-8F (5’CGTATCGCCTCCCTCGCGCCATCAGXXXXXXGAGTTTGAT CMTGGCTCAG-3’) and ad-533R (5’CTATGCGCCTTGCCAGCCCGCTCAGTTACCGCKRCTGCT GRCAC) [13], in which the underlined sequences were adaptors added for pyrosequencing and XXXXXX was an arb…”
Method
Prokaryotic and Eukaryotic Diversity of the Human Gut
Marchesi, J. R. (2010) · Advances in applied microbiology · doi:10.1016/s0065-2164(10)72002-5 · Cited by 113
Tag-Encoded FLX Amplicon Pyrosequencing for the Elucidation of Microbial and Functional Gene Diversity in Any Environment
Sun, Y., Wolcott, R. D., & Dowd, S. E. (2011) · Methods in molecular biology · doi:10.1007/978-1-61779-089-8_9 · Cited by 104
The Oral Microbiome in Periodontal Health
Lenartova, M., Tesinska, B., Janatova, T., Hrebicek, O., Myšák, J., Janata, J., & Najmanová, L. (2021) · Frontiers in Cellular and Infection Microbiology · doi:10.3389/fcimb.2021.629723 · Cited by 108
“The universal primers 530f (GTGCCAGCMGCNGCGG) (Dowd et al., 2008) and 907R (CCGTCAATTCMTTTGAGTTT) (Lane et al.”
Background
Rumen microbial communities influence metabolic phenotypes in lambs
Morgavi, D., Rathahao, E., Popova, M., Boccard, J., Nielsen, K. F., & Boudra, H. (2015) · Frontiers in Microbiology · doi:10.3389/fmicb.2015.01060 · Cited by 109
Bacterial Community Composition in Three Freshwater Reservoirs of Different Alkalinity and Trophic Status
Llirós, M., İnceoǧlu, Ö., García–Armisen, T., Anzil, A., Leporcq, B., Pigneur, L., Viroux, L., Darchambeau, F., Descy, J., & Servais, P. (2014) · PLoS ONE · doi:10.1371/journal.pone.0116145 · Cited by 107
“Bacterial tag-encoded 454 FLX amplicon pyrosequencing (bTEFAP) was performed using a 454 FLX Titanium platform (Roche) with Titanium reagents at Research and Testing Laboratory (Lubbock, TX, USA) as previously described [55, 56].”
Method
Fast acquisition of a polysaccharide fermenting gut microbiome by juvenile green turtles Chelonia mydas after settlement in coastal habitats
Campos, P., Guivernau, M., Prenafeta-Boldú, F. X., & Cardona, L. (2018) · Microbiome · doi:10.1186/s40168-018-0454-z · Cited by 106
Heat Stress: Effects on Rumen Microbes and Host Physiology, and Strategies to Alleviate the Negative Impacts on Lactating Dairy Cows
Kim, S., Ramos, S., Valencia, R. A., Cho, Y.-I., & Lee, S. (2022) · Frontiers in Microbiology · doi:10.3389/fmicb.2022.804562 · Cited by 114
Spread of tetracycline resistance genes at a conventional dairy farm
Kyselková, M., Jirout, J., da VrchotovÃ¡, N. ⁄., Schmitt, H., & Elhottová, D. (2015) · Frontiers in Microbiology · doi:10.3389/fmicb.2015.00536 · Cited by 105
Electrode material properties for designing effective microbial electrosynthesis systems
Sharma, M., Álvarez‐Gallego, Y., Achouak, W., Pant, D., Sarma, P. M., & Benetton, X. D. (2019) · Journal of Materials Chemistry A · doi:10.1039/c9ta04886c · Cited by 99
Temporal and Spatial Impact of Human Cadaver Decomposition on Soil Bacterial and Arthropod Community Structure and Function
Singh, B., Minick, K. J., Strickland, M. S., Wickings, K. G., Crippen, T. L., Tarone, A. M., Benbow, M. E., Ness, S., Tomberlin, J. K., & Pechal, J. L. (2018) · Frontiers in Microbiology · doi:10.3389/fmicb.2017.02616 · Cited by 100
“Amplicons were subjected to 454-pyrosequencing by bacterial tag-encoded FLX-Titanium pyrosequencing (bTEFAP) method (Dowd et al., 2008) in the Genome Sequencer FLX System (Roche, Inc.”
Method
Monitoring the developmental impact of copper and silver nanoparticle exposure in Drosophila and their microbiomes
Han, X., Geller, B., Moniz, K., Das, P., Chippindale, A. K., & Walker, V. K. (2014) · The Science of The Total Environment · doi:10.1016/j.scitotenv.2013.12.129 · Cited by 97
Reshaping gut bacterial communities after dietary Tenebrio molitor larvae meal supplementation in three fish species
Antonopoulou, E., Nikouli, E., Piccolo, G., Gasco, L., Gai, F., Chatzifotis, S., Mente, E., & Kormas, K. A. (2018) · Aquaculture · doi:10.1016/j.aquaculture.2018.12.013 · Cited by 106
Effect of biostimulation, temperature and salinity on respiration activities and bacterial community composition in an oil polluted desert soil
Abed, R. M. M., Al-Kharusi, S., & Al-Hinai, M. (2014) · International Biodeterioration & Biodegradation · doi:10.1016/j.ibiod.2014.11.018 · Cited by 96
Interactions between Obesity Status and Dietary Intake of Monounsaturated and Polyunsaturated Oils on Human Gut Microbiome Profiles in the Canola Oil Multicenter Intervention Trial (COMIT)
Pu, S., Khazanehei, H., Jones, P. J. H., & Khafipour, E. (2016) · Frontiers in Microbiology · doi:10.3389/fmicb.2016.01612 · Cited by 95
“Approximately 200 ng aliquots of high quality, inhibitorfree genomic DNA were sent to the Research and Testing Laboratories (Lubbock, TX, USA) for bacterial rRNA gene tagencoded GS FLX-Titanium amplicon pyrosequencing (Dowd et al., 2008).”
Method
The Potential of High‐throughput Metagenomic Sequencing of Aquatic Bacterial Communities to Estimate the Postmortem Submersion Interval
Benbow, M. E., Pechal, J. L., Lang, J. M., Erb, R., & Wallace, J. R. (2015) · Journal of Forensic Sciences · doi:10.1111/1556-4029.12859 · Cited by 95
Does the complexity of the rumen microbial ecology preclude methane mitigation?
Wright, A. G., & Klieve, A. V. (2011) · Animal Feed Science and Technology · doi:10.1016/j.anifeedsci.2011.04.015 · Cited by 95
Fecal Microbial Communities in a Large Representative Cohort of California Dairy Cows
Hagey, J. V., Bhatnagar, S., Heguy, J. M., Karle, B. M., Price, P. L., Meyer, D., & Maga, E. A. (2019) · Frontiers in Microbiology · doi:10.3389/fmicb.2019.01093 · Cited by 98
“Previous studies, using 16S rRNA gene sequencing-based approaches, to investigate the effects of a variety of feeds on the fecal microbiota of cattle provided valuable initial insights (Dowd et al., 2008; Callaway et al., 2010; Rice et al., 2012; Li et al., 2017).”
BackgroundResult
A single strain of Bacteroides fragilis protects gut integrity and reduces GVHD
Sofi, M. H., Wu, Y., Ticer, T. D., Schutt, S. D., Bastian, D. A., Choi, H.-J., Tian, L., Mealer, C., Liu, C., Westwater, C., et al. (2021) · JCI Insight · doi:10.1172/jci.insight.136841 · Cited by 97
“The extracted DNA samples were sent to a commercial sequencing facility (67) (MRDNA).”
Method
Illumina sequencing analysis of the ruminal microbiota in high-yield and low-yield lactating dairy cows
Tong, J., Zhang, H., Yang, D., Zhang, Y., Xiong, B., & Jiang, L. (2018) · PLoS ONE · doi:10.1371/journal.pone.0198225 · Cited by 100
High throughput whole rumen metagenome profiling using untargeted massively parallel sequencing
Ross, E. M., Moate, P. J., Bath, C. R., Davidson, S. E., Sawbridge, T., Guthridge, K. M., Cocks, B., & Hayes, B. J. (2012) · BMC Genetics · doi:10.1186/1471-2156-13-53 · Cited by 92
“Other methods used to examine the rumen metagenome tend to be either targeted 16S gene studies [24–26], which use some form of amplification and then sequence the amplified products; or they perform whole genomic (shot-gun) untargeted sequencing and then assemble contigs to gain some functional insight into the sample…”
Method
The Role of Host Phylogeny Varies in Shaping Microbial Diversity in the Hindguts of Lower Termites
Tai, V., James, E. R., Nalepa, C. A., Scheffrahn, R. H., Perlman, S. J., & Keeling, P. J. (2014) · Applied and Environmental Microbiology · doi:10.1128/aem.02945-14 · Cited by 92
“(Lubbock, TX, USA) as described previously (27, 28).”
Tick-Borne Pathogens Shape the Native Microbiome Within Tick Vectors
Adegoke, A., Kumar, D., Bobo, C. G., Rashid, I., Durrani, A. Z., Sajid, M. S., & Karim, S. (2020) · Microorganisms · doi:10.3390/microorganisms8091299 · Cited by 89
“Amar 16S-F GGC GGT GAT CTG TAG CTG GTC TGA 270 bp [16] Amar 16S-R GCC CAA TAA TTC CGA ACA ACG CTT Theileria sp 18S-F GGT AAT TCC AGC TCCAAT AG 300 bp [4] Theileria sp 18S-R ACC AAC AAA ATA GAA CCA AAG TC 16S rRNA 27F AGR GTT TGA TCM TGG CTC AG V1–V3 [13] 16S rRNA 519R GTN TTA CNG CGG CKG CTG COI-F GGT CAA CAA ATC ATA…”
BackgroundMethod
Consumption of different soymilk formulations differentially affects the gut microbiomes of overweight and obese men
Fernandez-Raudales, D., Hoeflinger, J. L., Bringe, N. A., Cox, S. B., Dowd, S. E., Miller, M. J., & de Mejı́a, E. G. (2012) · Gut Microbes · doi:10.4161/gmic.21578 · Cited by 92
“Evaluations presented at each taxonomic level, including percentage compilations represent all sequences resolved to their primary identification or their closest relative.(23,36,37) Statistical analysis.”
Background
Implications of Downstream Nitrate Dosage in anaerobic sewers to control sulfide and methane emissions
Auguet, O., Pijuan, M., Guasch-Balcells, H., Borrego, C., & Gutiérrez, O. (2014) · Water Research · doi:10.1016/j.watres.2014.09.034 · Cited by 92
Natural Sunlight Shapes Crude Oil-Degrading Bacterial Communities in Northern Gulf of Mexico Surface Waters
Bacosa, H. P., Liu, Z., & Erdner, D. L. (2015) · Frontiers in Microbiology · doi:10.3389/fmicb.2015.01325 · Cited by 92
“A∼500 bp region of the 16S rRNA gene was amplified using Eubacterial primers 28F (5′TTTGATCNTGGCTCAG-3′) and 519 R(519R 5′-GTNTTACNGCGGCKGCTG-3′) (Dowd et al., 2008; Smith et al., 2010).”
Method
Diversity of Rumen Bacteria in Canadian Cervids
Gruninger, R. J., Sensen, C. W., McAllister, T. A., & Forster, R. J. (2014) · PLoS ONE · doi:10.1371/journal.pone.0089682 · Cited by 91
“Sequencing of the 16S rRNA genes was performed by Molecular Research LP, where pyrosequencing was carried out using the bTEFAP FLX massively parallel method [18].”
Method
Source water quality shaping different fouling scenarios in a full-scale desalination plant at the Red Sea
Khan, M. T., Manes, C.-L. D. O., Aubry, C., & Croué, J. (2012) · Water Research · doi:10.1016/j.watres.2012.10.017 · Cited by 91
Polycyclic aromatic hydrocarbons degradation and microbial community shifts during co-composting of creosote-treated wood
Covino, S., Fabiánová, T., Křesinová, Z., Čvančarová, M., Burianová, E., Filipová, A., Voříšková, J., Baldrián, P., & Cajthaml, T. (2015) · Journal of Hazardous Materials · doi:10.1016/j.jhazmat.2015.08.023 · Cited by 90
Phylogenetic Analysis of Bacterial Communities in Different Regions of the Gastrointestinal Tract of Agkistrodon piscivorus, the Cottonmouth Snake
Colston, T. J., Noonan, B. P., & Jackson, C. R. (2015) · PLoS ONE · doi:10.1371/journal.pone.0128793 · Cited by 96
“The initial (bp 8–1492) 16S rRNA amplicons from each sample were sequenced using bacterial tag-encoded FLX amplicon 454 pyrosequencing (bTEFAP) [11] at the Research and Testing Laboratory sequencing facility (Lubbock, TX).”
Method
Endophyte Microbiome Diversity in Micropropagated Atriplex canescens and Atriplex torreyi var griffithsii
Lucero, M. E., Unc, A., Cooke, P. H., Dowd, S. E., & Sun, S. (2011) · PLoS ONE · doi:10.1371/journal.pone.0017693 · Cited by 89
“Each sample was analyzed using bacterial tag-encoded FLX amplicon pyrosequencing (bTEFAP) to determine the bacterial populations present [32,33,34,35,36].”
Method
The nasopharyngeal microbiota of feedlot cattle
Holman, D. B., Timsit, E., & Alexander, T. W. (2015) · Scientific Reports · doi:10.1038/srep15557 · Cited by 97
A symbiotic nutrient exchange within the cyanosphere microbiome of the biocrust cyanobacterium, Microcoleus vaginatus
Nelson, C., Giraldo‐Silva, A., & García‐Pichel, F. (2020) · The ISME Journal · doi:10.1038/s41396-020-00781-1 · Cited by 89
“The 16S rRNA gene was amplified using general bacterial primers 530F [58], and 1492R [59].”
Method
Potassium permanganate elicits a shift of the external fish microbiome and increases host susceptibility to columnaris disease
Mohammed, H. H., & Arias, C. R. (2015) · Veterinary Research · doi:10.1186/s13567-015-0215-y · Cited by 89
“Operational taxonomic units (OTUs) were defined at a cutoff value of 3% divergence (97% similarity) in agreement with the current accepted prokaryote species concept [34-39].”
Result
Microbial iron mats at the mid-atlantic ridge and evidence that zetaproteobacteria may be restricted to iron-oxidizing marine systems.
Scott, J. J., Breier, J. A., Luther, G. W., & Emerson, D. (2015) · PLoS ONE · doi:10.1371/journal.pone.0119284 · Cited by 88
“Extracted DNA was sent to Research and Testing Laboratory (Lubbock, TX, USA) for pyrosequencing targeting the V4 hypervariable region (E.coli positions 531–997) using 530F (50-GTG CCA GCMGCN GCG G-30) and 1100R (50-GGG TTN CGN TCG TTG-30) [47].”
Method
Immune and production responses of dairy cows to postruminal supplementation with phytonutrients
Oh, J., Hristov, A. N., Lee, C., Cassidy, T., Heyler, K., Varga, G. A., Pate, J., Walusimbi, S., Brzezicka, E., Toyokawa, K., et al. (2013) · Journal of Dairy Science · doi:10.3168/jds.2013-7089 · Cited by 89
“…samples (approximately 50 g per sampling, wet basis) were composited, per cow and period, and stored frozen in −80°C for bacterial population analysis using tag-encoded FLX amplicon pyrosequencing and Gray28F 5 GAGTTTGATCNTGGCTCAG and Gray519R 5 GTNTTACNGCGGCKGCTG primers (Dowd et al., 2008a,b).”
Method
The Planktonic Core Microbiome and Core Functions in the Cattle Rumen by Next Generation Sequencing
Wirth, R., Kádár, G., Kakuk, B., Maróti, G., Bagi, Z., Szilágyi, Á., Rákhely, G., Horváth, J., & Kovács, K. L. (2018) · Frontiers in Microbiology · doi:10.3389/fmicb.2018.02285 · Cited by 90
“These are usually detected in cow manure and their relative abundances change during the transition from developing and mature rumen (Dowd et al., 2008; Wu et al., 2012).”
Background

Authors: Dowd, S. E., Callaway, T. R., Wolcott, R. D., Sun, Y., McKeehan, T., Hagevoort, R. G., & Edrington, T. S.
Affiliations: Agricultural Research Service (US)
Corresponding author: Dowd, Scot E
ORCID: Dowd, Scot E
Callaway, Todd R
Edrington, Thomas S
Venue: BMC Microbiology
Publisher: Springer Science and Business Media LLC
Published: 2008
Volume: 8
Issue: 1
Pages: 125
ISSN: 1471-2180 (ISSN-L)
DOI: 10.1186/1471-2180-8-125
PMC: PMC2515157
OpenAlex: W2105807803
Cited by: 1,121
References: 80
Citations by year: 2026: 16 · 2025: 23 · 2024: 32 · 2023: 32 · 2022: 45 · 2021: 65 · 2020: 52 · 2019: 60 · 2018: 68 · 2017: 105 · 2016: 116 · 2015: 121 · 2014: 129 · 2013: 99 · 2012: 75
FWCI: 11.37
Type: journal article
Language: en
Open access: gold
doi.org
Licence: cc-by
Locations: BMC Microbiology (publishedVersion, cc-by)
PubMed Central (publishedVersion, cc-by)
PubMed (publishedVersion)
DOAJ (DOAJ: Directory of Open Access Journals) (submittedVersion)
Funders: U.S. Department of Agriculture
Topics: Life Sciences › Biochemistry, Genetics and Molecular Biology › Molecular Biology › Gut microbiota and health
Life Sciences › Agricultural and Biological Sciences › Animal Science and Zoology › Ruminant Nutrition and Digestive Physiology
Life Sciences › Agricultural and Biological Sciences › Animal Science and Zoology › Animal Nutrition and Physiology
Keywords: fecal microbiota, bacterial diversity, dairy cattle, Clostridium, Bacteroides, Ruminococcus, Lachnospiraceae, foodborne pathogens, Salmonella, Campylobacter, gut microbiota
MeSH terms: Animals, Bacteria, Cattle, DNA, Bacterial, DNA, Ribosomal, Feces, Female, RNA, Ribosomal, 16S, Polymerase Chain Reaction, Sequence Analysis, DNA, Gastrointestinal Tract, Biodiversity

About these checks

Registry, retraction, Cites and statistics results are computed, not judged, with one exception: a printed reference that no index lists is read once by a model before it counts as a citation error. Claims are extracted by a model and kept only when their quote appears verbatim in the text; each cited source is then checked, with a model’s help, for whether it says what the claim relies on. Those verdicts can be wrong — read the claim’s quote and the cited source before relying on one.

Statistics and arithmetic are recomputed, not judged.

Confidence bands are shown only for fields calibrated on our annotated test set. None is calibrated yet, so no band is shown.

What counts as a claim ›How we measure confidence ›How we check this ›

Are you an author, or do you see a problem with this page? Request a review

Evaluation of the bacterial diversity in the feces of cattle using 16S rDNA bacterial tag-encoded FLX amplicon pyrosequencing (bTEFAP)

Abstract

Overview

Integrity signals

Verification

Claims the paper makes

Claims other papers make about this one

Self-check

Citations

Cites

Cited by

Related

Metadata

Record

About these checks