The DOI matches its Crossref record; 66 of the 67 references it cites were found in a registry or an index; none of the 56 sources its claims cite is checked for support yet.
Disease-Associated Short Tandem Repeats Co-localize with Chromatin Domain Boundaries
Open accessAbstract
Summary More than 25 inherited human disorders are caused by the unstable expansion of repetitive DNA sequences termed short tandem repeats (STRs). A fundamental unresolved question is why some STRs are susceptible to pathologic expansion, whereas thousands of repeat tracts across the human genome are relatively stable. Here, we discover that nearly all disease-associated STRs (daSTRs) are located at boundaries demarcating 3D chromatin domains. We identify a subset of boundaries with markedly higher CpG island density compared to the rest of the genome. daSTRs specifically localize to ultra-high-density CpG island boundaries, suggesting they might be hotspots for epigenetic misregulation or topological disruption upon STR expansion. Fragile X Syndrome patients exhibit severe boundary disruption in a manner that correlates with local loss of CTCF occupancy and the degree of FMR1 silencing. Our data uncover higher-order chromatin architecture as a new dimension in understanding repeat expansion disorders.
Overview
AI snapshot
Written from the paper’s full text.
TL;DR
Nearly all disease-associated short tandem repeats (daSTRs) localize to 3D chromatin domain boundaries, especially boundaries with ultra-high CpG island density and high CTCF occupancy. In Fragile X syndrome, the FMR1 boundary is disrupted in patients, correlating with local CTCF loss and FMR1 silencing.
Key findings
- 22 of 27 daSTR loci localized to human ES cell boundaries, including 11 at TAD boundaries and 11 at subTAD boundaries; 21 of 23 neurological daSTRs localized to boundaries in human fetal cortical plate tissue.
- daSTRs were significantly closer to domain boundaries than matched normal-length repeats (0 bp versus 5,203 bp median; P = 0.00074 Mann-Whitney U; P = 0.0037 Kolmogorov-Smirnov) and enriched at boundaries (odds ratio = 4.77, Fisher’s exact P = 0.00056).
- daSTRs localized to CpG island-rich boundaries more than matched repeats (odds ratio = 10.4, P = 1.4E-8), with 65.7% of daSTRs at CpG island-rich boundaries versus 22.0% of matched repeats; no significant difference was found at CpG island-depleted boundaries or non-boundary CpG islands.
- In Fragile X syndrome patient samples, the FMR1 TAD boundary was ablated, a CTCF doublet ~100 kb upstream was lost, and boundary disruption correlated with FMR1 silencing; these topological changes occurred in at least three cell types and four patients.
Methods
- Analyzed published Hi-C data from human ES cells and human fetal cortical plate tissue, using DI+HMM for Mb-scale TADs and 3DNetMod for nested subTADs; daSTRs were mapped in hg19 and compared with normal-length repeats matched by repeat sequence, length range, and gene body placement.
- Performed 5C, CTCF ChIP-seq, qRT-PCR for FMR1 expression, and Sanger sequencing in Fragile X syndrome patient and control B-lymphocytes, fibroblasts, and postmortem brain tissue.
- Used Fisher’s exact, Kolmogorov-Smirnov, Cochran–Mantel–Haenszel, randomization, and bootstrapped tests to assess boundary localization and CpG island density.
Limitations
- The paper states it does not aim to identify specific genetic variants predicting which individuals develop repeat expansion disorders, and that cause-and-effect relationships among boundary disruption, DNA methylation, CTCF occupancy, CpG islands, STR expansion, and gene expression remain unresolved.
- The paper notes that statistical power was restricted by small daSTR class sizes, and that rigorous thresholds likely missed some visually evident boundaries, making boundary enrichment estimates conservative.
- Evident from the text: the Fragile X syndrome topological analyses rely on a small number of patient samples and cell types, and the link between boundary disruption and FMR1 silencing is correlative rather than causal.
Model-written summary. Check it against the paper before relying on it.
Integrity signals
Registry
Cites
Statistics
Verification
Claims the paper makes
0 of 56 cited sources checked · 0 supported · 0 flagged
A result the paper reports from its own data — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“Importantly, daSTRs localize with boundaries exhibiting ultra-high CpG island density (blue spheres, Figure 4A).”
§ Disease-associated short tandem repeats co-localize with chromatin domain boundaries > Results > Boundaries containing daSTRs are characterized by ultra-high density of CpG islands
Tests✓ Asserted: passes✓ Checkable: passes✓ Load-bearing: passes✓ Based: passesA result the paper reports from its own data — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“Third, the small subTAD encompassing the FMR1 gene dissolves in the ~935 FXS patient compared to the healthy sibling (Figure 5B-C, lower green arrow).”
§ Disease-associated short tandem repeats co-localize with chromatin domain boundaries > Results > TAD boundary at the FMR1 daSTR is ablated in Fragile X Syndrome
Tests✓ Asserted: passes✓ Checkable: passes✓ Load-bearing: passes✓ Based: passesA result the paper reports from its own data — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“We observed severe topological disruption around the FMR1 daSTR in both FXS patient B cell lines compared to the healthy sibling with normal-length repeats (Figure 5B-D).”
§ Disease-associated short tandem repeats co-localize with chromatin domain boundaries > Results > TAD boundary at the FMR1 daSTR is ablated in Fragile X Syndrome
Tests✓ Asserted: passes✓ Checkable: passes✓ Load-bearing: passes✓ Based: passesA result the paper reports from its own data — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“Consistent with our observations in human ES cells, we found 8 out of the 23 neurological daSTR loci were detected at TAD boundaries in human fetal cortical plate tissue (Figure 3A).”
§ Disease-associated short tandem repeats co-localize with chromatin domain boundaries > Results > daSTRs linked to neurological disorders co-localize with boundaries in human cortical tissue
Tests✓ Asserted: passes✓ Checkable: passes✓ Load-bearing: passes✓ Based: passesA result the paper reports from its own data — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“Although statistical power was restricted by the small size of the groups, all four classes of daSTRs showed enrichment at boundaries compared to other normal-length repeats matched by sequence and gene body location (Figure S5A).”
§ Disease-associated short tandem repeats co-localize with chromatin domain boundaries > Results > daSTRs linked to neurological disorders co-localize with boundaries in human cortical tissue
Tests✓ Asserted: passes✓ Checkable: passes✓ Load-bearing: passes✓ Based: passesA result the paper reports from its own data — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“Boundaries containing matched normal-length repeat tracts show a striking increase in CpG island density compared to boundaries without repeats (Odds Ratio = 3.92, Fisher’s Exact Test, P = 1.69E-110, Figure 4A-B).”
§ Disease-associated short tandem repeats co-localize with chromatin domain boundaries > Results > Boundaries containing daSTRs are characterized by ultra-high density of CpG islands
Tests✓ Asserted: passes✓ Checkable: passes✓ Load-bearing: passes✓ Based: passesA result the paper reports from its own data — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“The extent of boundary disruption correlates with the degree of FMR1 silencing and local loss of CTCF occupancy at specific sites.”
§ Disease-associated short tandem repeats co-localize with chromatin domain boundaries > Introduction
Tests✓ Asserted: passes✓ Checkable: passes✓ Load-bearing: passes✓ Based: passesA result the paper reports from its own data — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“First, a domain boundary separating FMR1 from the immediate upstream TAD in the healthy sibling was ablated in the ~935 FXS patient (Figure 5B-C, green bracket).”
§ Disease-associated short tandem repeats co-localize with chromatin domain boundaries > Results > TAD boundary at the FMR1 daSTR is ablated in Fragile X Syndrome
Tests✓ Asserted: passes✓ Checkable: passes✓ Load-bearing: passes✓ Based: passesA result the paper reports from its own data — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“The mean percentage of drawn repeats tracts that are boundary-associated increased from 49.5% (bootstrapped 95% CI: 30.3% < μpercent_boundary < 68.6%) in matched repeats compared to 81.1% (bootstrapped 95% CI: 66.2% < μpercent_boundary < 96.0%) in daSTRs, respectively (Figure 2C).”
§ Disease-associated short tandem repeats co-localize with chromatin domain boundaries > Results > daSTRs localize to boundaries significantly more than normal-length repeats genome-wide
Tests✓ Asserted: passes✓ Checkable: passes✓ Load-bearing: passes✓ Based: passesA result the paper reports from its own data — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“Importantly, there is no significant difference between matched repeats and daSTRs when the test is performed on CpG island-depleted boundaries (Fisher's Exact Test: Odds Ratio = 0.271 and P = 0.063; Cochran-Mantel-Haenszel Test: Odds Ratio = 0.364; Figure 4E)”
§ Disease-associated short tandem repeats co-localize with chromatin domain boundaries > Results > Boundaries containing daSTRs are characterized by ultra-high density of CpG islands
Load-bearingStrength:plain· not yet calibratedTests✓ Asserted: passes✓ Checkable: passes✓ Load-bearing: passes✓ Based: passes
- It may state two separate claims as one. 26
- Probably not a substantial claim. 32
- The quote only partly states this claim. 1
A result the paper reports from its own data — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“An additional 8 and 5 daSTRs localized to subTAD and qualitatively apparent boundaries, respectively (Figure 3B, Figure S4A-C).”
§ Disease-associated short tandem repeats co-localize with chromatin domain boundaries > Results > daSTRs linked to neurological disorders co-localize with boundaries in human cortical tissue
Tests✓ Asserted: passes✓ Checkable: passes✓ Load-bearing: passes✓ Based: passesIt may state two separate claims as one.
A result the paper reports from its own data — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“We observed that nearly all daSTRs are specifically targeted to CpG island-rich boundaries, but not boundaries devoid of CpG islands or CpG islands internal to domains.”
§ Disease-associated short tandem repeats co-localize with chromatin domain boundaries > Introduction
Tests✓ Asserted: passes✓ Checkable: passes✓ Load-bearing: passes✓ Based: passesIt may state two separate claims as one.
A result the paper reports from its own data — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“Noteworthy, we also observed a marked increase in the density of CpG islands at boundaries vs. non-boundaries, whereas classic repressive chromatin marks such as H3K9me3 were slightly depleted at boundaries compared to loci internal to domains.”
§ Disease-associated short tandem repeats co-localize with chromatin domain boundaries > Results > Boundaries containing daSTRs are characterized by ultra-high density of CpG islands
Strength:plain· not yet calibratedCausal:correlational· not yet calibratedTests✓ Asserted: passes✓ Checkable: passes? Load-bearing: unclear✓ Based: passesIt may state two separate claims as one.
A result the paper reports from its own data — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“We found severe reduction of FMR1 expression in all FXS patient samples with boundary disruption, whereas boundaries remained intact if FMR1 was not silenced (Figure 6G-H, Figure S7I-K).”
§ Disease-associated short tandem repeats co-localize with chromatin domain boundaries > Results > Boundary disruption in Fragile X Syndrome patients correlates with FMR1 silencing
Tests✓ Asserted: passes✓ Checkable: passes✓ Load-bearing: passes✓ Based: passesIt may state two separate claims as one.
A result the paper reports from its own data — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“The CTCF doublet is located directly at the base of the upstream loop and TAD boundary; disruption of these structural features in FXS patients correlated with lost CTCF occupancy (Figure 6C-D).”
§ Disease-associated short tandem repeats co-localize with chromatin domain boundaries > Results > CTCF occupancy at the FMR1 daSTR is ablated in Fragile X Syndrome
Tests✓ Asserted: passes✓ Checkable: passes✓ Load-bearing: passes✓ Based: passesIt may state two separate claims as one.
A result the paper reports from its own data — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“We also noticed that the specific long-range contacts between FMR1 and the downstream TAD were lost in FXS but not mediated by CTCF (Figure 6E, Figure S7G), suggesting that additional architectural proteins are affected by repeat expansion.”
§ Disease-associated short tandem repeats co-localize with chromatin domain boundaries > Results > CTCF occupancy at the FMR1 daSTR is ablated in Fragile X Syndrome
Load-bearingStrength:plain· not yet calibratedTests✓ Asserted: passes✓ Checkable: passes✓ Load-bearing: passes✓ Based: passesIt may state two separate claims as one.
In the paper
“Consistent with the established principles of CTCF motif convergency (Rao et al., 2014), the doublet CTCF sites contained CTCF motifs in the reverse orientation and looped to distal CTCF occupied motifs oriented in the forward direction (Figure 6C-D).”
§ Disease-associated short tandem repeats co-localize with chromatin domain boundaries > Results > CTCF occupancy at the FMR1 daSTR is ablated in Fragile X Syndrome
What the sources say
- Not checked yetcites Rao et al., 2014 source
Strength:boosted· not yet calibratedCausal:correlational· not yet calibratedTests✓ Asserted: passes✓ Checkable: passes? Load-bearing: unclear✓ Based: passesIt may state two separate claims as one.
A result the paper reports from its own data — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“We found increased density of H3K27ac+ putative enhancers in the downstream TAD and minimal H3K27ac+ signal in the TAD upstream of the FMR1 daSTR (Figure 6I).”
§ Disease-associated short tandem repeats co-localize with chromatin domain boundaries > Results > Boundary disruption in Fragile X Syndrome patients correlates with FMR1 silencing
Tests✓ Asserted: passes✓ Checkable: passes✓ Load-bearing: passes✓ Based: passesIt may state two separate claims as one.
A result the paper reports from its own data — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“FMR1 is biased towards downstream contacts (positive DI) in healthy individuals and transitions to upstream contacts (negative DI) in diseased individuals.”
§ Disease-associated short tandem repeats co-localize with chromatin domain boundaries > Results > TAD boundary at the FMR1 daSTR is ablated in Fragile X Syndrome
Tests✓ Asserted: passes✓ Checkable: passes✓ Load-bearing: passes✓ Based: passesIt may state two separate claims as one.
A result the paper reports from its own data — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“One final gene (CSTB) was queried for boundary localization but dropped from all analyses that compared daSTRs to matched, normal-length repeats because there are no other repeats matching its sequence, length, and gene body location requirements in hg19.”
§ Disease-associated short tandem repeats co-localize with chromatin domain boundaries > STAR Methods > QUANTIFICATION AND STATISTICAL ANALYSES
Strength:plain· not yet calibratedCausal:direct· not yet calibratedTests✓ Asserted: passes✓ Checkable: passes✗ Load-bearing: fails✓ Based: passesProbably not a substantial claim. The paper’s conclusions may not depend on it.
The paper states this without a source or data behind it here, so there is nothing to check it against. The quote shows it is in the paper.
In the paper
“Of these 29, two (TBP, NOP56) were dropped from our analyses because they were located at the far edges of chromosomes beyond where Hi-C can query domains.”
§ Disease-associated short tandem repeats co-localize with chromatin domain boundaries > STAR Methods > QUANTIFICATION AND STATISTICAL ANALYSES
Strength:plain· not yet calibratedCausal:direct· not yet calibratedTests✓ Asserted: passes✓ Checkable: passes✗ Load-bearing: fails✓ Based: passesProbably not a substantial claim. The paper’s conclusions may not depend on it.
None of the sources cited for this claim have been checked yet.
In the paper
“Mammalian genomes are organized into a hierarchy of Megabase (Mb)-scale topologically associating domains (TADs) (Dixon et al., 2012; Nora et al., 2012) and smaller, nested subTADs (Dixon et al., 2012; Nora et al., 2012; Phillips-Cremins et al., 2013; Rao et al., 2014).”
§ Disease-associated short tandem repeats co-localize with chromatin domain boundaries > Introduction
What the sources say
Load-bearingStrength:plain· not yet calibratedTests✓ Asserted: passes✓ Checkable: passes✓ Load-bearing: passes✓ Based: passesProbably not a substantial claim.
None of the sources cited for this claim have been checked yet.
In the paper
“By a process that is poorly understood, a small number of specific normal-length STRs undergo somatic or germline expansion and transition to intermediate, pre-mutation, and mutation (affected) repeat unit tract lengths (Mirkin, 2007; Pearson et al., 2005).”
§ Disease-associated short tandem repeats co-localize with chromatin domain boundaries > Introduction
What the sources say
Strength:plain· not yet calibratedCausal:direct· not yet calibratedTests✓ Asserted: passes✓ Checkable: passes✗ Load-bearing: fails✓ Based: passesProbably not a substantial claim. The paper’s conclusions may not depend on it.
None of the sources cited for this claim have been checked yet.
In the paper
“Such chromatin domains span >90% of the genome and are thought to create insulated neighborhoods demarcating the search space of specific long-range interactions between enhancers and their target genes (Dowen et al., 2014; Narendra et al., 2015; Symmons et al., 2014).”
§ Disease-associated short tandem repeats co-localize with chromatin domain boundaries > Introduction
What the sources say
Load-bearingStrength:hedged· not yet calibratedTests✓ Asserted: passes✓ Checkable: passes✓ Load-bearing: passes✓ Based: passesProbably not a substantial claim. It may state two separate claims as one.
In the paper
“Normal-length STR tracts are generally stable across generations and among somatic tissues in the same individual (McMurray, 2010).”
§ Disease-associated short tandem repeats co-localize with chromatin domain boundaries > Introduction
What the sources say
- Not checked yetcites McMurray, 2010 source
Load-bearingStrength:plain· not yet calibratedTests✓ Asserted: passes✓ Checkable: passes✓ Load-bearing: passes✓ Based: passesProbably not a substantial claim. It may state two separate claims as one.
In the paper
“daSTRs consist predominantly of a trinucleotide unit, but expandable tetra-, penta-, and hexa-nucleotide repeat sequences have also been reported (Iyer et al., 2015).”
§ Disease-associated short tandem repeats co-localize with chromatin domain boundaries > Introduction
What the sources say
- Not checked yetcites Iyer et al., 2015 source
Strength:plain· not yet calibratedTests✓ Asserted: passes✓ Checkable: passes✗ Load-bearing: fails✓ Based: passesProbably not a substantial claim. The paper’s conclusions may not depend on it. It may state two separate claims as one.
None of the sources cited for this claim have been checked yet.
In the paper
“Pre-mutation and mutation lengths vary widely among the repeat expansion disorders (Iyer et al., 2015; McMurray, 2010).”
§ Disease-associated short tandem repeats co-localize with chromatin domain boundaries > Introduction
What the sources say
Strength:plain· not yet calibratedTests✓ Asserted: passes✓ Checkable: passes✗ Load-bearing: fails✓ Based: passesProbably not a substantial claim. The paper’s conclusions may not depend on it.
None of the sources cited for this claim have been checked yet.
In the paper
“Healthy individuals have tens of thousands of relatively short STR tracts distributed throughout their genomes (Gymrek and Erlich, 2013; Gymrek et al., 2016; Willems et al., 2017).”
§ Disease-associated short tandem repeats co-localize with chromatin domain boundaries > Introduction
What the sources say
Strength:plain· not yet calibratedTests✓ Asserted: passes✓ Checkable: passes✗ Load-bearing: fails✓ Based: passesProbably not a substantial claim. The paper’s conclusions may not depend on it.
In the paper
“daSTRs also exhibit a wide range of repeat unit sequences and can be localized across the gene body in introns, exons, promoters and 3’/5’ untranslated regions (UTRs) (La Spada and Taylor, 2010).”
§ Disease-associated short tandem repeats co-localize with chromatin domain boundaries > Introduction
What the sources say
- Not checked yetcites La Spada and Taylor, 2010
Strength:plain· not yet calibratedTests✓ Asserted: passes✓ Checkable: passes✗ Load-bearing: fails✓ Based: passesProbably not a substantial claim. The paper’s conclusions may not depend on it. It may state two separate claims as one.
None of the sources cited for this claim have been checked yet.
In the paper
“Disease-associated STR tracts (hereafter referred to as daSTRs) exhibit tremendous diversity in sequence, gene body location, and tract length.”
§ Disease-associated short tandem repeats co-localize with chromatin domain boundaries > Introduction
Strength:plain· not yet calibratedTests✓ Asserted: passes✓ Checkable: passes✗ Load-bearing: fails✓ Based: passesProbably not a substantial claim. The paper’s conclusions may not depend on it. It may state two separate claims as one.
None of the sources cited for this claim have been checked yet.
In the paper
“More than 25 inherited human disorders are caused by the unstable expansion of repetitive DNA sequences termed short tandem repeats (STRs).”
§ Disease-associated short tandem repeats co-localize with chromatin domain boundaries > Abstract
What the sources say
Strength:plain· not yet calibratedCausal:direct· not yet calibratedTests✓ Asserted: passes✓ Checkable: passes✗ Load-bearing: fails✓ Based: passesProbably not a substantial claim. The paper’s conclusions may not depend on it.
In the paper
“CpG islands are generally hypomethylated in normal somatic cells and can acquire aberrant hypermethylation in disease (Robertson, 2005).”
§ Disease-associated short tandem repeats co-localize with chromatin domain boundaries > Results > TAD boundary at the FMR1 daSTR is ablated in Fragile X Syndrome
What the sources say
- Not checked yetcites Robertson, 2005 source
Tests✓ Asserted: passes✓ Checkable: passes✓ Load-bearing: passes✓ Based: passesProbably not a substantial claim. It may state two separate claims as one.
A conclusion the paper draws from its own results — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“Together, these results indicate that daSTRs are present at boundaries in embryonic and somatic cell lineages and also in at least one stage of spermatogenesis when daSTR instability is paternally inherited.”
§ Disease-associated short tandem repeats co-localize with chromatin domain boundaries > Results > daSTRs co-localize with TADs that are invariant across somatic cell types
Tests✓ Asserted: passes✓ Checkable: passes✓ Load-bearing: passes✓ Based: passesIt may state two separate claims as one.
In the paper
“The mutation-length CGG STR acquires DNA methylation, which is thought to cause FMR1 silencing (Park et al., 2015).”
§ Disease-associated short tandem repeats co-localize with chromatin domain boundaries > Results > Boundary disruption in Fragile X Syndrome patients correlates with FMR1 silencing
What the sources say
- Not checked yetcites Park et al., 2015 source
Strength:hedged· not yet calibratedCausal:conditional· not yet calibratedTests✓ Asserted: passes✓ Checkable: passes✗ Load-bearing: fails✓ Based: passesProbably not a substantial claim. The paper’s conclusions may not depend on it. It may state two separate claims as one.
None of the sources cited for this claim have been checked yet.
In the paper
“Moreover, CpG islands are aberrantly hypermethylated in a subset of cancers that exhibit microsatellite instability (Sharma et al., 2010; You and Jones, 2012).”
§ Disease-associated short tandem repeats co-localize with chromatin domain boundaries > Discussion
What the sources say
- Not checked yetcites Sharma et al., 2010 source
- Not checked yetcites You and Jones, 2012
Strength:plain· not yet calibratedCausal:correlational· not yet calibratedTests✓ Asserted: passes✓ Checkable: passes✗ Load-bearing: fails✓ Based: passesProbably not a substantial claim. The paper’s conclusions may not depend on it.
A conclusion the paper draws from its own results — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“This boundary disruption results in a dramatic re-organization of genome topology around the FMR1 gene, such that it no longer contacts genomic loci in the downstream TAD marked by histone modifications characteristic of active enhancers. Rather, FMR1 merges with the upstream TAD largely devoid of active enhancer marks, suggesting that the topological reconfiguration of the genome could be related”
§ Disease-associated short tandem repeats co-localize with chromatin domain boundaries > Discussion
Tests✓ Asserted: passes✓ Checkable: passes✓ Load-bearing: passes✓ Based: passesIt may state two separate claims as one.
A conclusion the paper draws from its own results — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“Together, these results reveal severe topological disruption at the FMR1 daSTR in at least three cell types and at least four patients with FXS.”
§ Disease-associated short tandem repeats co-localize with chromatin domain boundaries > Results > TAD boundary at the FMR1 daSTR is ablated in Fragile X Syndrome
Tests✓ Asserted: passes✓ Checkable: passes✓ Load-bearing: passes✓ Based: passesIt may state two separate claims as one.
In the paper
“FXS is caused by the loss of the fragile X mental retardation protein (FMRP) encoded by FMR1 (Verkerk et al., 1991).”
§ Disease-associated short tandem repeats co-localize with chromatin domain boundaries > Results > Boundary disruption in Fragile X Syndrome patients correlates with FMR1 silencing
What the sources say
- Not checked yetcites Verkerk et al., 1991 source
Tests✓ Asserted: passes✓ Checkable: passes✓ Load-bearing: passes✓ Based: passesProbably not a substantial claim.
A conclusion the paper draws from its own results — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“These results demonstrate that FMR1 is associated with the downstream TAD in healthy B cells and shifts to the upstream TAD in two patients with FXS.”
§ Disease-associated short tandem repeats co-localize with chromatin domain boundaries > Results > TAD boundary at the FMR1 daSTR is ablated in Fragile X Syndrome
Tests✓ Asserted: passes✓ Checkable: passes✓ Load-bearing: passes✓ Based: passesIt may state two separate claims as one.
None of the sources cited for this claim have been checked yet.
In the paper
“In congenital myotonic dystrophy, the region flanking the DM1 gene is hypermethylated and this methylation disrupts binding of adjacent CTCF binding sites (Filippova et al., 2001; Steinbach et al., 1998).”
§ Disease-associated short tandem repeats co-localize with chromatin domain boundaries > Discussion
What the sources say
Strength:plain· not yet calibratedCausal:direct· not yet calibratedTests✓ Asserted: passes✓ Checkable: passes? Load-bearing: unclear✓ Based: passesIt may state two separate claims as one.
What the paper did — it cites no source for this, so there is none to check. The quote shows it is in the paper.
In the paper
“The null distribution was created by taking 10,000 draws without replacement of n=26 matched repeats, where each draw is proportionally matched to the daSTR group with respect to repeat unit sequence and gene body location, and computing the test statistic each time.”
§ Disease-associated short tandem repeats co-localize with chromatin domain boundaries > STAR Methods > QUANTIFICATION AND STATISTICAL ANALYSES
Tests✓ Asserted: passes✓ Checkable: passes✓ Load-bearing: passes✓ Based: passesProbably not a substantial claim.
None of the sources cited for this claim have been checked yet.
In the paper
“A total of 29 genes associated with trinucleotide repeat expansion disorders were initially selected for analysis based on previous reports (Tables S1-S3) (Iyer et al., 2015; La Spada and Taylor, 2010).”
§ Disease-associated short tandem repeats co-localize with chromatin domain boundaries > STAR Methods > QUANTIFICATION AND STATISTICAL ANALYSES
What the sources say
- Not checked yetcites Iyer et al., 2015 source
- Not checked yetcites La Spada and Taylor, 2010
Load-bearingStrength:plain· not yet calibratedTests✓ Asserted: passes✓ Checkable: passes✓ Load-bearing: passes✓ Based: passesProbably not a substantial claim.
What the paper did — it cites no source for this, so there is none to check. The quote shows it is in the paper.
In the paper
“This method ensures that both boundaries and non-boundary bins are the same size, and that non-boundary bins are not dominated by hard to query regions of the genome.”
§ Disease-associated short tandem repeats co-localize with chromatin domain boundaries > STAR Methods > QUANTIFICATION AND STATISTICAL ANALYSES
Tests✓ Asserted: passes✓ Checkable: passes✓ Load-bearing: passes✓ Based: passesProbably not a substantial claim.
A conclusion the paper draws from its own results — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“We discover that boundaries at a specific daSTR in the FMR1 gene are disrupted in FXS in a manner that markedly alters the enhancer landscape accessible to the gene and correlates with the loss of CTCF occupancy and FMR1 silencing.”
§ Disease-associated short tandem repeats co-localize with chromatin domain boundaries > Discussion
Tests✓ Asserted: passes✓ Checkable: passes✓ Load-bearing: passes✓ Based: passesIt may state two separate claims as one.
What the paper did — it cites no source for this, so there is none to check. The quote shows it is in the paper.
In the paper
“Raw 5C counts distributions were quantile normalized to address minor sequencing depth differences.”
§ Disease-associated short tandem repeats co-localize with chromatin domain boundaries > STAR Methods > QUANTIFICATION AND STATISTICAL ANALYSES
Strength:plain· not yet calibratedCausal:direct· not yet calibratedTests✓ Asserted: passes✓ Checkable: passes✗ Load-bearing: fails✓ Based: passesProbably not a substantial claim. The paper’s conclusions may not depend on it.
What the paper did — it cites no source for this, so there is none to check. The quote shows it is in the paper.
In the paper
“To ensure that our results from the Fisher’s Exact test (Figure 2B, Figure 4D-F) were not artifacts of using a null repeat set that was not weighted similarly to the daSTRs set with respect to STR type group (Table S3), we also randomly created n=1000 subsets of the null repeat set that were weighted similarly to the daSTRs.”
- Also stated in: § QUANTIFICATION AND STATISTICAL ANALYSES · plain
“We then used the Python StatsModel package implementation of the Cochran–Mantel–Haenszel test on the 1000 subsets to calculate a pooled odds ratio of the empirical distribution.”
§ Disease-associated short tandem repeats co-localize with chromatin domain boundaries > STAR Methods > QUANTIFICATION AND STATISTICAL ANALYSES
Tests✓ Asserted: passes✓ Checkable: passes✓ Load-bearing: passes✓ Based: passesProbably not a substantial claim.
- Also stated in: § QUANTIFICATION AND STATISTICAL ANALYSES · plain
In the paper
“A recent genome-wide association study in Huntington’s disease patients identified a link between genetic variation in DNA repair machinery and the age of onset of the disease (Genetic Modifiers of Huntington's Disease, 2015).”
§ Disease-associated short tandem repeats co-localize with chromatin domain boundaries > Discussion
What the sources say
- Not checked yetcites Genetic Modifiers of Huntington's Disease, 2015
Tests✓ Asserted: passes✓ Checkable: passes✓ Load-bearing: passes✓ Based: passesProbably not a substantial claim.
A conclusion the paper draws from its own results — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“We posit that STR instability at CpG island-rich boundaries manifests in individuals already genetically pre-disposed to repeat expansion.”
§ Disease-associated short tandem repeats co-localize with chromatin domain boundaries > Discussion
Strength:hedged· not yet calibratedCausal:conditional· not yet calibratedTests✓ Asserted: passes✓ Checkable: passes✗ Load-bearing: fails✗ Based: failsProbably not a substantial claim. The paper’s conclusions may not depend on it. The paper may give no reason why it holds.
None of the sources cited for this claim have been checked yet.
In the paper
“Recent high-resolution Chromosome-Conformation-Capture sequencing studies have revealed that TAD boundaries are perturbed in rare human limb malformation diseases (Lupianez et al., 2015) and certain types of cancers (Flavahan et al., 2016; Hnisz et al., 2016), leading to enhancer miswiring and pathogenic disruption of gene expression.”
§ Disease-associated short tandem repeats co-localize with chromatin domain boundaries > Discussion
What the sources say
Tests✓ Asserted: passes✓ Checkable: passes✓ Load-bearing: passes✓ Based: passesProbably not a substantial claim. It may state two separate claims as one.
None of the sources cited for this claim have been checked yet.
In the paper
“STR instability is known to occur in the germline, but tissue-specific somatic variation in STR tract length has been reported (Leeflang et al., 1995; Telenius et al., 1994; Wohrle et al., 1993; Wong et al., 1995; Zhang et al., 1994).”
§ Disease-associated short tandem repeats co-localize with chromatin domain boundaries > Discussion
What the sources say
Strength:plain· not yet calibratedTests✓ Asserted: passes✓ Checkable: passes✗ Load-bearing: fails✓ Based: passesProbably not a substantial claim. The paper’s conclusions may not depend on it. It may state two separate claims as one.
In the paper
“By contrast, many other daSTRS are co-localized to subTAD boundaries, which are known to be dynamically reconfigured across cell state transitions in development (Norton et al., 2018).”
§ Disease-associated short tandem repeats co-localize with chromatin domain boundaries > Discussion
What the sources say
- Not checked yetcites Norton et al., 2018 source
Tests✓ Asserted: passes✓ Checkable: passes✓ Load-bearing: passes✓ Based: passesIt may state two separate claims as one.
What the paper did — it cites no source for this, so there is none to check. The quote shows it is in the paper.
In the paper
“This method ensures that both boundaries and non-boundary bins are the same size, and that non-boundary bins are not dominated by hard to query regions of the genome.”
§ Disease-associated short tandem repeats co-localize with chromatin domain boundaries > STAR Methods > QUANTIFICATION AND STATISTICAL ANALYSES
Tests✓ Asserted: passes✓ Checkable: passes✓ Load-bearing: passes✓ Based: passesProbably not a substantial claim.
In the paper
“These groups are motivated by prior literature showing that daSTRs with similar sequence and gene body locations behave similarly with respect to number of repeats required for disease and expansion mechanisms (Iyer et al., 2015).”
§ Disease-associated short tandem repeats co-localize with chromatin domain boundaries > STAR Methods > QUANTIFICATION AND STATISTICAL ANALYSES
What the sources say
- Not checked yetcites Iyer et al., 2015 source
Tests✓ Asserted: passes✓ Checkable: passes✓ Load-bearing: passes✓ Based: passesProbably not a substantial claim.
In the paper
“We used these published Mb-scale TAD calls in Figure S2 because Ren and colleagues used an independent study and an independent TAD calling method to compare TADs across H1 ES cell (Human H1) and H1 ESC-derived lineages—mesendoderm (MES), mesenchymal stem cells (MSC), neural progenitor cells (NPC), and trophoblast-like cells (TRO).”
§ Disease-associated short tandem repeats co-localize with chromatin domain boundaries > STAR Methods > QUANTIFICATION AND STATISTICAL ANALYSES
What the sources say
- Not checked yetcites Schmitt et al., 2016 source
Strength:plain· not yet calibratedTests✓ Asserted: passes✓ Checkable: passes✗ Load-bearing: fails✓ Based: passesProbably not a substantial claim. The paper’s conclusions may not depend on it. It may state two separate claims as one.
In the paper
“Finally, restriction fragment biases were normalized by applying matrix balancing as previously reported (Imakaev et al., 2012).”
§ Disease-associated short tandem repeats co-localize with chromatin domain boundaries > STAR Methods > QUANTIFICATION AND STATISTICAL ANALYSES
What the sources say
- Not checked yetcites Imakaev et al., 2012 source
Load-bearingStrength:plain· not yet calibratedTests✓ Asserted: passes✓ Checkable: passes✓ Load-bearing: passes✓ Based: passesProbably not a substantial claim.
What the paper did — it cites no source for this, so there is none to check. The quote shows it is in the paper.
In the paper
“To facilitate the comparison of ChIPseq libraries across cell types, the mapped reads were filtered to remove optical and PCR duplicates and then downsampled to equivalent read numbers across cellular states.”
§ Disease-associated short tandem repeats co-localize with chromatin domain boundaries > STAR Methods > QUANTIFICATION AND STATISTICAL ANALYSES
Tests✓ Asserted: passes✓ Checkable: passes✓ Load-bearing: passes✓ Based: passesProbably not a substantial claim.
What the paper did — it cites no source for this, so there is none to check. The quote shows it is in the paper.
In the paper
“The 120kb boundary size was chosen to address the resolution limit of the Hi-C assays, 40 kb, used in this study.”
§ Disease-associated short tandem repeats co-localize with chromatin domain boundaries > STAR Methods > QUANTIFICATION AND STATISTICAL ANALYSES
Tests✓ Asserted: passes✓ Checkable: passes✓ Load-bearing: passes✓ Based: passesProbably not a substantial claim.
What the paper did — it cites no source for this, so there is none to check. The quote shows it is in the paper.
In the paper
“Bootstrapped confidence intervals for percent of repeats at boundary and CpG island density were constructed by randomly selecting groups of 26 repeats from both the matched repeat set and the daSTRs 1,000 times with replacement and computing the percent of the randomly chosen repeats at a boundary in each sampling.”
§ Disease-associated short tandem repeats co-localize with chromatin domain boundaries > STAR Methods > QUANTIFICATION AND STATISTICAL ANALYSES
Tests✓ Asserted: passes✓ Checkable: passes✓ Load-bearing: passes✓ Based: passesProbably not a substantial claim. The quote only partly states this claim.
The paper relies on this without support.
The role for TAD boundaries in neurological disorders has not yet been reported.
“but the role for TAD boundaries in neurological disorders has not yet been reported.”
The paper relies on this without support.
Mapping daSTRs to normal-length repeat tracts in the hg19 reference genome is representative of disease-associated STR loci.
“Because the samples are not diseased, we mapped daSTRs to the normal-length repeat tracts found in the hg19 reference genome (Tables S1-S3).”
The paper relies on this without support.
Domain boundaries called in human ES cells and fetal cortical plate are relevant to the cell types of pathology for all daSTRs.
“Thus, although the target cell type(s) for many unstable repeat expansion disorders are unknown, the strong enrichment at boundaries regardless of tissue origin suggests that daSTR co-localization with boundaries might be robust across cell types relevant for the pathology.”
Claims other papers make about this one
Each is checked against this paper’s own text: does it say what the citing paper says it does?
In the citing paper
“the disruption of 3D genome organization has been demonstrated in neurodevelopmental and neurological neurodegenerative disorders such as Huntington’s disease, Fragile X syndrome, Down syndrome, etc.”
From Neuronal DNA double-strand breaks lead to genome structural variations and 3D genome disruption in neurodegeneration (2023) · cites this paper as [43]
In the citing paper
“Genome misfolding has been reported in fragile X syndrome48, the leading monogenic cause of ASD, as well as other human diseases49”
From Three-dimensional genome restructuring across timescales of activity-induced neuronal gene expression (2020) · cites this paper as [48]
Self-check
Percentages, sums and reported differences re-computed from the paper’s own numbers.
Four daSTR classes account for only 25 of 26 tracts
MinorThe methods say that 26 daSTR tracts were subdivided into these four classes, but the listed class sizes sum to 25. One tract is unaccounted for.
Reported 26 · recomputed 25
“The classes are: (1) Repeat unit CAG in exons and 5’UTRs (9 daSTRs), (2) Repeat unit GCG/CGG in exons and 5’UTRs (8 daSTRs), (3) Unique repeat units in introns (5 daSTRs), and (4) CTG introns in 3’UTRs (3 daSTRs).”
Citations
Cites
Fast gapped-read alignment with Bowtie 2
Langmead, B., & Salzberg, S. L. (2012) · Nature Methods · doi:10.1038/nmeth.1923 · Cited by 56,400 · cited 1×
“…for CTCF peak 2 F: TCTTGTCTGGCCT GTATGGTTR: CCATATTGCACAATGCAGCTCT This paper N/A Software and Algorithms Bowtie/Bowtie2 Langmead et al., 2009; Langmead and Salzberg, 2012 http://bowtie-bio.sourceforge.net/ Python MACS Zhang et al., 2008 https://github.com/taoliu/MACS BEDTools Quinlan 2014…”
BackgroundUltrafast and memory-efficient alignment of short DNA sequences to the human genome.
Langmead, B., Trapnell, C., Pop, M., & Salzberg, S. L. (2009) · Genome Biology · doi:10.1186/gb-2009-10-3-r25 · Cited by 21,849
Model-based Analysis of ChIP-Seq (MACS)
Zhang, Y., Liu, T., Meyer, C. A., Eeckhoute, J., Johnson, D. S., Bernstein, B. E., Nusbaum, C., Myers, R. M., Brown, M., Li, W., et al. (2008) · Genome Biology · doi:10.1186/gb-2008-9-9-r137 · Cited by 18,386
MEME SUITE: tools for motif discovery and searching
Bailey, T. L., Boden, M., Buske, F. A., Frith, M., Grant, C. E., Clementi, L., Ren, J., Li, W. W., & Noble, W. S. (2009) · Nucleic Acids Research · doi:10.1093/nar/gkp335 · Cited by 10,648
A 3D Map of the Human Genome at Kilobase Resolution Reveals Principles of Chromatin Looping
Rao, S. S. P., Huntley, M. H., Durand, N. C., Stamenova, E. K., Bochkov, I. D., Robinson, J. T., Sanborn, A. L., Machol, I., Omer, A. D., Lander, E. S., et al. (2014) · Cell · doi:10.1016/j.cell.2014.11.021 · Cited by 9,212 · cited 1×
“Consistent with the established principles of CTCF motif convergency (Rao et al., 2014), the doublet CTCF sites contained CTCF motifs in the reverse orientation and looped to distal CTCF occupied motifs oriented in the forward direction (Figures 6C and 6D).”
BackgroundBolstad, B. M., Irizarry, R. A., Åstrand, M., & Speed, T. P. (2003) · Bioinformatics · doi:10.1093/bioinformatics/19.2.185 · Cited by 8,328
deepTools2: a next generation web server for deep-sequencing data analysis
Ramírez, F., Ryan, D. P., Grüning, B., Bhardwaj, V., Kilpert, F., Richter, A. S., Heyne, S., Dündar, F., & Manke, T. (2016) · Nucleic Acids Research · doi:10.1093/nar/gkw257 · Cited by 8,096 · cited 1×
“…matrix balancing Imakaev et al., 2012 https://github.com/hiclib/iced MEME Suite Bailey et al., 2009 http://meme-suite.org Quantile normalization Bolstad et al., 2003 https://www.ncbi.nlm.nih.gov/pubmed/ 12538238 deepTools Ramı́rez et al., 2016 https://github.com/deeptools/deepTools”
Topological domains in mammalian genomes identified by analysis of chromatin interactions
Dixon, J. R., Selvaraj, S., Yue, F., Kim, A., Li, Y., Shen, Y., Hu, M., Liu, J. S., & Ren, B. (2012) · Nature · doi:10.1038/nature11082 · Cited by 6,829 · cited 3×
“Mammalian genomes are organized into a hierarchy of megabase (Mb)-scale topologically associating domains (TADs) (Dixon et al., 2012; Nora et al., 2012) and smaller, nested subTADs (Dixon et al.”
BackgroundResultHistone H3K27ac separates active from poised enhancers and predicts developmental state
Creyghton, M. P., Cheng, A. W., Welstead, G. G., Kooistra, T., Carey, B. W., Steine, E. J., Hanna, J., Lodato, M. A., Frampton, G. M., Sharp, P. A., et al. (2010) · Proceedings of the National Academy of Sciences · doi:10.1073/pnas.1016071107 · Cited by 4,302 · cited 1×
“Finally, to better understand how the FXS topological changes might be connected to FMR1 trancriptional silencing, we mined published ChIP-seq data in GM12878 cells for H3K27ac, an established mark of active enhancers (Creyghton et al., 2010).”
MethodVerkerk, A. J. M. H., Pieretti, M., Sutcliffe, J. S., Fu, Y.-H., Kuhl, D. P. A., Pizzuti, A., Reiner, O., Richards, S., Victoria, M. F., Zhang, F., et al. (1991) · Cell · doi:10.1016/0092-8674(91)90397-h · Cited by 3,481 · cited 1×
“Boundary Disruption in Fragile X Syndrome Patients Correlates with FMR1 Silencing FXS is caused by the loss of the fragile X mental retardation protein (FMRP) encoded by FMR1 (Verkerk et al., 1991).”
Background
Flagged first, then by citations
Cited by
Sorted by citations
Items 101–200 of 259
Alpsoy, A., Sood, S., & Dykhuizen, E. C. (2021) · Biology · doi:10.3390/biology10040272 · Cited by 13
Jablonski, K. P., Carron, L., Mozziconacci, J., Forné, T., Hütt, M. ‐., & Lesne, A. (2022) · Human Genomics · doi:10.1186/s40246-022-00375-2 · Cited by 13
3D genome alterations and editing in pathology
Tiukacheva, E. A., Ulianov, S. V., Karpukhina, A. A., Razin, S. V., & Vassetzky, Y. S. (2023) · Molecular Therapy · doi:10.1016/j.ymthe.2023.02.005 · Cited by 14
Stratifying TAD boundaries pinpoints focal genomic regions of regulation, damage, and repair
Chen, B., Ren, C., Ouyang, Z., Xu, J., Xu, K., Li, Y., Guo, H., Bai, X., Tian, M., Xu, X., et al. (2024) · Briefings in Bioinformatics · doi:10.1093/bib/bbae306 · Cited by 11
Chromatin Domains Go on Repeat in Disease
Bruneau, B. G., & Nora, E. P. (2018) · Cell · doi:10.1016/j.cell.2018.08.068 · Cited by 11
Mosaicism in Short Tandem Repeat Disorders: A Clinical Perspective
Doss, R. M., Lopez-Ignacio, S., Dischler, A. M., Hiatt, L., Dashnow, H., Breuss, M. W., & Dias, C. (2025) · Genes · doi:10.3390/genes16020216 · Cited by 11
3D genome organization in the central nervous system, implications for neuropsychological disorders
Sun, D., Weng, J., Dong, Y., & Jiang, Y. (2021) · Journal of genetics and genomics/Journal of Genetics and Genomics · doi:10.1016/j.jgg.2021.06.017 · Cited by 10
CasSABER for Programmable In Situ Visualization of Low and Nonrepetitive Gene Loci
Li, Y., Huang, D., Pei, Y., Wu, Y., Xu, R., Quan, F., Gao, H., Zhang, J., Hou, H., Zhang, K., et al. (2023) · Analytical Chemistry · doi:10.1021/acs.analchem.2c04867 · Cited by 10
Location, location, location: nuclear structure regulates gene expression in neurons
Brookes, E., & Riccio, A. (2019) · Current Opinion in Neurobiology · doi:10.1016/j.conb.2019.03.009 · Cited by 9
Manor, E., Gonen, R., Sarussi, B., Keidar-Friedman, D., Kumar, J., Tang, H., & Tassone, F. (2019) · Molecular Genetics & Genomic Medicine · doi:10.1002/mgg3.946 · Cited by 9
“Recently, Sun et al. (2018) showed that disease‐associated tandem repeats are located to TAD boundaries and affect their insulation.”
BackgroundSelf-citationDiab, M. A., & Eiges, R. (2019) · Brain Sciences · doi:10.3390/brainsci9020042 · Cited by 10
Guo, Q., Chang, Y.-Y., Huang, C., Hsiao, Y.-S., Hsiao, Y.-C., Chiu, I.-F., Zhou, Y., Zhang, H., & Ko, T. (2021) · Journal of genetics and genomics/Journal of Genetics and Genomics · doi:10.1016/j.jgg.2021.04.012 · Cited by 9
Schreiber, A. M., Li, Y., Chen, Y., Napierala, J. S., & Напиерала, М. (2022) · Frontiers in Neuroscience · doi:10.3389/fnins.2022.836476 · Cited by 9
Dufour, B. D., Albores‐Gallo, L., Luna‐Muñoz, J., Hagerman, R. J., Miquelajáuregui, A., Buriticá, E., Saldarriaga, W., Pacheco‐Herrero, M., Silvestre‐Sosa, A. Y., Mazefsky, C. A., et al. (2021) · Brain Pathology · doi:10.1111/bpa.13019 · Cited by 9
Insights into Enhancer RNAs: Biogenesis and Emerging Role in Brain Diseases
Shen, Y., Huang, Z., Yang, R., Chen, Y., Wang, Q., & Gao, L. (2021) · The Neuroscientist · doi:10.1177/10738584211046889 · Cited by 10
Emerging regulatory mechanisms of noncoding RNAs in topologically associating domains
Yeo, S. J., Chen, Y., Fullwood, M. J., & Tergaonkar, V. (2023) · Trends in Genetics · doi:10.1016/j.tig.2022.12.003 · Cited by 7
Wang, X., Luo, J., Wu, L., Luo, H., & Guo, F. (2025) · Briefings in Bioinformatics · doi:10.1093/bib/bbaf127 · Cited by 8
Tau beyond Tangles: DNA Damage Response and Cytoskeletal Protein Crosstalk on Neurodegeneration
Asada‐Utsugi, M., & Urushitani, M. (2024) · International Journal of Molecular Sciences · doi:10.3390/ijms25147906 · Cited by 8
“In neurodevelopmental disorders such as Fragile X syndrome and Down syndrome, disruption of the 3D structure of the genome has also been demonstrated [44,45].”
BackgroundFISHnet: detecting chromatin domains in single-cell sequential Oligopaints imaging data
Patel, R. V., Pham, K., Chandrashekar, H., & Phillips‐Cremins, J. E. (2025) · Nature Methods · doi:10.1038/s41592-025-02688-1 · Cited by 8
Self-citationMacBeth, M., Joetham, A., Gelfand, E., & Schedel, M. (2021) · International Journal of Molecular Sciences · doi:10.3390/ijms22094582 · Cited by 7
3D Genome Plasticity in Normal and Diseased Neurodevelopment
Plaza-Jennings, A. L., Valada, A., & Akbarian, S. (2022) · Genes · doi:10.3390/genes13111999 · Cited by 7
Grapotte, M., Saraswat, M., Bessière, C., Menichelli, C., Ramilowski, J. A., Severin, J., Hayashizaki, Y., Itoh, M., Tagami, M., Murata, M., et al. (2020) · bioRxiv (Cold Spring Harbor Laboratory) · doi:10.1101/2020.07.10.195636 · Cited by 7
Gjoni, K., Ren, X., Everitt, A., Shen, Y., & Pollard, K. S. (2026) · Genome Research · doi:10.1101/gr.280394.124 · Cited by 7
“…(Symmons et al. 2016), X-Chromosome inactivation (van Bemmel et al. 2019), limb morphogenesis (Kragesteen et al. 2018), congenital malformations (Kraft et al. 2019), branchiooculofacial syndrome (Laugsch et al. 2019), Fragile X syndrome (Sun et al. 2018), and Cooks syndrome (Kurth et al. 2009).”
The significance of chromosome conformation capture in 3D genome architecture comprehension
Cetin, S., & Sefer, E. (2025) · Computational Biology and Chemistry · doi:10.1016/j.compbiolchem.2025.108534 · Cited by 8
Genome folding and refolding in differentiation and cellular senescence
Mizi, A., Zhang, S., & Papantonis, A. (2020) · Current Opinion in Cell Biology · doi:10.1016/j.ceb.2020.08.002 · Cited by 6
Multi-scale phase separation by explosive percolation with single-chromatin loop resolution
Sengupta, K., Denkiewicz, M., Chiliński, M., Szczepińska, T., Mollah, A. F., Korsak, S., D’Souza, R. M., Ruan, Y., & Plewczyński, D. (2022) · Computational and Structural Biotechnology Journal · doi:10.1016/j.csbj.2022.06.063 · Cited by 6
Detection of tandem repeats in the Capsicum annuum genome
Rudenko, V. M., & Korotkov, E. (2023) · DNA Research · doi:10.1093/dnares/dsad007 · Cited by 6
Disentangling chromatin architecture to gain insights into the etiology of brain disorders
Lamonica, J. M., & Zhou, Z. (2019) · Current Opinion in Genetics & Development · doi:10.1016/j.gde.2019.06.009 · Cited by 5
Characterization of network hierarchy reflects cell state specificity in genome organizationPreprint
Wang, J., Xue, Y., He, Y., Quan, H., Zhang, J., & Gao, Y. Q. (2023) · Genome Research · doi:10.1101/gr.277206.122 · Cited by 6
Gestational trophoblastic disease: STR genotyping for precision diagnosis
Rozenova, K., Buza, N., & Hui, P. (2025) · Expert Review of Molecular Diagnostics · doi:10.1080/14737159.2025.2453506 · Cited by 6
Association of human-specific expanded short tandem repeats with neuron-specific regulatory features
Liu, Q., & Tian, W. (2025) · Science Advances · doi:10.1126/sciadv.adp9707 · Cited by 5
“Such polymorphisms have been linked to changes in gene expression ( 17 , 18 ), alternative splicing ( 19 ), and various neurological disorders ( 20 , 21 ), including Fragile X syndrome ( 22 ), Huntington’s disease ( 23 ), and amyotrophic lateral sclerosis ( 24 ).”
Regulation of Genome Architecture in Huntington’s Disease
Portillo‐Ledesma, S., Hang, M., & Tamar Schlick, A. (2025) · Biochemistry · doi:10.1021/acs.biochem.5c00029 · Cited by 5
Epigenetics in intellectual disability
Jakub, T. E., Quesnel, K., Keung, C., Bérubé, N. G., & Kramer, J. M. (2021) · Elsevier eBooks · doi:10.1016/b978-0-12-823577-5.00030-1 · Cited by 5
A Novel Dolph-Chebyshev Filter for Prediction of Huntington’s Disease
Das, L., Dash, J., Nanda, S., Das, J. K., & Patnaik, S. (2024) · International Conference on Intelligent Computing and Sustainable Innovations in Technology (IC-SIT) · doi:10.1109/ic-sit63503.2024.10862127 · Cited by 5
Pandey, N., Chandra, O., Mishra, S., & Kumar, V. (2021) · Frontiers in Genetics · doi:10.3389/fgene.2021.738194 · Cited by 4
Spatially coordinated heterochromatinization of distal short tandem repeats in fragile X syndromePreprint
Zhou, L., Ge, C., Malachowski, T., Kim, J. H., Chandradoss, K. R., Chuanbin, S., Wu, H., Rojas, L. A., Wallace, O. B., Titus, K. R., et al. (2021) · bioRxiv (Cold Spring Harbor Laboratory) · doi:10.1101/2021.04.23.441217 · Cited by 5
“S3f-h) as previously reported in B cells and post-mortem brain tissue (24).”
BackgroundResultSelf-citationIgnatieva, E. V., & Matrosova, E. A. (2021) · Vavilov Journal of Genetics and Breeding · doi:10.18699/vj21.003 · Cited by 12
He, Y., Li, W., Li, L., Yang, Y., Lu, Y., Pan, Y., Wáng, Q., Sun, Y., Xie, Y., Wu, M., et al. (2025) · Advanced Genetics · doi:10.1002/ggn2.202500035 · Cited by 4
Tandem repeats in human brain evolution and disease susceptibility
Lee, H., & An, J. (2026) · Molecules and Cells · doi:10.1016/j.mocell.2026.100363 · Cited by 4
Hara, S., Matsuhisa, F., Kitajima, S., Yatsuki, H., Kubiura‐Ichimaru, M., Higashimoto, K., & Soejima, H. (2024) · Communications Biology · doi:10.1038/s42003-024-07323-x · Cited by 5
“This suggests that chromatin interactions through CTCF/cohesin binding may simultaneously de fi ne the TAD and DNA methylation boundary 29 .”
Opportunity to improve livestock traits using 3D genomics
MacPhillamy, C., Pitchford, W. S., Alinejad‐Rokny, H., & Low, W. Y. (2021) · Animal Genetics · doi:10.1111/age.13135 · Cited by 4
Short tandem repeats of human genome are intrinsically unstable in cultured cells in vivo
Liu, Y., Li, J., & Wu, Q. (2023) · Gene · doi:10.1016/j.gene.2023.147539 · Cited by 5
Tay, K. Y., Wu, K. X., Chioh, F. W., Autio, M. I., Pek, N. M. Q., Narmada, B. C., Tan, S. H., Low, A. F.-H., Lian, M. M., Chew, E. G. Y., et al. (2022) · Atherosclerosis · doi:10.1016/j.atherosclerosis.2022.10.012 · Cited by 4
Rybarikova, M., Rey, M. J., Hasanovic, E., Sipion, M., Rambousek, L., & Déglon, N. (2025) · Gene Therapy · doi:10.1038/s41434-025-00557-2 · Cited by 3
Computational tools for tandem repeat detection using long-read sequencing
Liu, Q., & Li, J. (2026) · Briefings in Bioinformatics · doi:10.1093/bib/bbag031 · Cited by 5
“These TRs regulate gene expression [7–12], influence chromatin structures [13–16] and affect genome stability [17–19].”
Tandem repeat variation shapes immune cell type-specific gene expression
Tanudisastro, H. A., Cuomo, A. S. E., Weisburd, B., Welland, M. J., Spenceley, E., Franklin, M., Xue, A., Huang, H. L., Bowen, B., Fan, J., et al. (2026) · Nature · doi:10.1101/2024.11.02.621562 · Cited by 14
Nanopore sequencing as a novel method of characterising anorexia nervosa risk loci
Berthold, N., Gaudieri, S., Hood, S. D., Tschochner, M., Miller, A. L., Jordan, J., Thornton, L. M., Bulik, C. M., Akkari, P. A., & Kennedy, M. A. (2024) · BMC Genomics · doi:10.1186/s12864-024-11172-7 · Cited by 4
“SVs have been associated with pathogenic and biological mechanisms, including accessibility of genetic regulatory regions, expression efficiency, chromatin formation, and three-dimensional structure interactions, such as topological associating domains [3–6].”
Nakayama, Y., Adachi, K., Shioda, N., Maeta, S., Nanba, E., & Kugoh, H. (2020) · Experimental Cell Research · doi:10.1016/j.yexcr.2020.112419 · Cited by 4
A comprehensive microsatellite landscape of human Y-DNA at kilobase resolution
Li, D., Pan, S., Zhang, H., Fu, Y., Peng, Z., Zhang, L., Peng, S., Xu, F., Huang, H., Shi, R., et al. (2021) · BMC Genomics · doi:10.1186/s12864-021-07389-5 · Cited by 3
Loops are geometric catalysts for DNA integration
Battaglia, C., & Michieletto, D. (2023) · bioRxiv · doi:10.1093/nar/gkae484 · Cited by 3
Weiner, D. J., Ling, E., Erdin, S., Tai, D. J. C., Yadav, R., Grove, J., Fu, J. M., Nadig, A., Carey, C. E., Baya, N., et al. (2022) · European Neuropsychopharmacology · doi:10.1016/j.euroneuro.2022.07.047 · Cited by 4
Three-dimensional chromosome architecture and drug addiction
Chitaman, J. M., Fraser, P., & Feng, J. (2019) · Current Opinion in Neurobiology · doi:10.1016/j.conb.2019.05.009 · Cited by 3
“For example, it was recently discovered that all known disease-associated short tandem repeats, such as those responsible for Fragile X syndrome, are located at the boundaries of 3D chromatin domains and that topological disruption of these boundaries may contribute the etiology of disease [42].”
BackgroundJakubosky, D. A., D’Antonio, M., Bonder, M. J., Smail, C., Donovan, M. K. R., Greenwald, W. W. Y., D’Antonio‐Chronowska, A., Matsui, H., Stegle, O., Smith, E. N., et al. (2019) · bioRxiv (Cold Spring Harbor Laboratory) · doi:10.1101/714477 · Cited by 3
The role of insulators and transcription in 3D chromatin organisation of fliesPreprint
Chathoth, K. T., Mikheeva, L. A., Crevel, G., Wolfe, J. C., Hunter, I., Beckett-Doyle, S., Cotterill, S., Dai, H., Harrison, A., & Zabet, N. R. (2021) · bioRxiv (Cold Spring Harbor Laboratory) · doi:10.1101/2021.04.26.441424 · Cited by 3
Laberthonnìère, C., Chevalier, R., Dion, C., Delourme, M., Hirst, D., Adélaı̈de, J., Chaffanet, M., Xue, S., Nguyen, K., Reversade, B., et al. (2021) · bioRxiv (Cold Spring Harbor Laboratory) · doi:10.1101/2021.05.17.444338 · Cited by 3
“Boundary disruption has been linked to cancer, diseases of limb development or linked to triplet expansions (Flavahan et al., 2016; Hnisz et al., 2016; Lupianez et al., 2015; Sun et al., 2018).”
BackgroundSingle-cell multiplex chromatin and RNA interactions in aging human brainPreprint
Wen, X., Luo, Z., Zhao, W., Calandrelli, R., Nguyen, T. C., Wan, X., Richard, J. L. C., & Zhong, S. (2023) · bioRxiv (Cold Spring Harbor Laboratory) · doi:10.1101/2023.06.28.546457 · Cited by 3
Learning induces persistent chromatin loops underlying robust gene expression during memory recallPreprint
Xu, P., Chandradoss, K. R., Lukasak, B. J., Paranjapye, A., Waldman, A. J., Pham, K., Ryu, H.-S., Liu, C., Titus, K. R., Sureka, R., et al. (2025) · bioRxiv (Cold Spring Harbor Laboratory) · doi:10.1101/2025.09.30.678146 · Cited by 3
Self-citationDischler, A. M., Avvaru, A. K., Lopez-Ignacio, S., Lau, C., Breuss, M. W., Martínez‐Cerdeño, V., Dashnow, H., & Dias, C. (2025) · bioRxiv (Cold Spring Harbor Laboratory) · doi:10.1101/2025.10.07.678589 · Cited by 3
STRAS:a snakemake pipeline for genome-wide short tandem repeats annotation and score
Zhang, M. (2024) · Human Genetics · doi:10.1007/s00439-024-02662-5 · Cited by 2
3D epigenomics and 3D epigenopathies
Lee, K., Kim, J. W., & Kim, J. H. (2024) · BMB Reports · doi:10.5483/bmbrep.2023-0249 · Cited by 3
Wu, Y., Zhang, C., Zhang, Y., Chen, R., Wang, L., Chang, H., Li, M., Xiao, X., & Li, S. L. (2024) · Psychiatry Research · doi:10.1016/j.psychres.2024.115929 · Cited by 2
Can abnormal chromatin folding cause high-penetrance cancer predisposition?
Schwartz, M. (2022) · Physiological Genomics · doi:10.1152/physiolgenomics.00052.2022 · Cited by 2
3D chromatin organization changes modulate adipogenesis and osteogenesisPreprint
Hao, R.-H., Guo, Y., Guo, J., Rong, Y., Yao, S., Chen, Y.-X., Dong, S., Zhu, D., Chen, H., & Yang, T.-L. (2020) · bioRxiv (Cold Spring Harbor Laboratory) · doi:10.1101/2020.05.25.114272 · Cited by 2
Fearnley, L. G., Bennett, M. F., & Bahlo, M. (2021) · bioRxiv (Cold Spring Harbor Laboratory) · doi:10.1101/2021.04.05.438449 · Cited by 2
RT2T: A Global Collaborative Project to Study Chromosomal Evolution in the Suborder RuminantiaPreprint
Kalbfleisch, T., McKay, S., Murdoch, B. M., Adelson, D. L., Almansa-Villa, D., Becker, G. M., Beckett, L. M., Benítez-Galeano, M. J., Biase, F. H., Casey, T., et al. (2024) · Research Square · doi:10.21203/rs.3.rs-3918604/v1 · Cited by 2
Biologic Significance of the Short Tandem Trinucleotide Repeats in the Androgen Receptor Gene
Bhasin, S. (2024) · The Journal of Clinical Endocrinology & Metabolism · doi:10.1210/clinem/dgae505 · Cited by 2
Pham, K., Malachowski, T., Zhou, L., Kim, J. H., Chuanbin, S., & Phillips‐Cremins, J. E. (2025) · bioRxiv (Cold Spring Harbor Laboratory) · doi:10.1101/2025.03.19.644148 · Cited by 2
“We performed qRT-PCR as previously described ( 23, 24 ).”
Self-citationDRED: A Comprehensive Database of Genes Related to Repeat Expansion Diseases
Shi, Q., Dai, M., Ma, Y., Liu, J., Liu, X., & Wang, X. (2024) · Genomics Proteomics & Bioinformatics · doi:10.1093/gpbjnl/qzae068 · Cited by 1
“…factors at the cis -regulation level could promote the expansion of STRs, including adjacent to CpG islands [24], mutations in adjacent CCCTC-binding factor (CTCF) binding sites [25], as well as the presence of nearby Alu elements [26,27] or topological associating domains (TAD) boundaries [28].”
BackgroundBeyond the Synapse: FMR1 and FMRP Molecular Mechanisms in the Nucleus
Hansen, N. A., Dischler, A. M., & Dias, C. (2024) · International Journal of Molecular Sciences · doi:10.3390/ijms26010214 · Cited by 1
“The subsequent loss of CTCF at FMR1 is correlated with the degree of FMR1 silencing [100].”
InfluentialContrasting Effects of Molecular Crowding on Trinucleotide-Repeat DNA Hairpins
Martini, D., Anderson, J., Garcia, G., & Cannon, B. L. (2025) · The Journal of Physical Chemistry B · doi:10.1021/acs.jpcb.5c06024 · Cited by 1
Engineering the Link: From Genome Interaction Maps to Functional Insight
Petersen, F., Westermann, S., Smialkovska, V., Mathony, J., Feldmann, A., & Niopek, D. (2025) · Advanced Biology · doi:10.1002/adbi.202500525 · Cited by 2
Analyzing Biomedical Signals for Huntington’s disease Prediction A Signal Processing Approach
Das, L., Nanda, S., Dash, J., Kar, T., & Parija, S. (2025) · International Conference on Circuits, Power and Intelligent Systems (CCPIS) · doi:10.1109/ccpis65231.2025.11233929 · Cited by 1
DNA repeats: origins, conservation, and role in human disease
Rana, A. K. (2026) · Genome Instability & Disease · doi:10.1007/s42764-025-00174-8 · Cited by 1
Single-cell multiomics connects 3D genome and transcriptome alterations in Alzheimer’s disease
Zhang, Y., Lu, X., Kunisky, A. K., Alam, S., Tang, J., Zhang, R., Wang, S., Zhang, H. H., Baroudi, J. K., Ichcho, W., et al. (2026) · Science · doi:10.1126/science.adz1652 · Cited by 3
The contribution of human pluripotent stem cells to the study of myotonic dystrophy type 1
Handal, T., & Eiges, R. (2020) · Elsevier eBooks · doi:10.1016/b978-0-12-822227-0.00008-9 · Cited by 1
Mismatch Repair Status Characterization as an Immune-Related Biomarker in Oncology
Fusco, N., & Venetis, K. (2023) · Springer eBooks · doi:10.1007/978-3-030-80962-1_137-1 · Cited by 1
Short, but matters: short tandem repeats confer variation in transcription factor-DNA binding
Zhang, J., & Zhu, B. (2023) · 中国科学通报：英文版 · doi:10.1016/j.scib.2023.11.050 · Cited by 1
Genome structure could be key factor in some forms of autism
Guglielmi, G. (2024) · The Transmitter · doi:10.53053/knjq6161 · Cited by 1
Ning, M., Song, L., Niu, X., Wang, Y., Liu, W., Hu, J., Cai, H., Song, W., Liu, L., Li, H., et al. (2024) · International Journal of Biological Macromolecules · doi:10.1016/j.ijbiomac.2024.132452 · Cited by 2
Magdinier, F., & Robin, J. D. (2022) · Elsevier eBooks · doi:10.1016/b978-0-323-91909-8.00003-7 · Cited by 1
Relatively semi-conservative replication and a folded slippage model for simple sequence repeatsPreprint
Zhang, H., Li, D., Zhao, X., Pan, S., Wu, X., Peng, S., Huang, H., Shi, R., & Tan, Z. (2020) · bioRxiv (Cold Spring Harbor Laboratory) · doi:10.1101/2020.02.28.970814 · Cited by 1
“Most of new occurring repeats should be lethal mutation and may have been negatively selected to lost; some of new occurring repeats should be deleterious in genomes and responsible for a series of diseases [69, 70, 72, 73]; many neutral repeat expansions may be lost or fixed with no functions in genomes by genetic dr…”
BackgroundCONTEXT-INDEPENDENT FUNCTION OF A CHROMATIN BOUNDARY IN VIVOPreprint
Willemin, A., Lopez‐Delisle, L., Bolt, C. C., Gadolini, M.-L., Duboule, D., & Rodríguez-Carballo, E. (2021) · bioRxiv (Cold Spring Harbor Laboratory) · doi:10.1101/2021.02.11.430727 · Cited by 1
Contribution of 3D genome topological domains to genetic risk of cancersPreprint
Jablonski, K. P., Carron, L., Mozziconacci, J., Forné, T., Hütt, M. ‐., & Lesne, A. (2021) · bioRxiv (Cold Spring Harbor Laboratory) · doi:10.1101/2021.07.26.453813 · Cited by 1
“, in [19, 24] which is the—not always existing—linker region between two successive TADs along the genome (not belonging to any TAD), whereas a TAD will always have two borders.”
RT2T: A Global Collaborative Project to Study Chromosomal Evolution in the Suborder RuminantiaPreprint
Kalbfleisch, T., McKay, S., Murdoch, B. M., Adelson, D. L., Almansa-Villa, D., Becker, G. M., Beckett, L. M., Benítez-Galeano, M. J., Biase, F. H., Casey, T., et al. (2024) · Research Square · doi:10.21203/rs.3.rs-3918604/v2 · Cited by 1
C9orf72 expansion creates the unstable folate-sensitive fragile site FRA9APreprint
Mirceta, M., Schmidt, M. H. M., Shum, N., Prasolava, T. K., Meikle, B., Lanni, S., Mohiuddin, M., McKeever, P. M., Zhang, M., Liang, M., et al. (2024) · bioRxiv (Cold Spring Harbor Laboratory) · doi:10.1101/2024.10.26.620312 · Cited by 1
Uyan, Ö., Sambare, S., Oomen, M. E., Wightman, N., Schooley, A., Klim, J. R., Belaghzal, H., Aydemir, Ö., Oksuz, B. A., USLU, Z. S. A., et al. (2025) · bioRxiv (Cold Spring Harbor Laboratory) · doi:10.1101/2025.09.22.677835 · Cited by 1
Anderson, R., Soni, T., & Jain, A. (2025) · bioRxiv (Cold Spring Harbor Laboratory) · doi:10.1101/2025.10.20.683480 · Cited by 1
“This complexity is further enhanced upon repeat expansions, which can remodel local chromatin architecture and influence TAD boundaries 83 .”
Zheng, Y., Ay, F., & Keleş, S. (2018) · bioRxiv (Cold Spring Harbor Laboratory) · doi:10.1101/301705
Pandey, N., Chandra, O., Mishra, S. V., & Kumar, V. (2020) · bioRxiv (Cold Spring Harbor Laboratory) · doi:10.1101/2020.12.29.424732
“Similarly, many short tandem repeat define boundaries of topologically associated domain (TADs) which tend to be conserved across different cell types (9).”
Backgroundvan Steensel, B. (2019) · Faculty Opinions – Post-Publication Peer Review of the Biomedical Literature · doi:10.3410/f.736388530.793565996
Drouin‐Ouellet, J., Li, D., Lu, Y. R., & Echegaray, C. V. (2022) · Cellular Reprogramming · doi:10.1089/cell.2022.0105
“…(FXS), where a CGG-repeat tract located at the 5 ¢ end of the FMR1 gene on the X chromosome is expanded, the chromosome repeats attract DNA methylases and form heterochromatin domains, disrupting loops/subTADs in FXS patients and affecting gene expression (Sun et al, 2018; Zhou et al, 2021).”
Systematic inspection of genomic tandem repeats and rearrangements in autism model
Arslan, A. (2022) · Brain Disorders · doi:10.1016/j.dscb.2022.100059
Practical application of massively parallel reporter assay in biotechnology and medicine
Romanov, S. E., & Laktionov, P. P. (2023) · Journal of clinical practice · doi:10.17816/clinpract115063
Short Tandem Repeat DNA Profiling Using Perylene-Oligonucleotide Fluorescence Assay
Bustos, A. H., Martiny, E., Pedersen, N. B., Parvathaneni, R. P., Hansen, J. T., Ji, H. P., & Astakhova, K. (2023) · Analytical Chemistry · doi:10.1021/acs.analchem.3c00063 · Cited by 1
Collar-Fernández, C., Hoffmann, L. B., Fennell, K. A., Pang, T. Y., & Hannan, A. J. (2023) · Elsevier eBooks · doi:10.1016/b978-0-12-823937-7.00006-7
ระบบสนบสนนการจดเกบและวเคราะหขอมลลำดบซำเรยงตอเนองแบบสนสำหรบนตวทยาศาสตร
กุลธรรมนิตย์, ณ. (2022) · doi:10.58837/chula.the.2022.862
Huang, X., Zhu, L., Zhang, X., & Wang, M. (2023) · BIO-PROTOCOL · doi:10.21769/bioprotoc.4879
Lü, J., Toro, C., Adams, D. R., Undiagnosed Diseases Network, Acosta, M. T., Adam, M. P., Alvarez, R. L., Alvey, J. C., Amendola, L. M., Andrews, A., et al. (2024) · BMC Genomics · doi:10.1186/s12864-023-09935-9
Additional file 1 of A comprehensive microsatellite landscape of human Y-DNA at kilobase resolution
Li, D., Pan, S., Zhang, H., Fu, Y., Peng, Z., Zhang, L., Peng, S., Xu, F., Huang, H., Shi, R., et al. (2021) · Figshare · doi:10.6084/m9.figshare.13632767
Additional file 4 of A comprehensive microsatellite landscape of human Y-DNA at kilobase resolution
Li, D., Pan, S., Zhang, H., Fu, Y., Peng, Z., Zhang, L., Peng, S., Xu, F., Huang, H., Shi, R., et al. (2021) · Figshare · doi:10.6084/m9.figshare.13632776
Metadata
- Authors
- Sun, J. H., Zhou, L., Emerson, D. J., Phyo, S. A., Titus, K. R., Gong, W., Gilgenast, T. G., Beagan, J. A., Davidson, B. L., Tassone, F., & Phillips-Cremins, J. E.
- Affiliations
- University of Pennsylvania (US)
- Children's Hospital of Philadelphia (US)
- University of California, Davis (US)
- ORCID
- Venue
- Cell
- Publisher
- Elsevier BV
- Published
- 2018-09
- Volume
- 175
- Issue
- 1
- Pages
- 224-238.e15
- ISSN
- 0092-8674 (ISSN-L)
- PMC
- PMC6175607
- OpenAlex
- W2889421335
- Semantic Scholar
- 68a0a360b6754c0c8f9f272f6ff06cd5b60de52a
- Cited by
- 249
- References
- 67
- Citations by year
- 2026: 12 · 2025: 24 · 2024: 42 · 2023: 26 · 2022: 41 · 2021: 41 · 2020: 28 · 2019: 32 · 2018: 3
- FWCI
- 12.41
- Type
- journal article
- Language
- en
- Open access
- bronze
- doi.org
- Licence
- Locations
- Cell (publishedVersion)
- PubMed (publishedVersion)
- Europe PMC (PubMed Central) (acceptedVersion)
- PubMed Central (acceptedVersion)
- eScholarship (California Digital Library) (submittedVersion)
- Funders
- The New York Stem Cell Foundation
- Alfred P. Sloan Foundation
- NIH Director’s New Innovator Award (1DP2MH11024701)
- 4D Nucleome Common Fund (1U01HL12999801)
- NIH (R01 GM113929)
- NSF-NIGMS (1562665)
- Topics
- Life Sciences › Neuroscience › Cellular and Molecular Neuroscience › Genetic Neurodegenerative Diseases
- Life Sciences › Biochemistry, Genetics and Molecular Biology › Molecular Biology › Genomics and Chromatin Dynamics
- Life Sciences › Biochemistry, Genetics and Molecular Biology › Genetics › Genetics and Neurodevelopmental Disorders
- Keywords
- microsatellite markers, repeat expansion disorders, chromatin domain boundaries, CpG islands, fragile X syndrome, chromatin topology
- MeSH terms
- CCCTC-Binding Factor, Adult, Brain, Cell Line, Chromatin, Disease, DNA, Female, Fragile X Syndrome, Humans, Male, Genome, Human, Microsatellite Repeats, CpG Islands, Trinucleotide Repeat Expansion, Chromatin Assembly and Disassembly, Fragile X Messenger Ribonucleoprotein 1
About these checks
Registry, retraction, Cites and statistics results are computed, not judged, with one exception: a printed reference that no index lists is read once by a model before it counts as a citation error. Claims are extracted by a model and kept only when their quote appears verbatim in the text; each cited source is then checked, with a model’s help, for whether it says what the claim relies on. Those verdicts can be wrong — read the claim’s quote and the cited source before relying on one.
A language model drew the claims from the paper on 2026-10-10, under version 3 of the claim definition (model deepseek-v4.1-flash, prompt extract-v3).
A second model labelled each claim on 2026-10-10 (model jev-1.13-20260917, definition revision gold-guideline-v0.2).
Statistics and arithmetic are recomputed, not judged.
Confidence bands are shown only for fields calibrated on our annotated test set. None is calibrated yet, so no band is shown.
What counts as a claim ›How we measure confidence ›How we check this ›
Are you an author, or do you see a problem with this page? Request a review
