Cited by 259Genetic Neurodegenerative DiseasesGenomics and Chromatin DynamicsGenetics and Neurodevelopmental Disorders

The DOI matches its Crossref record; 66 of the 67 references it cites were found in a registry or an index; none of the 56 sources its claims cite is checked for support yet.

Disease-Associated Short Tandem Repeats Co-localize with Chromatin Domain Boundaries

Open access

Sun, James H., Zhou, Linda, Emerson, Daniel J., Phyo, Sai A., Titus, Katelyn R., Gong, Wanfeng, Gilgenast, Thomas G., Beagan, Jonathan A., Davidson, Beverly L., Tassone, Flora, Phillips-Cremins, Jennifer E.·2018·Cell

DOI 10.1016/j.cell.2018.08.005PMC PMC6175607

Open this paper in CoChat — free account Open PDF

Abstract

Summary More than 25 inherited human disorders are caused by the unstable expansion of repetitive DNA sequences termed short tandem repeats (STRs). A fundamental unresolved question is why some STRs are susceptible to pathologic expansion, whereas thousands of repeat tracts across the human genome are relatively stable. Here, we discover that nearly all disease-associated STRs (daSTRs) are located at boundaries demarcating 3D chromatin domains. We identify a subset of boundaries with markedly higher CpG island density compared to the rest of the genome. daSTRs specifically localize to ultra-high-density CpG island boundaries, suggesting they might be hotspots for epigenetic misregulation or topological disruption upon STR expansion. Fragile X Syndrome patients exhibit severe boundary disruption in a manner that correlates with local loss of CTCF occupancy and the degree of FMR1 silencing. Our data uncover higher-order chromatin architecture as a new dimension in understanding repeat expansion disorders.

AI snapshot

Written from the paper’s full text.

TL;DR

Nearly all disease-associated short tandem repeats (daSTRs) localize to 3D chromatin domain boundaries, especially boundaries with ultra-high CpG island density and high CTCF occupancy. In Fragile X syndrome, the FMR1 boundary is disrupted in patients, correlating with local CTCF loss and FMR1 silencing.

Key findings

22 of 27 daSTR loci localized to human ES cell boundaries, including 11 at TAD boundaries and 11 at subTAD boundaries; 21 of 23 neurological daSTRs localized to boundaries in human fetal cortical plate tissue.
daSTRs were significantly closer to domain boundaries than matched normal-length repeats (0 bp versus 5,203 bp median; P = 0.00074 Mann-Whitney U; P = 0.0037 Kolmogorov-Smirnov) and enriched at boundaries (odds ratio = 4.77, Fisher’s exact P = 0.00056).
daSTRs localized to CpG island-rich boundaries more than matched repeats (odds ratio = 10.4, P = 1.4E-8), with 65.7% of daSTRs at CpG island-rich boundaries versus 22.0% of matched repeats; no significant difference was found at CpG island-depleted boundaries or non-boundary CpG islands.
In Fragile X syndrome patient samples, the FMR1 TAD boundary was ablated, a CTCF doublet ~100 kb upstream was lost, and boundary disruption correlated with FMR1 silencing; these topological changes occurred in at least three cell types and four patients.

Methods

Analyzed published Hi-C data from human ES cells and human fetal cortical plate tissue, using DI+HMM for Mb-scale TADs and 3DNetMod for nested subTADs; daSTRs were mapped in hg19 and compared with normal-length repeats matched by repeat sequence, length range, and gene body placement.
Performed 5C, CTCF ChIP-seq, qRT-PCR for FMR1 expression, and Sanger sequencing in Fragile X syndrome patient and control B-lymphocytes, fibroblasts, and postmortem brain tissue.
Used Fisher’s exact, Kolmogorov-Smirnov, Cochran–Mantel–Haenszel, randomization, and bootstrapped tests to assess boundary localization and CpG island density.

Limitations

The paper states it does not aim to identify specific genetic variants predicting which individuals develop repeat expansion disorders, and that cause-and-effect relationships among boundary disruption, DNA methylation, CTCF occupancy, CpG islands, STR expansion, and gene expression remain unresolved.
The paper notes that statistical power was restricted by small daSTR class sizes, and that rigorous thresholds likely missed some visually evident boundaries, making boundary enrichment estimates conservative.
Evident from the text: the Fragile X syndrome topological analyses rely on a small number of patient samples and cell types, and the link between boundary disruption and FMR1 silencing is correlative rather than causal.

Model-written summary. Check it against the paper before relying on it.

Integrity signals

Registry

Crossref · 10.1016/j.cell.2018.08.005

Cites

66 of 67 references verified0 citation errors · 1 not checkable

Statistics

Nothing to recompute.

Claims the paper makes

0 of 56 cited sources checked · 0 supported · 0 flagged

None of the sources cited for this claim have been checked yet.
In the paper
“Notably, a large number of daSTRs known to undergo paternal instability (McMurray, 2010; Pearson et al., 2005) co-localized to boundaries in mouse sperm and not in mouse oocytes (Du et al., 2017), suggesting that daSTRs could be at boundaries when germ line expansion takes place (Figure S3).”
§ Disease-associated short tandem repeats co-localize with chromatin domain boundaries > Results > daSTRs co-localize with TADs that are invariant across somatic cell types
What the sources say
- Not checked yetcites McMurray, 2010 source
- Not checked yetcites Pearson et al., 2005 source
- Not checked yetcites Du et al., 2017
Load-bearingStrength:plain· not yet calibratedCausal:correlational· not yet calibrated
Tests✓ Asserted: passes✓ Checkable: passes✓ Load-bearing: passes✓ Based: passes
None of the sources cited for this claim have been checked yet.
In the paper
“Consistent with previous reports, we found enrichment for the architectural protein CCCTC-binding factor (CTCF) at human ES cell boundaries compared to loci internal to domains (Figure S6A-B) (Dixon et al., 2012; Nora et al., 2012; Phillips-Cremins et al., 2013).”
§ Disease-associated short tandem repeats co-localize with chromatin domain boundaries > Results > Boundaries containing daSTRs are characterized by ultra-high density of CpG islands
What the sources say
- Not checked yetcites Dixon et al., 2012 source
- Not checked yetcites Nora et al., 2012 source
- Not checked yetcites Phillips-Cremins et al., 2013 source
Strength:plain· not yet calibratedCausal:correlational· not yet calibrated
Tests✓ Asserted: passes✓ Checkable: passes? Load-bearing: unclear✓ Based: passes
None of the sources cited for this claim have been checked yet.
In the paper
“Boundary disruption has recently been linked to cancer and diseases of limb development (Flavahan et al., 2016; Hnisz et al., 2016; Lupianez et al., 2015)”
§ Disease-associated short tandem repeats co-localize with chromatin domain boundaries > Introduction
What the sources say
- Not checked yetcites Flavahan et al., 2016 source
- Not checked yetcites Hnisz et al., 2016 source
- Not checked yetcites Lupianez et al., 2015 source
Load-bearingStrength:plain· not yet calibratedCausal:correlational· not yet calibrated
Tests✓ Asserted: passes✓ Checkable: passes✓ Load-bearing: passes✓ Based: passes
A conclusion the paper draws from its own results — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“Thus, although the target cell type(s) for many unstable repeat expansion disorders are unknown, the strong enrichment at boundaries regardless of tissue origin suggests that daSTR co-localization with boundaries might be robust across cell types relevant for the pathology.”
§ Disease-associated short tandem repeats co-localize with chromatin domain boundaries > Results > daSTRs linked to neurological disorders co-localize with boundaries in human cortical tissue
Load-bearingStrength:hedged· not yet calibratedCausal:correlational· not yet calibrated
Tests✓ Asserted: passes✓ Checkable: passes✓ Load-bearing: passes✓ Based: passes
- Rests on an assumption: Domain boundaries called in human ES cells and fetal cortical plate are relevant to the cell types of pathology for all daSTRs.
A conclusion the paper draws from its own results — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“Together, our analyses indicate that the majority of daSTRs currently reported as susceptible to unstable expansion in human disease are spatially co-localized to boundaries of 3D genome domains in human ES cells (Figure 1C).”
§ Disease-associated short tandem repeats co-localize with chromatin domain boundaries > Results > daSTRs co-localize with chromatin domain boundaries in human ES cells
Load-bearingStrength:hedged· not yet calibratedCausal:correlational· not yet calibrated
Tests✓ Asserted: passes✓ Checkable: passes✓ Load-bearing: passes✓ Based: passes
- Rests on an assumption: Mapping daSTRs to normal-length repeat tracts in the hg19 reference genome is representative of disease-associated STR loci.
None of the sources cited for this claim have been checked yet.
In the paper
“Our observations add a 3D component to the locus-specific evidence that STR instability is linked to alterations of CTCF occupancy (Brock et al., 1999; Cleary et al., 2010; Filippova et al., 2001; Libby et al., 2008; Sopher et al., 2011).”
§ Disease-associated short tandem repeats co-localize with chromatin domain boundaries > Discussion
What the sources say
- Not checked yetcites Brock et al., 1999 source
- Not checked yetcites Cleary et al., 2010 source
- Not checked yetcites Filippova et al., 2001 source
Load-bearingStrength:plain· not yet calibratedCausal:correlational· not yet calibratedSingle case
Tests✓ Asserted: passes✓ Checkable: passes✓ Load-bearing: passes✓ Based: passes
In the paper
“Disruption of a CTCF binding site at the Atxn7 locus leads to increased somatic and germline repeat instability in a transgenic mouse model of spinocerebellar ataxia 7 (Libby et al., 2008).”
§ Disease-associated short tandem repeats co-localize with chromatin domain boundaries > Discussion
What the sources say
- Not checked yetcites Libby et al., 2008 source
Load-bearingStrength:plain· not yet calibratedCausal:direct· not yet calibrated
Tests✓ Asserted: passes✓ Checkable: passes✓ Load-bearing: passes✓ Based: passes
None of the sources cited for this claim have been checked yet.
In the paper
“Studies in model organisms show that mutations in genes encoding key machinery involved in DNA replication, repair, and recombination are linked to STR instability (Iyer et al., 2015; McMurray, 2010; Mirkin, 2007; Pearson et al., 2005).”
§ Disease-associated short tandem repeats co-localize with chromatin domain boundaries > Discussion
What the sources say
- Not checked yetcites Iyer et al., 2015 source
- Not checked yetcites McMurray, 2010 source
- Not checked yetcites Mirkin, 2007 source
Load-bearingStrength:plain· not yet calibratedCausal:correlational· not yet calibrated
Tests✓ Asserted: passes✓ Checkable: passes✓ Load-bearing: passes✓ Based: passes
A conclusion the paper draws from its own results — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“Thus, daSTRs localized between constitutive TADs are likely to be placed at boundaries in the specific cell type(s) of origin relevant to each repeat expansion disorders.”
§ Disease-associated short tandem repeats co-localize with chromatin domain boundaries > Discussion
Load-bearingStrength:hedged· not yet calibratedCausal:correlational· not yet calibrated
Tests✓ Asserted: passes✓ Checkable: passes✓ Load-bearing: passes✓ Based: passes
- Rests on an assumption: Domain boundaries called in human ES cells and fetal cortical plate are relevant to the cell types of pathology for all daSTRs.

It may state two separate claims as one. 26
Probably not a substantial claim. 32
The quote only partly states this claim. 1

In the paper
“Consistent with the established principles of CTCF motif convergency (Rao et al., 2014), the doublet CTCF sites contained CTCF motifs in the reverse orientation and looped to distal CTCF occupied motifs oriented in the forward direction (Figure 6C-D).”
§ Disease-associated short tandem repeats co-localize with chromatin domain boundaries > Results > CTCF occupancy at the FMR1 daSTR is ablated in Fragile X Syndrome
What the sources say
- Not checked yetcites Rao et al., 2014 source
Strength:boosted· not yet calibratedCausal:correlational· not yet calibrated
Tests✓ Asserted: passes✓ Checkable: passes? Load-bearing: unclear✓ Based: passes
It may state two separate claims as one.
None of the sources cited for this claim have been checked yet.
In the paper
“Mammalian genomes are organized into a hierarchy of Megabase (Mb)-scale topologically associating domains (TADs) (Dixon et al., 2012; Nora et al., 2012) and smaller, nested subTADs (Dixon et al., 2012; Nora et al., 2012; Phillips-Cremins et al., 2013; Rao et al., 2014).”
§ Disease-associated short tandem repeats co-localize with chromatin domain boundaries > Introduction
What the sources say
- Not checked yetcites Dixon et al., 2012 source
- Not checked yetcites Nora et al., 2012 source
- Not checked yetcites Rao et al., 2014 source
Load-bearingStrength:plain· not yet calibrated
Tests✓ Asserted: passes✓ Checkable: passes✓ Load-bearing: passes✓ Based: passes
Probably not a substantial claim.
None of the sources cited for this claim have been checked yet.
In the paper
“By a process that is poorly understood, a small number of specific normal-length STRs undergo somatic or germline expansion and transition to intermediate, pre-mutation, and mutation (affected) repeat unit tract lengths (Mirkin, 2007; Pearson et al., 2005).”
§ Disease-associated short tandem repeats co-localize with chromatin domain boundaries > Introduction
What the sources say
- Not checked yetcites Mirkin, 2007 source
- Not checked yetcites Pearson et al., 2005 source
Strength:plain· not yet calibratedCausal:direct· not yet calibrated
Tests✓ Asserted: passes✓ Checkable: passes✗ Load-bearing: fails✓ Based: passes
Probably not a substantial claim. The paper’s conclusions may not depend on it.
None of the sources cited for this claim have been checked yet.
In the paper
“Such chromatin domains span >90% of the genome and are thought to create insulated neighborhoods demarcating the search space of specific long-range interactions between enhancers and their target genes (Dowen et al., 2014; Narendra et al., 2015; Symmons et al., 2014).”
§ Disease-associated short tandem repeats co-localize with chromatin domain boundaries > Introduction
What the sources say
- Not checked yetcites Dowen et al., 2014 source
- Not checked yetcites Narendra et al., 2015 source
- Not checked yetcites Symmons et al., 2014 source
Load-bearingStrength:hedged· not yet calibrated
Tests✓ Asserted: passes✓ Checkable: passes✓ Load-bearing: passes✓ Based: passes
Probably not a substantial claim. It may state two separate claims as one.
In the paper
“Normal-length STR tracts are generally stable across generations and among somatic tissues in the same individual (McMurray, 2010).”
§ Disease-associated short tandem repeats co-localize with chromatin domain boundaries > Introduction
What the sources say
- Not checked yetcites McMurray, 2010 source
Load-bearingStrength:plain· not yet calibrated
Tests✓ Asserted: passes✓ Checkable: passes✓ Load-bearing: passes✓ Based: passes
Probably not a substantial claim. It may state two separate claims as one.
In the paper
“daSTRs consist predominantly of a trinucleotide unit, but expandable tetra-, penta-, and hexa-nucleotide repeat sequences have also been reported (Iyer et al., 2015).”
§ Disease-associated short tandem repeats co-localize with chromatin domain boundaries > Introduction
What the sources say
- Not checked yetcites Iyer et al., 2015 source
Strength:plain· not yet calibrated
Tests✓ Asserted: passes✓ Checkable: passes✗ Load-bearing: fails✓ Based: passes
Probably not a substantial claim. The paper’s conclusions may not depend on it. It may state two separate claims as one.
None of the sources cited for this claim have been checked yet.
In the paper
“Pre-mutation and mutation lengths vary widely among the repeat expansion disorders (Iyer et al., 2015; McMurray, 2010).”
§ Disease-associated short tandem repeats co-localize with chromatin domain boundaries > Introduction
What the sources say
- Not checked yetcites Iyer et al., 2015 source
- Not checked yetcites McMurray, 2010 source
Strength:plain· not yet calibrated
Tests✓ Asserted: passes✓ Checkable: passes✗ Load-bearing: fails✓ Based: passes
Probably not a substantial claim. The paper’s conclusions may not depend on it.
None of the sources cited for this claim have been checked yet.
In the paper
“Healthy individuals have tens of thousands of relatively short STR tracts distributed throughout their genomes (Gymrek and Erlich, 2013; Gymrek et al., 2016; Willems et al., 2017).”
§ Disease-associated short tandem repeats co-localize with chromatin domain boundaries > Introduction
What the sources say
- Not checked yetcites Gymrek and Erlich, 2013
- Not checked yetcites Gymrek et al., 2016 source
- Not checked yetcites Willems et al., 2017 source
Strength:plain· not yet calibrated
Tests✓ Asserted: passes✓ Checkable: passes✗ Load-bearing: fails✓ Based: passes
Probably not a substantial claim. The paper’s conclusions may not depend on it.
In the paper
“daSTRs also exhibit a wide range of repeat unit sequences and can be localized across the gene body in introns, exons, promoters and 3’/5’ untranslated regions (UTRs) (La Spada and Taylor, 2010).”
§ Disease-associated short tandem repeats co-localize with chromatin domain boundaries > Introduction
What the sources say
- Not checked yetcites La Spada and Taylor, 2010
Strength:plain· not yet calibrated
Tests✓ Asserted: passes✓ Checkable: passes✗ Load-bearing: fails✓ Based: passes
Probably not a substantial claim. The paper’s conclusions may not depend on it. It may state two separate claims as one.
None of the sources cited for this claim have been checked yet.
In the paper
“More than 25 inherited human disorders are caused by the unstable expansion of repetitive DNA sequences termed short tandem repeats (STRs).”
§ Disease-associated short tandem repeats co-localize with chromatin domain boundaries > Abstract
What the sources say
- Not checked yetcites La Spada and Taylor, 2010
- Not checked yetcites McMurray, 2010 source
- Not checked yetcites Mirkin, 2007 source
Strength:plain· not yet calibratedCausal:direct· not yet calibrated
Tests✓ Asserted: passes✓ Checkable: passes✗ Load-bearing: fails✓ Based: passes
Probably not a substantial claim. The paper’s conclusions may not depend on it.
In the paper
“CpG islands are generally hypomethylated in normal somatic cells and can acquire aberrant hypermethylation in disease (Robertson, 2005).”
§ Disease-associated short tandem repeats co-localize with chromatin domain boundaries > Results > TAD boundary at the FMR1 daSTR is ablated in Fragile X Syndrome
What the sources say
- Not checked yetcites Robertson, 2005 source
Load-bearingStrength:plain· not yet calibratedCausal:correlational· not yet calibrated
Tests✓ Asserted: passes✓ Checkable: passes✓ Load-bearing: passes✓ Based: passes
Probably not a substantial claim. It may state two separate claims as one.
In the paper
“The mutation-length CGG STR acquires DNA methylation, which is thought to cause FMR1 silencing (Park et al., 2015).”
§ Disease-associated short tandem repeats co-localize with chromatin domain boundaries > Results > Boundary disruption in Fragile X Syndrome patients correlates with FMR1 silencing
What the sources say
- Not checked yetcites Park et al., 2015 source
Strength:hedged· not yet calibratedCausal:conditional· not yet calibrated
Tests✓ Asserted: passes✓ Checkable: passes✗ Load-bearing: fails✓ Based: passes
Probably not a substantial claim. The paper’s conclusions may not depend on it. It may state two separate claims as one.
None of the sources cited for this claim have been checked yet.
In the paper
“Moreover, CpG islands are aberrantly hypermethylated in a subset of cancers that exhibit microsatellite instability (Sharma et al., 2010; You and Jones, 2012).”
§ Disease-associated short tandem repeats co-localize with chromatin domain boundaries > Discussion
What the sources say
- Not checked yetcites Sharma et al., 2010 source
- Not checked yetcites You and Jones, 2012
Strength:plain· not yet calibratedCausal:correlational· not yet calibrated
Tests✓ Asserted: passes✓ Checkable: passes✗ Load-bearing: fails✓ Based: passes
Probably not a substantial claim. The paper’s conclusions may not depend on it.
In the paper
“FXS is caused by the loss of the fragile X mental retardation protein (FMRP) encoded by FMR1 (Verkerk et al., 1991).”
§ Disease-associated short tandem repeats co-localize with chromatin domain boundaries > Results > Boundary disruption in Fragile X Syndrome patients correlates with FMR1 silencing
What the sources say
- Not checked yetcites Verkerk et al., 1991 source
Load-bearingStrength:plain· not yet calibratedCausal:direct· not yet calibrated
Tests✓ Asserted: passes✓ Checkable: passes✓ Load-bearing: passes✓ Based: passes
Probably not a substantial claim.
None of the sources cited for this claim have been checked yet.
In the paper
“In congenital myotonic dystrophy, the region flanking the DM1 gene is hypermethylated and this methylation disrupts binding of adjacent CTCF binding sites (Filippova et al., 2001; Steinbach et al., 1998).”
§ Disease-associated short tandem repeats co-localize with chromatin domain boundaries > Discussion
What the sources say
- Not checked yetcites Filippova et al., 2001 source
- Not checked yetcites Steinbach et al., 1998 source
Strength:plain· not yet calibratedCausal:direct· not yet calibrated
Tests✓ Asserted: passes✓ Checkable: passes? Load-bearing: unclear✓ Based: passes
It may state two separate claims as one.
None of the sources cited for this claim have been checked yet.
In the paper
“A total of 29 genes associated with trinucleotide repeat expansion disorders were initially selected for analysis based on previous reports (Tables S1-S3) (Iyer et al., 2015; La Spada and Taylor, 2010).”
§ Disease-associated short tandem repeats co-localize with chromatin domain boundaries > STAR Methods > QUANTIFICATION AND STATISTICAL ANALYSES
What the sources say
- Not checked yetcites Iyer et al., 2015 source
- Not checked yetcites La Spada and Taylor, 2010
Load-bearingStrength:plain· not yet calibrated
Tests✓ Asserted: passes✓ Checkable: passes✓ Load-bearing: passes✓ Based: passes
Probably not a substantial claim.
What the paper did — it cites no source for this, so there is none to check. The quote shows it is in the paper.
In the paper
“To ensure that our results from the Fisher’s Exact test (Figure 2B, Figure 4D-F) were not artifacts of using a null repeat set that was not weighted similarly to the daSTRs set with respect to STR type group (Table S3), we also randomly created n=1000 subsets of the null repeat set that were weighted similarly to the daSTRs.”
- Also stated in: § QUANTIFICATION AND STATISTICAL ANALYSES · plain
  “We then used the Python StatsModel package implementation of the Cochran–Mantel–Haenszel test on the 1000 subsets to calculate a pooled odds ratio of the empirical distribution.”
§ Disease-associated short tandem repeats co-localize with chromatin domain boundaries > STAR Methods > QUANTIFICATION AND STATISTICAL ANALYSES
Load-bearingStrength:plain· not yet calibratedn = 1,000
Tests✓ Asserted: passes✓ Checkable: passes✓ Load-bearing: passes✓ Based: passes
Probably not a substantial claim.
In the paper
“A recent genome-wide association study in Huntington’s disease patients identified a link between genetic variation in DNA repair machinery and the age of onset of the disease (Genetic Modifiers of Huntington's Disease, 2015).”
§ Disease-associated short tandem repeats co-localize with chromatin domain boundaries > Discussion
What the sources say
- Not checked yetcites Genetic Modifiers of Huntington's Disease, 2015
Load-bearingStrength:plain· not yet calibratedCausal:correlational· not yet calibrated
Tests✓ Asserted: passes✓ Checkable: passes✓ Load-bearing: passes✓ Based: passes
Probably not a substantial claim.
None of the sources cited for this claim have been checked yet.
In the paper
“Recent high-resolution Chromosome-Conformation-Capture sequencing studies have revealed that TAD boundaries are perturbed in rare human limb malformation diseases (Lupianez et al., 2015) and certain types of cancers (Flavahan et al., 2016; Hnisz et al., 2016), leading to enhancer miswiring and pathogenic disruption of gene expression.”
§ Disease-associated short tandem repeats co-localize with chromatin domain boundaries > Discussion
What the sources say
- Not checked yetcites Lupianez et al., 2015 source
- Not checked yetcites Flavahan et al., 2016 source
- Not checked yetcites Hnisz et al., 2016 source
Load-bearingStrength:plain· not yet calibratedCausal:direct· not yet calibrated
Tests✓ Asserted: passes✓ Checkable: passes✓ Load-bearing: passes✓ Based: passes
Probably not a substantial claim. It may state two separate claims as one.
None of the sources cited for this claim have been checked yet.
In the paper
“STR instability is known to occur in the germline, but tissue-specific somatic variation in STR tract length has been reported (Leeflang et al., 1995; Telenius et al., 1994; Wohrle et al., 1993; Wong et al., 1995; Zhang et al., 1994).”
§ Disease-associated short tandem repeats co-localize with chromatin domain boundaries > Discussion
What the sources say
- Not checked yetcites Leeflang et al., 1995 source
- Not checked yetcites Telenius et al., 1994 source
- Not checked yetcites Wohrle et al., 1993 source
Strength:plain· not yet calibrated
Tests✓ Asserted: passes✓ Checkable: passes✗ Load-bearing: fails✓ Based: passes
Probably not a substantial claim. The paper’s conclusions may not depend on it. It may state two separate claims as one.
In the paper
“By contrast, many other daSTRS are co-localized to subTAD boundaries, which are known to be dynamically reconfigured across cell state transitions in development (Norton et al., 2018).”
§ Disease-associated short tandem repeats co-localize with chromatin domain boundaries > Discussion
What the sources say
- Not checked yetcites Norton et al., 2018 source
Load-bearingStrength:boosted· not yet calibratedCausal:correlational· not yet calibrated
Tests✓ Asserted: passes✓ Checkable: passes✓ Load-bearing: passes✓ Based: passes
It may state two separate claims as one.
In the paper
“These groups are motivated by prior literature showing that daSTRs with similar sequence and gene body locations behave similarly with respect to number of repeats required for disease and expansion mechanisms (Iyer et al., 2015).”
§ Disease-associated short tandem repeats co-localize with chromatin domain boundaries > STAR Methods > QUANTIFICATION AND STATISTICAL ANALYSES
What the sources say
- Not checked yetcites Iyer et al., 2015 source
Load-bearingStrength:plain· not yet calibratedCausal:correlational· not yet calibrated
Tests✓ Asserted: passes✓ Checkable: passes✓ Load-bearing: passes✓ Based: passes
Probably not a substantial claim.
In the paper
“We used these published Mb-scale TAD calls in Figure S2 because Ren and colleagues used an independent study and an independent TAD calling method to compare TADs across H1 ES cell (Human H1) and H1 ESC-derived lineages—mesendoderm (MES), mesenchymal stem cells (MSC), neural progenitor cells (NPC), and trophoblast-like cells (TRO).”
§ Disease-associated short tandem repeats co-localize with chromatin domain boundaries > STAR Methods > QUANTIFICATION AND STATISTICAL ANALYSES
What the sources say
- Not checked yetcites Schmitt et al., 2016 source
Strength:plain· not yet calibrated
Tests✓ Asserted: passes✓ Checkable: passes✗ Load-bearing: fails✓ Based: passes
Probably not a substantial claim. The paper’s conclusions may not depend on it. It may state two separate claims as one.
In the paper
“Finally, restriction fragment biases were normalized by applying matrix balancing as previously reported (Imakaev et al., 2012).”
§ Disease-associated short tandem repeats co-localize with chromatin domain boundaries > STAR Methods > QUANTIFICATION AND STATISTICAL ANALYSES
What the sources say
- Not checked yetcites Imakaev et al., 2012 source
Load-bearingStrength:plain· not yet calibrated
Tests✓ Asserted: passes✓ Checkable: passes✓ Load-bearing: passes✓ Based: passes
Probably not a substantial claim.

48 of 48

The paper relies on this without support.
The role for TAD boundaries in neurological disorders has not yet been reported.
“but the role for TAD boundaries in neurological disorders has not yet been reported.”
The paper relies on this without support.
Mapping daSTRs to normal-length repeat tracts in the hg19 reference genome is representative of disease-associated STR loci.
“Because the samples are not diseased, we mapped daSTRs to the normal-length repeat tracts found in the hg19 reference genome (Tables S1-S3).”
The paper relies on this without support.
Domain boundaries called in human ES cells and fetal cortical plate are relevant to the cell types of pathology for all daSTRs.
“Thus, although the target cell type(s) for many unstable repeat expansion disorders are unknown, the strong enrichment at boundaries regardless of tissue origin suggests that daSTR co-localization with boundaries might be robust across cell types relevant for the pathology.”

3 of 3

Claims other papers make about this one

Each is checked against this paper’s own text: does it say what the citing paper says it does?

Self-check

Percentages, sums and reported differences re-computed from the paper’s own numbers.

Four daSTR classes account for only 25 of 26 tracts
Minor
The methods say that 26 daSTR tracts were subdivided into these four classes, but the listed class sizes sum to 25. One tract is unaccounted for.
Reported 26 · recomputed 25

1 of 1

Fast gapped-read alignment with Bowtie 2
Langmead, B., & Salzberg, S. L. (2012) · Nature Methods · doi:10.1038/nmeth.1923 · Cited by 56,400 · cited 1×
“…for CTCF peak 2 F: TCTTGTCTGGCCT GTATGGTTR: CCATATTGCACAATGCAGCTCT This paper N/A Software and Algorithms Bowtie/Bowtie2 Langmead et al., 2009; Langmead and Salzberg, 2012 http://bowtie-bio.sourceforge.net/ Python MACS Zhang et al., 2008 https://github.com/taoliu/MACS BEDTools Quinlan 2014…”
Background
Ultrafast and memory-efficient alignment of short DNA sequences to the human genome.
Langmead, B., Trapnell, C., Pop, M., & Salzberg, S. L. (2009) · Genome Biology · doi:10.1186/gb-2009-10-3-r25 · Cited by 21,849
Model-based Analysis of ChIP-Seq (MACS)
Zhang, Y., Liu, T., Meyer, C. A., Eeckhoute, J., Johnson, D. S., Bernstein, B. E., Nusbaum, C., Myers, R. M., Brown, M., Li, W., et al. (2008) · Genome Biology · doi:10.1186/gb-2008-9-9-r137 · Cited by 18,386
MEME SUITE: tools for motif discovery and searching
Bailey, T. L., Boden, M., Buske, F. A., Frith, M., Grant, C. E., Clementi, L., Ren, J., Li, W. W., & Noble, W. S. (2009) · Nucleic Acids Research · doi:10.1093/nar/gkp335 · Cited by 10,648
A 3D Map of the Human Genome at Kilobase Resolution Reveals Principles of Chromatin Looping
Rao, S. S. P., Huntley, M. H., Durand, N. C., Stamenova, E. K., Bochkov, I. D., Robinson, J. T., Sanborn, A. L., Machol, I., Omer, A. D., Lander, E. S., et al. (2014) · Cell · doi:10.1016/j.cell.2014.11.021 · Cited by 9,212 · cited 1×
“Consistent with the established principles of CTCF motif convergency (Rao et al., 2014), the doublet CTCF sites contained CTCF motifs in the reverse orientation and looped to distal CTCF occupied motifs oriented in the forward direction (Figures 6C and 6D).”
Background
A comparison of normalization methods for high density oligonucleotide array data based on variance and bias
Bolstad, B. M., Irizarry, R. A., Åstrand, M., & Speed, T. P. (2003) · Bioinformatics · doi:10.1093/bioinformatics/19.2.185 · Cited by 8,328
deepTools2: a next generation web server for deep-sequencing data analysis
Ramírez, F., Ryan, D. P., Grüning, B., Bhardwaj, V., Kilpert, F., Richter, A. S., Heyne, S., Dündar, F., & Manke, T. (2016) · Nucleic Acids Research · doi:10.1093/nar/gkw257 · Cited by 8,096 · cited 1×
“…matrix balancing Imakaev et al., 2012 https://github.com/hiclib/iced MEME Suite Bailey et al., 2009 http://meme-suite.org Quantile normalization Bolstad et al., 2003 https://www.ncbi.nlm.nih.gov/pubmed/ 12538238 deepTools Ramı́rez et al., 2016 https://github.com/deeptools/deepTools”
Topological domains in mammalian genomes identified by analysis of chromatin interactions
Dixon, J. R., Selvaraj, S., Yue, F., Kim, A., Li, Y., Shen, Y., Hu, M., Liu, J. S., & Ren, B. (2012) · Nature · doi:10.1038/nature11082 · Cited by 6,829 · cited 3×
“Mammalian genomes are organized into a hierarchy of megabase (Mb)-scale topologically associating domains (TADs) (Dixon et al., 2012; Nora et al., 2012) and smaller, nested subTADs (Dixon et al.”
BackgroundResult
Histone H3K27ac separates active from poised enhancers and predicts developmental state
Creyghton, M. P., Cheng, A. W., Welstead, G. G., Kooistra, T., Carey, B. W., Steine, E. J., Hanna, J., Lodato, M. A., Frampton, G. M., Sharp, P. A., et al. (2010) · Proceedings of the National Academy of Sciences · doi:10.1073/pnas.1016071107 · Cited by 4,302 · cited 1×
“Finally, to better understand how the FXS topological changes might be connected to FMR1 trancriptional silencing, we mined published ChIP-seq data in GM12878 cells for H3K27ac, an established mark of active enhancers (Creyghton et al., 2010).”
Method
Identification of a gene (FMR-1) containing a CGG repeat coincident with a breakpoint cluster region exhibiting length variation in fragile X syndrome
Verkerk, A. J. M. H., Pieretti, M., Sutcliffe, J. S., Fu, Y.-H., Kuhl, D. P. A., Pizzuti, A., Reiner, O., Richards, S., Victoria, M. F., Zhang, F., et al. (1991) · Cell · doi:10.1016/0092-8674(91)90397-h · Cited by 3,481 · cited 1×
“Boundary Disruption in Fragile X Syndrome Patients Correlates with FMR1 Silencing FXS is caused by the loss of the fragile X mental retardation protein (FMRP) encoded by FMR1 (Verkerk et al., 1991).”
Background

Flagged first, then by citations

Show all 67 references

Sorted by citations

Transcription factors and 3D genome conformation in cell-fate decisions
Stadhouders, R., Filion, G. J. P., & Graf, T. (2019) · Nature · doi:10.1038/s41586-019-1182-7 · Cited by 530
On the existence and functionality of topologically associating domains
Beagan, J. A., & Phillips‐Cremins, J. E. (2020) · Nature Genetics · doi:10.1038/s41588-019-0561-1 · Cited by 381
Self-citation
Incomplete Penetrance and Variable Expressivity: From Clinical Studies to Population Cohorts
Kingdom, R., & Wright, C. F. (2022) · Frontiers in Genetics · doi:10.3389/fgene.2022.920390 · Cited by 326
“Non-coding variants within enhancer regions can be a cause of phenotypic diversity through alterations in gene expression, therefore affecting overall disease phenotype presentation (Sun et al., 2018).”
Background
On the wrong DNA track: Molecular mechanisms of repeat-mediated genome instability
Khristich, A. N., & Mirkin, S. M. (2020) · Journal of Biological Chemistry · doi:10.1074/jbc.rev119.007678 · Cited by 289
Mismatch Repair Pathway, Genome Stability and Cancer
Pećina‐Šlaus, N., Kafka, A., Salamon, I., & Bukovac, A. (2020) · Frontiers in Molecular Biosciences · doi:10.3389/fmolb.2020.00122 · Cited by 303
“Recently it has been demonstrated that disease associated microsatellites are located in nexuses between chromatin domains (Sun et al., 2018) suggesting affected gene replication and expression.”
Background

See all 259

Authors: Sun, J. H., Zhou, L., Emerson, D. J., Phyo, S. A., Titus, K. R., Gong, W., Gilgenast, T. G., Beagan, J. A., Davidson, B. L., Tassone, F., & Phillips-Cremins, J. E.
Affiliations: University of Pennsylvania (US)
Children's Hospital of Philadelphia (US)
University of California, Davis (US)
ORCID: Sun, James H.
Zhou, Linda
Emerson, Daniel J.
Titus, Katelyn R.
Beagan, Jonathan A.
Davidson, Beverly L.
Tassone, Flora
Venue: Cell
Publisher: Elsevier BV
Published: 2018-09
Volume: 175
Issue: 1
Pages: 224-238.e15
ISSN: 0092-8674 (ISSN-L)
DOI: 10.1016/j.cell.2018.08.005
PMC: PMC6175607
OpenAlex: W2889421335
Semantic Scholar: 68a0a360b6754c0c8f9f272f6ff06cd5b60de52a
Cited by: 249
References: 67
Citations by year: 2026: 12 · 2025: 24 · 2024: 42 · 2023: 26 · 2022: 41 · 2021: 41 · 2020: 28 · 2019: 32 · 2018: 3
FWCI: 12.41
Type: journal article
Language: en
Open access: bronze
doi.org
Licence: www.elsevier.com/tdm/userlicense/1.0/ (tdm)
www.elsevier.com/open-access/userlicense/1.0/ (vor, 384 d)
Locations: Cell (publishedVersion)
PubMed (publishedVersion)
Europe PMC (PubMed Central) (acceptedVersion)
PubMed Central (acceptedVersion)
eScholarship (California Digital Library) (submittedVersion)
Funders: The New York Stem Cell Foundation
Alfred P. Sloan Foundation
NIH Director’s New Innovator Award (1DP2MH11024701)
4D Nucleome Common Fund (1U01HL12999801)
NIH (R01 GM113929)
NSF-NIGMS (1562665)
Topics: Life Sciences › Neuroscience › Cellular and Molecular Neuroscience › Genetic Neurodegenerative Diseases
Life Sciences › Biochemistry, Genetics and Molecular Biology › Molecular Biology › Genomics and Chromatin Dynamics
Life Sciences › Biochemistry, Genetics and Molecular Biology › Genetics › Genetics and Neurodevelopmental Disorders
Keywords: microsatellite markers, repeat expansion disorders, chromatin domain boundaries, CpG islands, fragile X syndrome, chromatin topology
MeSH terms: CCCTC-Binding Factor, Adult, Brain, Cell Line, Chromatin, Disease, DNA, Female, Fragile X Syndrome, Humans, Male, Genome, Human, Microsatellite Repeats, CpG Islands, Trinucleotide Repeat Expansion, Chromatin Assembly and Disassembly, Fragile X Messenger Ribonucleoprotein 1

About these checks

Registry, retraction, Cites and statistics results are computed, not judged, with one exception: a printed reference that no index lists is read once by a model before it counts as a citation error. Claims are extracted by a model and kept only when their quote appears verbatim in the text; each cited source is then checked, with a model’s help, for whether it says what the claim relies on. Those verdicts can be wrong — read the claim’s quote and the cited source before relying on one.

A language model drew the claims from the paper on 2026-10-10, under version 3 of the claim definition (model deepseek-v4.1-flash, prompt extract-v3).

A second model labelled each claim on 2026-10-10 (model jev-1.13-20260917, definition revision gold-guideline-v0.2).

Statistics and arithmetic are recomputed, not judged.

Confidence bands are shown only for fields calibrated on our annotated test set. None is calibrated yet, so no band is shown.

What counts as a claim ›How we measure confidence ›How we check this ›

Are you an author, or do you see a problem with this page? Request a review

Disease-Associated Short Tandem Repeats Co-localize with Chromatin Domain Boundaries

Abstract

Overview

AI snapshot

TL;DR

Key findings

Methods

Limitations

Integrity signals

Verification

Claims the paper makes

Claims other papers make about this one

Self-check

Citations

Cites

Cited by

Related

Metadata

Record

About these checks