The DOI matches its Crossref record; 66 of the 67 references it cites were found in a registry or an index; 1 of the 56 sources its claims cite were checked for support.
Disease-Associated Short Tandem Repeats Co-localize with Chromatin Domain Boundaries
Open accessAbstract
Summary More than 25 inherited human disorders are caused by the unstable expansion of repetitive DNA sequences termed short tandem repeats (STRs). A fundamental unresolved question is why some STRs are susceptible to pathologic expansion, whereas thousands of repeat tracts across the human genome are relatively stable. Here, we discover that nearly all disease-associated STRs (daSTRs) are located at boundaries demarcating 3D chromatin domains. We identify a subset of boundaries with markedly higher CpG island density compared to the rest of the genome. daSTRs specifically localize to ultra-high-density CpG island boundaries, suggesting they might be hotspots for epigenetic misregulation or topological disruption upon STR expansion. Fragile X Syndrome patients exhibit severe boundary disruption in a manner that correlates with local loss of CTCF occupancy and the degree of FMR1 silencing. Our data uncover higher-order chromatin architecture as a new dimension in understanding repeat expansion disorders.
Overview
AI snapshot
Written from the paper’s full text.
TL;DR
Nearly all disease-associated short tandem repeats (daSTRs) localize to 3D chromatin domain boundaries, especially boundaries with ultra-high CpG island density and high CTCF occupancy. In Fragile X syndrome, the FMR1 boundary is disrupted in patients, correlating with local CTCF loss and FMR1 silencing.
Key findings
- 22 of 27 daSTR loci localized to human ES cell boundaries, including 11 at TAD boundaries and 11 at subTAD boundaries; 21 of 23 neurological daSTRs localized to boundaries in human fetal cortical plate tissue.
- daSTRs were significantly closer to domain boundaries than matched normal-length repeats (0 bp versus 5,203 bp median; P = 0.00074 Mann-Whitney U; P = 0.0037 Kolmogorov-Smirnov) and enriched at boundaries (odds ratio = 4.77, Fisher’s exact P = 0.00056).
- daSTRs localized to CpG island-rich boundaries more than matched repeats (odds ratio = 10.4, P = 1.4E-8), with 65.7% of daSTRs at CpG island-rich boundaries versus 22.0% of matched repeats; no significant difference was found at CpG island-depleted boundaries or non-boundary CpG islands.
- In Fragile X syndrome patient samples, the FMR1 TAD boundary was ablated, a CTCF doublet ~100 kb upstream was lost, and boundary disruption correlated with FMR1 silencing; these topological changes occurred in at least three cell types and four patients.
Methods
- Analyzed published Hi-C data from human ES cells and human fetal cortical plate tissue, using DI+HMM for Mb-scale TADs and 3DNetMod for nested subTADs; daSTRs were mapped in hg19 and compared with normal-length repeats matched by repeat sequence, length range, and gene body placement.
- Performed 5C, CTCF ChIP-seq, qRT-PCR for FMR1 expression, and Sanger sequencing in Fragile X syndrome patient and control B-lymphocytes, fibroblasts, and postmortem brain tissue.
- Used Fisher’s exact, Kolmogorov-Smirnov, Cochran–Mantel–Haenszel, randomization, and bootstrapped tests to assess boundary localization and CpG island density.
Limitations
- The paper states it does not aim to identify specific genetic variants predicting which individuals develop repeat expansion disorders, and that cause-and-effect relationships among boundary disruption, DNA methylation, CTCF occupancy, CpG islands, STR expansion, and gene expression remain unresolved.
- The paper notes that statistical power was restricted by small daSTR class sizes, and that rigorous thresholds likely missed some visually evident boundaries, making boundary enrichment estimates conservative.
- Evident from the text: the Fragile X syndrome topological analyses rely on a small number of patient samples and cell types, and the link between boundary disruption and FMR1 silencing is correlative rather than causal.
Model-written summary. Check it against the paper before relying on it.
Integrity signals
Registry
Cites
Statistics
Verification
Claims the paper makes
48 Own result · 29 Not checked yet · 25 Own interpretation · 8 Own method · 3 No basis given · 1 Partly supported · accuracy not yet measured
A result the paper reports from its own data — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“Importantly, daSTRs localize with boundaries exhibiting ultra-high CpG island density (blue spheres, Figure 4A).”
§ Disease-associated short tandem repeats co-localize with chromatin domain boundaries > Results > Boundaries containing daSTRs are characterized by ultra-high density of CpG islands
plaincorrelational- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: passes — The paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
A result the paper reports from its own data — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“Third, the small subTAD encompassing the FMR1 gene dissolves in the ~935 FXS patient compared to the healthy sibling (Figure 5B-C, lower green arrow).”
§ Disease-associated short tandem repeats co-localize with chromatin domain boundaries > Results > TAD boundary at the FMR1 daSTR is ablated in Fragile X Syndrome
plaindirectSingle case- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: passes — The paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
A result the paper reports from its own data — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“We observed severe topological disruption around the FMR1 daSTR in both FXS patient B cell lines compared to the healthy sibling with normal-length repeats (Figure 5B-D).”
§ Disease-associated short tandem repeats co-localize with chromatin domain boundaries > Results > TAD boundary at the FMR1 daSTR is ablated in Fragile X Syndrome
plaincorrelationaln = 2- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: passes — The paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
A result the paper reports from its own data — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“Consistent with our observations in human ES cells, we found 8 out of the 23 neurological daSTR loci were detected at TAD boundaries in human fetal cortical plate tissue (Figure 3A).”
§ Disease-associated short tandem repeats co-localize with chromatin domain boundaries > Results > daSTRs linked to neurological disorders co-localize with boundaries in human cortical tissue
plaincorrelational- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: passes — The paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
A result the paper reports from its own data — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“Although statistical power was restricted by the small size of the groups, all four classes of daSTRs showed enrichment at boundaries compared to other normal-length repeats matched by sequence and gene body location (Figure S5A).”
§ Disease-associated short tandem repeats co-localize with chromatin domain boundaries > Results > daSTRs linked to neurological disorders co-localize with boundaries in human cortical tissue
plaincorrelational- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: passes — The paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
A result the paper reports from its own data — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“Boundaries containing matched normal-length repeat tracts show a striking increase in CpG island density compared to boundaries without repeats (Odds Ratio = 3.92, Fisher’s Exact Test, P = 1.69E-110, Figure 4A-B).”
§ Disease-associated short tandem repeats co-localize with chromatin domain boundaries > Results > Boundaries containing daSTRs are characterized by ultra-high density of CpG islands
boostedcorrelational- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: passes — The paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
A result the paper reports from its own data — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“The extent of boundary disruption correlates with the degree of FMR1 silencing and local loss of CTCF occupancy at specific sites.”
§ Disease-associated short tandem repeats co-localize with chromatin domain boundaries > Introduction
plaincorrelational- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: passes — The paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
A result the paper reports from its own data — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“First, a domain boundary separating FMR1 from the immediate upstream TAD in the healthy sibling was ablated in the ~935 FXS patient (Figure 5B-C, green bracket).”
§ Disease-associated short tandem repeats co-localize with chromatin domain boundaries > Results > TAD boundary at the FMR1 daSTR is ablated in Fragile X Syndrome
plaindirectSingle case- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: passes — The paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
A result the paper reports from its own data — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“The mean percentage of drawn repeats tracts that are boundary-associated increased from 49.5% (bootstrapped 95% CI: 30.3% < μpercent_boundary < 68.6%) in matched repeats compared to 81.1% (bootstrapped 95% CI: 66.2% < μpercent_boundary < 96.0%) in daSTRs, respectively (Figure 2C).”
§ Disease-associated short tandem repeats co-localize with chromatin domain boundaries > Results > daSTRs localize to boundaries significantly more than normal-length repeats genome-wide
plaindirect- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: passes — The paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
A result the paper reports from its own data — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“Importantly, there is no significant difference between matched repeats and daSTRs when the test is performed on CpG island-depleted boundaries (Fisher's Exact Test: Odds Ratio = 0.271 and P = 0.063; Cochran-Mantel-Haenszel Test: Odds Ratio = 0.364; Figure 4E)”
§ Disease-associated short tandem repeats co-localize with chromatin domain boundaries > Results > Boundaries containing daSTRs are characterized by ultra-high density of CpG islands
plain- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: passes — The paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
- Probably not a substantial claim. 32
- It may state two separate claims as one. 26
- The quote only partly states this claim. 1
The cited sources support only part of this claim — read each source’s verdict below.
In the paper
“Moreover, CpG islands are aberrantly hypermethylated in a subset of cancers that exhibit microsatellite instability (Sharma et al., 2010; You and Jones, 2012).”
§ Disease-associated short tandem repeats co-localize with chromatin domain boundaries > Discussion
What the sources say
- Partly supportedcites Sharma et al., 2010 sourceExperimental — accuracy not yet measured
The ‘DNA methylation aberrations in cancer’ section describes tumor-specific CpG-island hypermethylation and coordinated methylation of a subset of islands in tumors. It does not itself connect those tumors to microsatellite instability; that connection appears only in the title of reference 86, so the microsatellite-instability qualifier is not supported by the paper’s discussion. (LLM, conf=0.82)
- Not checked yetcites You and Jones, 2012
plaincorrelational- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: fails — The paper’s conclusions may not depend on it.
- Based: passes — The paper gives a reason why it holds.
Probably not a substantial claim. The paper’s conclusions may not depend on it.
- Partly supported
A result the paper reports from its own data — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“An additional 8 and 5 daSTRs localized to subTAD and qualitatively apparent boundaries, respectively (Figure 3B, Figure S4A-C).”
§ Disease-associated short tandem repeats co-localize with chromatin domain boundaries > Results > daSTRs linked to neurological disorders co-localize with boundaries in human cortical tissue
plaincorrelational- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: passes — The paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
It may state two separate claims as one.
A result the paper reports from its own data — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“We observed that nearly all daSTRs are specifically targeted to CpG island-rich boundaries, but not boundaries devoid of CpG islands or CpG islands internal to domains.”
§ Disease-associated short tandem repeats co-localize with chromatin domain boundaries > Introduction
plaincorrelational- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: passes — The paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
It may state two separate claims as one.
A result the paper reports from its own data — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“Noteworthy, we also observed a marked increase in the density of CpG islands at boundaries vs. non-boundaries, whereas classic repressive chromatin marks such as H3K9me3 were slightly depleted at boundaries compared to loci internal to domains.”
§ Disease-associated short tandem repeats co-localize with chromatin domain boundaries > Results > Boundaries containing daSTRs are characterized by ultra-high density of CpG islands
plaincorrelational- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: unclear — It is unclear whether the paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
It may state two separate claims as one.
A result the paper reports from its own data — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“We found severe reduction of FMR1 expression in all FXS patient samples with boundary disruption, whereas boundaries remained intact if FMR1 was not silenced (Figure 6G-H, Figure S7I-K).”
§ Disease-associated short tandem repeats co-localize with chromatin domain boundaries > Results > Boundary disruption in Fragile X Syndrome patients correlates with FMR1 silencing
plaincorrelational- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: passes — The paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
It may state two separate claims as one.
A result the paper reports from its own data — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“The CTCF doublet is located directly at the base of the upstream loop and TAD boundary; disruption of these structural features in FXS patients correlated with lost CTCF occupancy (Figure 6C-D).”
§ Disease-associated short tandem repeats co-localize with chromatin domain boundaries > Results > CTCF occupancy at the FMR1 daSTR is ablated in Fragile X Syndrome
plaincorrelational- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: passes — The paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
It may state two separate claims as one.
A result the paper reports from its own data — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“We also noticed that the specific long-range contacts between FMR1 and the downstream TAD were lost in FXS but not mediated by CTCF (Figure 6E, Figure S7G), suggesting that additional architectural proteins are affected by repeat expansion.”
§ Disease-associated short tandem repeats co-localize with chromatin domain boundaries > Results > CTCF occupancy at the FMR1 daSTR is ablated in Fragile X Syndrome
plain- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: passes — The paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
It may state two separate claims as one.
In the paper
“Consistent with the established principles of CTCF motif convergency (Rao et al., 2014), the doublet CTCF sites contained CTCF motifs in the reverse orientation and looped to distal CTCF occupied motifs oriented in the forward direction (Figure 6C-D).”
§ Disease-associated short tandem repeats co-localize with chromatin domain boundaries > Results > CTCF occupancy at the FMR1 daSTR is ablated in Fragile X Syndrome
What the sources say
- Not checked yetcites Rao et al., 2014 source
boostedcorrelational- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: unclear — It is unclear whether the paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
It may state two separate claims as one.
A result the paper reports from its own data — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“We found increased density of H3K27ac+ putative enhancers in the downstream TAD and minimal H3K27ac+ signal in the TAD upstream of the FMR1 daSTR (Figure 6I).”
§ Disease-associated short tandem repeats co-localize with chromatin domain boundaries > Results > Boundary disruption in Fragile X Syndrome patients correlates with FMR1 silencing
plaincorrelational- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: passes — The paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
It may state two separate claims as one.
A result the paper reports from its own data — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“FMR1 is biased towards downstream contacts (positive DI) in healthy individuals and transitions to upstream contacts (negative DI) in diseased individuals.”
§ Disease-associated short tandem repeats co-localize with chromatin domain boundaries > Results > TAD boundary at the FMR1 daSTR is ablated in Fragile X Syndrome
plaincorrelational- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: passes — The paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
It may state two separate claims as one.
A result the paper reports from its own data — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“One final gene (CSTB) was queried for boundary localization but dropped from all analyses that compared daSTRs to matched, normal-length repeats because there are no other repeats matching its sequence, length, and gene body location requirements in hg19.”
§ Disease-associated short tandem repeats co-localize with chromatin domain boundaries > STAR Methods > QUANTIFICATION AND STATISTICAL ANALYSES
plaindirect- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: fails — The paper’s conclusions may not depend on it.
- Based: passes — The paper gives a reason why it holds.
Probably not a substantial claim. The paper’s conclusions may not depend on it.
The paper states this without a source or data behind it here, so there is nothing to check it against. The quote shows it is in the paper.
In the paper
“Of these 29, two (TBP, NOP56) were dropped from our analyses because they were located at the far edges of chromosomes beyond where Hi-C can query domains.”
§ Disease-associated short tandem repeats co-localize with chromatin domain boundaries > STAR Methods > QUANTIFICATION AND STATISTICAL ANALYSES
plaindirect- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: fails — The paper’s conclusions may not depend on it.
- Based: passes — The paper gives a reason why it holds.
Probably not a substantial claim. The paper’s conclusions may not depend on it.
None of the sources cited for this claim have been checked yet.
In the paper
“Mammalian genomes are organized into a hierarchy of Megabase (Mb)-scale topologically associating domains (TADs) (Dixon et al., 2012; Nora et al., 2012) and smaller, nested subTADs (Dixon et al., 2012; Nora et al., 2012; Phillips-Cremins et al., 2013; Rao et al., 2014).”
§ Disease-associated short tandem repeats co-localize with chromatin domain boundaries > Introduction
What the sources say
plain- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: passes — The paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
Probably not a substantial claim.
None of the sources cited for this claim have been checked yet.
In the paper
“By a process that is poorly understood, a small number of specific normal-length STRs undergo somatic or germline expansion and transition to intermediate, pre-mutation, and mutation (affected) repeat unit tract lengths (Mirkin, 2007; Pearson et al., 2005).”
§ Disease-associated short tandem repeats co-localize with chromatin domain boundaries > Introduction
What the sources say
plaindirect- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: fails — The paper’s conclusions may not depend on it.
- Based: passes — The paper gives a reason why it holds.
Probably not a substantial claim. The paper’s conclusions may not depend on it.
None of the sources cited for this claim have been checked yet.
In the paper
“Such chromatin domains span >90% of the genome and are thought to create insulated neighborhoods demarcating the search space of specific long-range interactions between enhancers and their target genes (Dowen et al., 2014; Narendra et al., 2015; Symmons et al., 2014).”
§ Disease-associated short tandem repeats co-localize with chromatin domain boundaries > Introduction
What the sources say
hedged- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: passes — The paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
Probably not a substantial claim. It may state two separate claims as one.
In the paper
“Normal-length STR tracts are generally stable across generations and among somatic tissues in the same individual (McMurray, 2010).”
§ Disease-associated short tandem repeats co-localize with chromatin domain boundaries > Introduction
What the sources say
- Not checked yetcites McMurray, 2010 source
plain- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: passes — The paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
Probably not a substantial claim. It may state two separate claims as one.
In the paper
“daSTRs consist predominantly of a trinucleotide unit, but expandable tetra-, penta-, and hexa-nucleotide repeat sequences have also been reported (Iyer et al., 2015).”
§ Disease-associated short tandem repeats co-localize with chromatin domain boundaries > Introduction
What the sources say
- Not checked yetcites Iyer et al., 2015 source
plain- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: fails — The paper’s conclusions may not depend on it.
- Based: passes — The paper gives a reason why it holds.
Probably not a substantial claim. The paper’s conclusions may not depend on it. It may state two separate claims as one.
None of the sources cited for this claim have been checked yet.
In the paper
“Pre-mutation and mutation lengths vary widely among the repeat expansion disorders (Iyer et al., 2015; McMurray, 2010).”
§ Disease-associated short tandem repeats co-localize with chromatin domain boundaries > Introduction
What the sources say
plain- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: fails — The paper’s conclusions may not depend on it.
- Based: passes — The paper gives a reason why it holds.
Probably not a substantial claim. The paper’s conclusions may not depend on it.
None of the sources cited for this claim have been checked yet.
In the paper
“Healthy individuals have tens of thousands of relatively short STR tracts distributed throughout their genomes (Gymrek and Erlich, 2013; Gymrek et al., 2016; Willems et al., 2017).”
§ Disease-associated short tandem repeats co-localize with chromatin domain boundaries > Introduction
What the sources say
plain- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: fails — The paper’s conclusions may not depend on it.
- Based: passes — The paper gives a reason why it holds.
Probably not a substantial claim. The paper’s conclusions may not depend on it.
In the paper
“daSTRs also exhibit a wide range of repeat unit sequences and can be localized across the gene body in introns, exons, promoters and 3’/5’ untranslated regions (UTRs) (La Spada and Taylor, 2010).”
§ Disease-associated short tandem repeats co-localize with chromatin domain boundaries > Introduction
What the sources say
- Not checked yetcites La Spada and Taylor, 2010
plain- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: fails — The paper’s conclusions may not depend on it.
- Based: passes — The paper gives a reason why it holds.
Probably not a substantial claim. The paper’s conclusions may not depend on it. It may state two separate claims as one.
None of the sources cited for this claim have been checked yet.
In the paper
“Disease-associated STR tracts (hereafter referred to as daSTRs) exhibit tremendous diversity in sequence, gene body location, and tract length.”
§ Disease-associated short tandem repeats co-localize with chromatin domain boundaries > Introduction
plain- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: fails — The paper’s conclusions may not depend on it.
- Based: passes — The paper gives a reason why it holds.
Probably not a substantial claim. The paper’s conclusions may not depend on it. It may state two separate claims as one.
None of the sources cited for this claim have been checked yet.
In the paper
“More than 25 inherited human disorders are caused by the unstable expansion of repetitive DNA sequences termed short tandem repeats (STRs).”
§ Disease-associated short tandem repeats co-localize with chromatin domain boundaries > Abstract
What the sources say
plaindirect- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: fails — The paper’s conclusions may not depend on it.
- Based: passes — The paper gives a reason why it holds.
Probably not a substantial claim. The paper’s conclusions may not depend on it.
In the paper
“CpG islands are generally hypomethylated in normal somatic cells and can acquire aberrant hypermethylation in disease (Robertson, 2005).”
§ Disease-associated short tandem repeats co-localize with chromatin domain boundaries > Results > TAD boundary at the FMR1 daSTR is ablated in Fragile X Syndrome
What the sources say
- Not checked yetcites Robertson, 2005 source
plaincorrelational- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: passes — The paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
Probably not a substantial claim. It may state two separate claims as one.
A conclusion the paper draws from its own results — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“Together, these results indicate that daSTRs are present at boundaries in embryonic and somatic cell lineages and also in at least one stage of spermatogenesis when daSTR instability is paternally inherited.”
§ Disease-associated short tandem repeats co-localize with chromatin domain boundaries > Results > daSTRs co-localize with TADs that are invariant across somatic cell types
hedgedcorrelational- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: passes — The paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
It may state two separate claims as one.
In the paper
“The mutation-length CGG STR acquires DNA methylation, which is thought to cause FMR1 silencing (Park et al., 2015).”
§ Disease-associated short tandem repeats co-localize with chromatin domain boundaries > Results > Boundary disruption in Fragile X Syndrome patients correlates with FMR1 silencing
What the sources say
- Not checked yetcites Park et al., 2015 source
hedgedconditional- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: fails — The paper’s conclusions may not depend on it.
- Based: passes — The paper gives a reason why it holds.
Probably not a substantial claim. The paper’s conclusions may not depend on it. It may state two separate claims as one.
A conclusion the paper draws from its own results — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“This boundary disruption results in a dramatic re-organization of genome topology around the FMR1 gene, such that it no longer contacts genomic loci in the downstream TAD marked by histone modifications characteristic of active enhancers. Rather, FMR1 merges with the upstream TAD largely devoid of active enhancer marks, suggesting that the topological reconfiguration of the genome could be related”
§ Disease-associated short tandem repeats co-localize with chromatin domain boundaries > Discussion
hedgeddirectn = 4- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: passes — The paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
It may state two separate claims as one.
A conclusion the paper draws from its own results — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“Together, these results reveal severe topological disruption at the FMR1 daSTR in at least three cell types and at least four patients with FXS.”
§ Disease-associated short tandem repeats co-localize with chromatin domain boundaries > Results > TAD boundary at the FMR1 daSTR is ablated in Fragile X Syndrome
plaincorrelationaln = 4- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: passes — The paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
It may state two separate claims as one.
In the paper
“FXS is caused by the loss of the fragile X mental retardation protein (FMRP) encoded by FMR1 (Verkerk et al., 1991).”
§ Disease-associated short tandem repeats co-localize with chromatin domain boundaries > Results > Boundary disruption in Fragile X Syndrome patients correlates with FMR1 silencing
What the sources say
- Not checked yetcites Verkerk et al., 1991 source
plaindirect- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: passes — The paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
Probably not a substantial claim.
A conclusion the paper draws from its own results — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“These results demonstrate that FMR1 is associated with the downstream TAD in healthy B cells and shifts to the upstream TAD in two patients with FXS.”
§ Disease-associated short tandem repeats co-localize with chromatin domain boundaries > Results > TAD boundary at the FMR1 daSTR is ablated in Fragile X Syndrome
boostedcorrelationaln = 2- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: passes — The paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
It may state two separate claims as one.
None of the sources cited for this claim have been checked yet.
In the paper
“In congenital myotonic dystrophy, the region flanking the DM1 gene is hypermethylated and this methylation disrupts binding of adjacent CTCF binding sites (Filippova et al., 2001; Steinbach et al., 1998).”
§ Disease-associated short tandem repeats co-localize with chromatin domain boundaries > Discussion
What the sources say
plaindirect- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: unclear — It is unclear whether the paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
It may state two separate claims as one.
What the paper did — it cites no source for this, so there is none to check. The quote shows it is in the paper.
In the paper
“The null distribution was created by taking 10,000 draws without replacement of n=26 matched repeats, where each draw is proportionally matched to the daSTR group with respect to repeat unit sequence and gene body location, and computing the test statistic each time.”
§ Disease-associated short tandem repeats co-localize with chromatin domain boundaries > STAR Methods > QUANTIFICATION AND STATISTICAL ANALYSES
plainn = 26- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: passes — The paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
Probably not a substantial claim.
None of the sources cited for this claim have been checked yet.
In the paper
“A total of 29 genes associated with trinucleotide repeat expansion disorders were initially selected for analysis based on previous reports (Tables S1-S3) (Iyer et al., 2015; La Spada and Taylor, 2010).”
§ Disease-associated short tandem repeats co-localize with chromatin domain boundaries > STAR Methods > QUANTIFICATION AND STATISTICAL ANALYSES
What the sources say
- Not checked yetcites Iyer et al., 2015 source
- Not checked yetcites La Spada and Taylor, 2010
plain- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: passes — The paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
Probably not a substantial claim.
What the paper did — it cites no source for this, so there is none to check. The quote shows it is in the paper.
In the paper
“This method ensures that both boundaries and non-boundary bins are the same size, and that non-boundary bins are not dominated by hard to query regions of the genome.”
§ Disease-associated short tandem repeats co-localize with chromatin domain boundaries > STAR Methods > QUANTIFICATION AND STATISTICAL ANALYSES
plaindirect- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: passes — The paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
Probably not a substantial claim.
A conclusion the paper draws from its own results — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“We discover that boundaries at a specific daSTR in the FMR1 gene are disrupted in FXS in a manner that markedly alters the enhancer landscape accessible to the gene and correlates with the loss of CTCF occupancy and FMR1 silencing.”
§ Disease-associated short tandem repeats co-localize with chromatin domain boundaries > Discussion
plaindirect- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: passes — The paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
It may state two separate claims as one.
What the paper did — it cites no source for this, so there is none to check. The quote shows it is in the paper.
In the paper
“Raw 5C counts distributions were quantile normalized to address minor sequencing depth differences.”
§ Disease-associated short tandem repeats co-localize with chromatin domain boundaries > STAR Methods > QUANTIFICATION AND STATISTICAL ANALYSES
plaindirect- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: fails — The paper’s conclusions may not depend on it.
- Based: passes — The paper gives a reason why it holds.
Probably not a substantial claim. The paper’s conclusions may not depend on it.
What the paper did — it cites no source for this, so there is none to check. The quote shows it is in the paper.
In the paper
“To ensure that our results from the Fisher’s Exact test (Figure 2B, Figure 4D-F) were not artifacts of using a null repeat set that was not weighted similarly to the daSTRs set with respect to STR type group (Table S3), we also randomly created n=1000 subsets of the null repeat set that were weighted similarly to the daSTRs.”
- Also stated in: § QUANTIFICATION AND STATISTICAL ANALYSES · plain
“We then used the Python StatsModel package implementation of the Cochran–Mantel–Haenszel test on the 1000 subsets to calculate a pooled odds ratio of the empirical distribution.”
§ Disease-associated short tandem repeats co-localize with chromatin domain boundaries > STAR Methods > QUANTIFICATION AND STATISTICAL ANALYSES
plainn = 1,000- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: passes — The paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
Probably not a substantial claim.
- Also stated in: § QUANTIFICATION AND STATISTICAL ANALYSES · plain
In the paper
“A recent genome-wide association study in Huntington’s disease patients identified a link between genetic variation in DNA repair machinery and the age of onset of the disease (Genetic Modifiers of Huntington's Disease, 2015).”
§ Disease-associated short tandem repeats co-localize with chromatin domain boundaries > Discussion
What the sources say
- Not checked yetcites Genetic Modifiers of Huntington's Disease, 2015
plaincorrelational- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: passes — The paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
Probably not a substantial claim.
A conclusion the paper draws from its own results — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“We posit that STR instability at CpG island-rich boundaries manifests in individuals already genetically pre-disposed to repeat expansion.”
§ Disease-associated short tandem repeats co-localize with chromatin domain boundaries > Discussion
hedgedconditional- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: fails — The paper’s conclusions may not depend on it.
- Based: fails — The paper may give no reason why it holds.
Probably not a substantial claim. The paper’s conclusions may not depend on it. The paper may give no reason why it holds.
None of the sources cited for this claim have been checked yet.
In the paper
“Recent high-resolution Chromosome-Conformation-Capture sequencing studies have revealed that TAD boundaries are perturbed in rare human limb malformation diseases (Lupianez et al., 2015) and certain types of cancers (Flavahan et al., 2016; Hnisz et al., 2016), leading to enhancer miswiring and pathogenic disruption of gene expression.”
§ Disease-associated short tandem repeats co-localize with chromatin domain boundaries > Discussion
What the sources say
plaindirect- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: passes — The paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
Probably not a substantial claim. It may state two separate claims as one.
None of the sources cited for this claim have been checked yet.
In the paper
“STR instability is known to occur in the germline, but tissue-specific somatic variation in STR tract length has been reported (Leeflang et al., 1995; Telenius et al., 1994; Wohrle et al., 1993; Wong et al., 1995; Zhang et al., 1994).”
§ Disease-associated short tandem repeats co-localize with chromatin domain boundaries > Discussion
What the sources say
plain- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: fails — The paper’s conclusions may not depend on it.
- Based: passes — The paper gives a reason why it holds.
Probably not a substantial claim. The paper’s conclusions may not depend on it. It may state two separate claims as one.
In the paper
“By contrast, many other daSTRS are co-localized to subTAD boundaries, which are known to be dynamically reconfigured across cell state transitions in development (Norton et al., 2018).”
§ Disease-associated short tandem repeats co-localize with chromatin domain boundaries > Discussion
What the sources say
- Not checked yetcites Norton et al., 2018 source
boostedcorrelational- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: passes — The paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
It may state two separate claims as one.
What the paper did — it cites no source for this, so there is none to check. The quote shows it is in the paper.
In the paper
“This method ensures that both boundaries and non-boundary bins are the same size, and that non-boundary bins are not dominated by hard to query regions of the genome.”
§ Disease-associated short tandem repeats co-localize with chromatin domain boundaries > STAR Methods > QUANTIFICATION AND STATISTICAL ANALYSES
plaindirect- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: passes — The paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
Probably not a substantial claim.
In the paper
“These groups are motivated by prior literature showing that daSTRs with similar sequence and gene body locations behave similarly with respect to number of repeats required for disease and expansion mechanisms (Iyer et al., 2015).”
§ Disease-associated short tandem repeats co-localize with chromatin domain boundaries > STAR Methods > QUANTIFICATION AND STATISTICAL ANALYSES
What the sources say
- Not checked yetcites Iyer et al., 2015 source
plaincorrelational- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: passes — The paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
Probably not a substantial claim.
In the paper
“We used these published Mb-scale TAD calls in Figure S2 because Ren and colleagues used an independent study and an independent TAD calling method to compare TADs across H1 ES cell (Human H1) and H1 ESC-derived lineages—mesendoderm (MES), mesenchymal stem cells (MSC), neural progenitor cells (NPC), and trophoblast-like cells (TRO).”
§ Disease-associated short tandem repeats co-localize with chromatin domain boundaries > STAR Methods > QUANTIFICATION AND STATISTICAL ANALYSES
What the sources say
- Not checked yetcites Schmitt et al., 2016 source
plain- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: fails — The paper’s conclusions may not depend on it.
- Based: passes — The paper gives a reason why it holds.
Probably not a substantial claim. The paper’s conclusions may not depend on it. It may state two separate claims as one.
In the paper
“Finally, restriction fragment biases were normalized by applying matrix balancing as previously reported (Imakaev et al., 2012).”
§ Disease-associated short tandem repeats co-localize with chromatin domain boundaries > STAR Methods > QUANTIFICATION AND STATISTICAL ANALYSES
What the sources say
- Not checked yetcites Imakaev et al., 2012 source
plain- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: passes — The paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
Probably not a substantial claim.
What the paper did — it cites no source for this, so there is none to check. The quote shows it is in the paper.
In the paper
“To facilitate the comparison of ChIPseq libraries across cell types, the mapped reads were filtered to remove optical and PCR duplicates and then downsampled to equivalent read numbers across cellular states.”
§ Disease-associated short tandem repeats co-localize with chromatin domain boundaries > STAR Methods > QUANTIFICATION AND STATISTICAL ANALYSES
plaindirect- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: passes — The paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
Probably not a substantial claim.
What the paper did — it cites no source for this, so there is none to check. The quote shows it is in the paper.
In the paper
“The 120kb boundary size was chosen to address the resolution limit of the Hi-C assays, 40 kb, used in this study.”
§ Disease-associated short tandem repeats co-localize with chromatin domain boundaries > STAR Methods > QUANTIFICATION AND STATISTICAL ANALYSES
plaindirect- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: passes — The paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
Probably not a substantial claim.
What the paper did — it cites no source for this, so there is none to check. The quote shows it is in the paper.
In the paper
“Bootstrapped confidence intervals for percent of repeats at boundary and CpG island density were constructed by randomly selecting groups of 26 repeats from both the matched repeat set and the daSTRs 1,000 times with replacement and computing the percent of the randomly chosen repeats at a boundary in each sampling.”
§ Disease-associated short tandem repeats co-localize with chromatin domain boundaries > STAR Methods > QUANTIFICATION AND STATISTICAL ANALYSES
plainn = 26- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: passes — The paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
Probably not a substantial claim. The quote only partly states this claim.
The paper relies on this without support.
The role for TAD boundaries in neurological disorders has not yet been reported.
“but the role for TAD boundaries in neurological disorders has not yet been reported.”
The paper relies on this without support.
Mapping daSTRs to normal-length repeat tracts in the hg19 reference genome is representative of disease-associated STR loci.
“Because the samples are not diseased, we mapped daSTRs to the normal-length repeat tracts found in the hg19 reference genome (Tables S1-S3).”
The paper relies on this without support.
Domain boundaries called in human ES cells and fetal cortical plate are relevant to the cell types of pathology for all daSTRs.
“Thus, although the target cell type(s) for many unstable repeat expansion disorders are unknown, the strong enrichment at boundaries regardless of tissue origin suggests that daSTR co-localization with boundaries might be robust across cell types relevant for the pathology.”
Claims other papers make about this one
Each is checked against this paper’s own text: does it say what the citing paper says it does?
In the citing paper
“the disruption of 3D genome organization has been demonstrated in neurodevelopmental and neurological neurodegenerative disorders such as Huntington’s disease, Fragile X syndrome, Down syndrome, etc.”
From Neuronal DNA double-strand breaks lead to genome structural variations and 3D genome disruption in neurodegeneration (2023) · cites this paper as [43]
In the citing paper
“Genome misfolding has been reported in fragile X syndrome48, the leading monogenic cause of ASD, as well as other human diseases49”
From Three-dimensional genome restructuring across timescales of activity-induced neuronal gene expression (2020) · cites this paper as [48]
Self-check
Percentages, sums and reported differences re-computed from the paper’s own numbers.
Rated minor: it would not touch a result — a value no result rests on, a p-value that stays on the same side of the significance level, or a conflict that is clerical, resolved elsewhere in the paper, or outside its own findings.
In the paper
“The classes are: (1) Repeat unit CAG in exons and 5’UTRs (9 daSTRs), (2) Repeat unit GCG/CGG in exons and 5’UTRs (8 daSTRs), (3) Unique repeat units in introns (5 daSTRs), and (4) CTG introns in 3’UTRs (3 daSTRs).”
§ Disease-associated short tandem repeats co-localize with chromatin domain boundaries > STAR Methods > QUANTIFICATION AND STATISTICAL ANALYSES
Reported 26 · recomputed 25
Citations
Cites
Fast gapped-read alignment with Bowtie 2
Langmead, B., & Salzberg, S. L. (2012) · Nature Methods · doi:10.1038/nmeth.1923 · Cited by 56,400 · cited 1×
“…for CTCF peak 2 F: TCTTGTCTGGCCT GTATGGTTR: CCATATTGCACAATGCAGCTCT This paper N/A Software and Algorithms Bowtie/Bowtie2 Langmead et al., 2009; Langmead and Salzberg, 2012 http://bowtie-bio.sourceforge.net/ Python MACS Zhang et al., 2008 https://github.com/taoliu/MACS BEDTools Quinlan 2014…”
BackgroundUltrafast and memory-efficient alignment of short DNA sequences to the human genome.
Langmead, B., Trapnell, C., Pop, M., & Salzberg, S. L. (2009) · Genome Biology · doi:10.1186/gb-2009-10-3-r25 · Cited by 21,849
Model-based Analysis of ChIP-Seq (MACS)
Zhang, Y., Liu, T., Meyer, C. A., Eeckhoute, J., Johnson, D. S., Bernstein, B. E., Nusbaum, C., Myers, R. M., Brown, M., Li, W., et al. (2008) · Genome Biology · doi:10.1186/gb-2008-9-9-r137 · Cited by 18,386
MEME SUITE: tools for motif discovery and searching
Bailey, T. L., Boden, M., Buske, F. A., Frith, M., Grant, C. E., Clementi, L., Ren, J., Li, W. W., & Noble, W. S. (2009) · Nucleic Acids Research · doi:10.1093/nar/gkp335 · Cited by 10,648
A 3D Map of the Human Genome at Kilobase Resolution Reveals Principles of Chromatin Looping
Rao, S. S. P., Huntley, M. H., Durand, N. C., Stamenova, E. K., Bochkov, I. D., Robinson, J. T., Sanborn, A. L., Machol, I., Omer, A. D., Lander, E. S., et al. (2014) · Cell · doi:10.1016/j.cell.2014.11.021 · Cited by 9,212 · cited 1×
“Consistent with the established principles of CTCF motif convergency (Rao et al., 2014), the doublet CTCF sites contained CTCF motifs in the reverse orientation and looped to distal CTCF occupied motifs oriented in the forward direction (Figures 6C and 6D).”
BackgroundBolstad, B. M., Irizarry, R. A., Åstrand, M., & Speed, T. P. (2003) · Bioinformatics · doi:10.1093/bioinformatics/19.2.185 · Cited by 8,328
deepTools2: a next generation web server for deep-sequencing data analysis
Ramírez, F., Ryan, D. P., Grüning, B., Bhardwaj, V., Kilpert, F., Richter, A. S., Heyne, S., Dündar, F., & Manke, T. (2016) · Nucleic Acids Research · doi:10.1093/nar/gkw257 · Cited by 8,096 · cited 1×
“…matrix balancing Imakaev et al., 2012 https://github.com/hiclib/iced MEME Suite Bailey et al., 2009 http://meme-suite.org Quantile normalization Bolstad et al., 2003 https://www.ncbi.nlm.nih.gov/pubmed/ 12538238 deepTools Ramı́rez et al., 2016 https://github.com/deeptools/deepTools”
Topological domains in mammalian genomes identified by analysis of chromatin interactions
Dixon, J. R., Selvaraj, S., Yue, F., Kim, A., Li, Y., Shen, Y., Hu, M., Liu, J. S., & Ren, B. (2012) · Nature · doi:10.1038/nature11082 · Cited by 6,829 · cited 3×
“Mammalian genomes are organized into a hierarchy of megabase (Mb)-scale topologically associating domains (TADs) (Dixon et al., 2012; Nora et al., 2012) and smaller, nested subTADs (Dixon et al.”
BackgroundResultHistone H3K27ac separates active from poised enhancers and predicts developmental state
Creyghton, M. P., Cheng, A. W., Welstead, G. G., Kooistra, T., Carey, B. W., Steine, E. J., Hanna, J., Lodato, M. A., Frampton, G. M., Sharp, P. A., et al. (2010) · Proceedings of the National Academy of Sciences · doi:10.1073/pnas.1016071107 · Cited by 4,302 · cited 1×
“Finally, to better understand how the FXS topological changes might be connected to FMR1 trancriptional silencing, we mined published ChIP-seq data in GM12878 cells for H3K27ac, an established mark of active enhancers (Creyghton et al., 2010).”
MethodVerkerk, A. J. M. H., Pieretti, M., Sutcliffe, J. S., Fu, Y.-H., Kuhl, D. P. A., Pizzuti, A., Reiner, O., Richards, S., Victoria, M. F., Zhang, F., et al. (1991) · Cell · doi:10.1016/0092-8674(91)90397-h · Cited by 3,481 · cited 1×
“Boundary Disruption in Fragile X Syndrome Patients Correlates with FMR1 Silencing FXS is caused by the loss of the fragile X mental retardation protein (FMRP) encoded by FMR1 (Verkerk et al., 1991).”
Background
Cited by
Sorted by citations
Transcription factors and 3D genome conformation in cell-fate decisions
Stadhouders, R., Filion, G. J. P., & Graf, T. (2019) · Nature · doi:10.1038/s41586-019-1182-7 · Cited by 530
On the existence and functionality of topologically associating domains
Beagan, J. A., & Phillips‐Cremins, J. E. (2020) · Nature Genetics · doi:10.1038/s41588-019-0561-1 · Cited by 381
Self-citationIncomplete Penetrance and Variable Expressivity: From Clinical Studies to Population Cohorts
Kingdom, R., & Wright, C. F. (2022) · Frontiers in Genetics · doi:10.3389/fgene.2022.920390 · Cited by 326
“Non-coding variants within enhancer regions can be a cause of phenotypic diversity through alterations in gene expression, therefore affecting overall disease phenotype presentation (Sun et al., 2018).”
BackgroundOn the wrong DNA track: Molecular mechanisms of repeat-mediated genome instability
Khristich, A. N., & Mirkin, S. M. (2020) · Journal of Biological Chemistry · doi:10.1074/jbc.rev119.007678 · Cited by 289
Mismatch Repair Pathway, Genome Stability and Cancer
Pećina‐Šlaus, N., Kafka, A., Salamon, I., & Bukovac, A. (2020) · Frontiers in Molecular Biosciences · doi:10.3389/fmolb.2020.00122 · Cited by 303
“Recently it has been demonstrated that disease associated microsatellites are located in nexuses between chromatin domains (Sun et al., 2018) suggesting affected gene replication and expression.”
BackgroundEnhancers in disease: molecular basis and emerging treatment strategies
Claringbould, A., & Zaugg, J. B. (2021) · Trends in Molecular Medicine · doi:10.1016/j.molmed.2021.07.012 · Cited by 179
Repetitive DNA sequence detection and its role in the human genome
Liao, X., Zhu, W., Zhou, J., Li, H., Xu, X., Zhang, B., & Gao, X. (2023) · Communications Biology · doi:10.1038/s42003-023-05322-y · Cited by 200
“However, they contain various regulatory elements involved in post-transcriptional gene regulation, such as mRNA stability, localization, and translation ef fi ciency 138 .”
BackgroundBeagan, J. A., Pastuzyn, E. D., Fernandez, L. R., Guo, M. H., Feng, K., Titus, K. R., Chandrashekar, H., Shepherd, J. D., & Phillips-Cremins, J. E. (2020) · Nature Neuroscience · doi:10.1038/s41593-020-0634-6 · Cited by 143
“5C reactions were carried out as previously described 29,48,56 .”
BackgroundMethodSelf-citationCohesin-dependence of neuronal gene expression relates to chromatin loop length
Calderon, L., Weiss, F. D., Beagan, J. A., Oliveira, M. S., Georgieva, R., Wang, Y.-F., Carroll, T. S., Dharmalingam, G., Gong, W., Tossell, K., et al. (2022) · eLife · doi:10.7554/elife.76539 · Cited by 132
“Rad21tev/tev mice have been described (Tachibana-Konwalski et al., 2010; 1041 Weiss et al., 2021).”
Self-citationDileep, V., Boix, C. A., Mathys, H., Marco, A., Welch, G. M., Meharena, H. S., Loon, A., Jeloka, R., Peng, Z., Bennett, D. A., et al. (2023) · Cell · doi:10.1016/j.cell.2023.08.038 · Cited by 130
“41 Further, the disruption of 3D genome organization has been demonstrated in neurodevelopmental disorders such as Fragile X syndrome and Down syndrome, etc. 42,43 Chromatin accessibility has also been shown to be disrupted in the AD brain.”
BackgroundJakubosky, D. A., D’Antonio, M., Bonder, M. J., Smail, C., Donovan, M. K. R., Greenwald, W. W. Y., Matsui, H., Bonder, M. J., Cai, N., Carcamo‐Orive, I., et al. (2020) · Nature Communications · doi:10.1038/s41467-020-16482-4 · Cited by 116
The Role of Noncoding Variants in Heritable Disease
French, J. D., & Edwards, S. L. (2020) · Trends in Genetics · doi:10.1016/j.tig.2020.07.004 · Cited by 128
“They showed in four fragile X syndrome patients that boundary disruption correlated with loss of CTCF occupancy and FMR1 transcriptional silencing, providing a new link between tandem repeat instability and 3D folding [75] (Figure 3C).”
BackgroundVisualizing the genome in high resolution challenges our textbook understanding
Lakadamyali, M., & Cosma, M. P. (2020) · Nature Methods · doi:10.1038/s41592-020-0758-3 · Cited by 92
TADs and Their Borders: Free Movement or Building a Wall?
Chang, L., Ghosh, S., & Noordermeer, D. (2019) · Journal of Molecular Biology · doi:10.1016/j.jmb.2019.11.025 · Cited by 97
Dekker, J., Alber, F., Aufmkolk, S., Beliveau, B. J., Bruneau, B. G., Belmont, A. S., Bintu, L., Boettiger, A. N., Calandrelli, R., Distèche, C. M., et al. (2023) · Molecular Cell · doi:10.1016/j.molcel.2023.06.018 · Cited by 98
Self-citationComputational methods for analysing multiscale 3D genome organization
Zhang, Y., Boninsegna, L., Yang, M., Misteli, T., Alber, F., & Ma, J. (2023) · Nature Reviews Genetics · doi:10.1038/s41576-023-00638-1 · Cited by 97
“DNA alterations such as short tandem repeats 198 and structural variations 199 have been found to shape 3D genome organization.”
Modifiers of CAG/CTG Repeat Instability: Insights from Mammalian Models
Wheeler, V. C., & Dion, V. (2021) · Journal of Huntington s Disease · doi:10.3233/jhd-200426 · Cited by 88
DNA methylation study of Huntington’s disease and motor progression in patients and in animal models
Lu, A. T.-H., Narayan, P. J., Grant, M. J., Langfelder, P., Wang, N., Kwak, S., Wilkinson, H. A., Chen, R. Z., Chen, J., Bawden, C. S., et al. (2020) · Nature Communications · doi:10.1038/s41467-020-18255-5 · Cited by 85
Invited Review: Epigenetics in neurodevelopment
Salinas, R. D., Connolly, D. R., & Song, H. (2020) · Neuropathology and Applied Neurobiology · doi:10.1111/nan.12608 · Cited by 90
Verbiest, M. A., Maksimov, M., Ye, J., Anisimova, M. O., Gymrek, M., & Sonay, T. B. (2022) · Journal of Evolutionary Biology · doi:10.1111/jeb.14106 · Cited by 82
“Additional studies have demonstrated that STRs may affect 3D chromatin structure (Sun et al., 2018) and are enriched in chromatin loops (Jakubosky et al., 2020), suggesting a role of non- coding STRs in epigenetic regulation.”
BackgroundChromatin compartment dynamics in a haploinsufficient model of cardiac laminopathy
Bertero, A., Fields, P., Smith, A. S. T., Leonard, A., Beussman, K. M., Sniadecki, N. J., Kim, D., Tse, H., Pabon, L., Shendure, J., et al. (2019) · The Journal of Cell Biology · doi:10.1083/jcb.201902117 · Cited by 77
Order and disorder: abnormal 3D chromatin organization in human disease
Anania, C., & Lupiáñez, D. G. (2019) · Briefings in Functional Genomics · doi:10.1093/bfgp/elz028 · Cited by 74
“novel molecular mechanism behind the FMR1 gene silencing in Fragile X syndrome (FXS), a disease characterized by an unstable expansion of repetitive DNA sequences termed short tandem repeats (STRs) [94].”
BackgroundTransposable elements drive reorganisation of 3D chromatin during early embryogenesisPreprint
Kruse, K., Díaz, N., Enriquez-Gasca, R., Gaume, X., Torres‐Padilla, M., & Vaquerizas, J. M. (2019) · bioRxiv (Cold Spring Harbor Laboratory) · doi:10.1101/523712 · Cited by 79
“More recently, an association between the expansion of disease-associated tandem repeats and three-dimensional chromatin topology has been reported, highlighting the role of these elements for healthy cellular function (Sun et al. 2018).”
BackgroundGenomic Enhancers in Brain Health and Disease
Carullo, N. V. N., & Day, J. J. (2019) · Genes · doi:10.3390/genes10010043 · Cited by 72
Okhovat, M., VanCampen, J., Nevonen, K. A., Harshman, L., Li, W., Layman, C. E., Ward, S., Herrera, J., Wells, J., Sheng, R. R., et al. (2023) · Nature Communications · doi:10.1038/s41467-023-43841-8 · Cited by 68
“6).”
InfluentialThree-dimensional chromatin in disease: What holds us together and what drives us apart?
Ibrahim, D. M., & Mundlos, S. (2020) · Current Opinion in Cell Biology · doi:10.1016/j.ceb.2020.01.003 · Cited by 70
Wulfridge, P., & Sarma, K. (2024) · Nature Cell Biology · doi:10.1038/s41556-024-01437-4 · Cited by 69
“In addition, the expansion of tandem repeats at 3D chromatin boundaries is linked to boundary disruption in repeat expansion diseases such as fragile X syndrome 128 .”
Interpreting the impact of noncoding structural variation in neurodevelopmental disorders
D’haene, E., & Vergult, S. (2020) · Genetics in Medicine · doi:10.1038/s41436-020-00974-1 · Cited by 63
Single-cell multiplex chromatin and RNA interactions in ageing human brain
Wen, X., Luo, Z., Zhao, W., Calandrelli, R., Nguyen, T. C., Wan, X., Richard, J. L. C., & Zhong, S. (2024) · Nature · doi:10.1038/s41586-024-07239-w · Cited by 68
“Consist-ently, sequential fluorescence in situ hybridization analysis showed a larger conformational difference between Xa and Xi in excitatory neurons compared with inhibitory neurons or astrocytes in female mice 49 (Supplementary Note 13).”
InfluentialStructure-forming repeats and their impact on genome stability
Brown, R. E., & Freudenreich, C. H. (2020) · Current Opinion in Genetics & Development · doi:10.1016/j.gde.2020.10.006 · Cited by 59
“The authors tested cells from Fragile X Syndrome (FXS) patients and healthy siblings and found that at the FMR1 locus, FXS patients with expanded repeats (>600 CGG repeats) exhibited disrupted TAD boundaries and CCCTC-binding factor (CTCF) binding that correlated to FMR1 silencing, compared to healthy siblings that di…”
BackgroundCalandrelli, R., Wen, X., Richard, J. L. C., Luo, Z., Nguyen, T. C., Chen, C.-J., Qi, Z., Xue, S., Chen, W., Yan, Z., et al. (2023) · Nature Communications · doi:10.1038/s41467-023-42274-7 · Cited by 55
Showpnil, I. A., Selich‐Anderson, J., Taslim, C., Boone, M. A., Crow, J. C., Theisen, E. R., & Lessnick, S. L. (2022) · Nucleic Acids Research · doi:10.1093/nar/gkac747 · Cited by 59
“Alterations to CTCF binding have been previously shown to disrupt TAD boundaries (62,63).”
BackgroundNishihara, H. (2019) · Genes & Genetic Systems · doi:10.1266/ggs.19-00029 · Cited by 55
“Patients with fragile X syndrome with the mutation-length STR exhibit loss of CTCF occupancy, disruption of the TAD boundary, and a reduced expression of the associated gene FMR1 (Sun et al., 2018).”
BackgroundWeiner, D. J., Ling, E., Erdin, S., Tai, D. J. C., Yadav, R., Grove, J., Fu, J. M., Nadig, A., Carey, C. E., Baya, N. A., et al. (2022) · Nature Genetics · doi:10.1038/s41588-022-01203-y · Cited by 51
Enhancer–promoter specificity in gene transcription: molecular mechanisms and disease associations
Friedman, M. J., Wagner, T., Lee, H., Rosenfeld, M. G., & Oh, S. (2024) · Experimental & Molecular Medicine · doi:10.1038/s12276-024-01233-y · Cited by 61
Nuclear pores in genome architecture and enhancer function
Pascual‐García, P., & Capelson, M. (2019) · Current Opinion in Cell Biology · doi:10.1016/j.ceb.2019.04.001 · Cited by 50
Translational genomics and beyond in bipolar disorder
Zhang, C., Xiao, X., Li, T., & Li, M. (2020) · Molecular Psychiatry · doi:10.1038/s41380-020-0782-9 · Cited by 51
3D genome, on repeat: Higher-order folding principles of the heterochromatinized repetitive genome
Haws, S. A., Simándi, Z., Barnett, R. J., & Phillips‐Cremins, J. E. (2022) · Cell · doi:10.1016/j.cell.2022.06.052 · Cited by 55
Self-citationThe role of insulators and transcription in 3D chromatin organization of fliesPreprint
Chathoth, K. T., Mikheeva, L. A., Crevel, G., Wolfe, J. C., Hunter, I., Beckett-Doyle, S., Cotterill, S., Dai, H., Harrison, A., & Zabet, N. R. (2022) · Genome Research · doi:10.1101/gr.275809.121 · Cited by 46
“Several studies have shown that TAD reorganization leads to changes in transcription that correspond to developmental defects or diseases (Chandra et al. 2015; Lupiáñez et al. 2015; Flavahan et al. 2016; Hnisz et al. 2016; Sun et al. 2018; Kraft et al. 2019).”
The motif composition of variable number tandem repeats impacts gene expressionPreprint
Lu, T.-Y. T., Smaruj, P. N., Fudenberg, G., Mancuso, N., & Chaisson, M. (2023) · Genome Research · doi:10.1101/gr.276768.122 · Cited by 45
Native functions of short tandem repeats
Wright, S. E., & Todd, P. K. (2023) · eLife · doi:10.7554/elife.84043 · Cited by 44
Sex Differences in the Epigenome: A Cause or Consequence of Sexual Differentiation of the Brain?
Gegenhuber, B., & Tollkühn, J. (2019) · Genes · doi:10.3390/genes10060432 · Cited by 44
Epigenetic regulatory layers in the 3D nucleus
Willemin, A., Szabó, D., & Pombo, A. (2024) · Molecular Cell · doi:10.1016/j.molcel.2023.12.032 · Cited by 37
Epigenetic regulation in Huntington's disease
Hyeon, J. W., Kim, A. H., & Yano, H. (2021) · Neurochemistry International · doi:10.1016/j.neuint.2021.105074 · Cited by 40
Histone Variants and Histone Modifications in Neurogenesis
Zhang, M., Zhao, J., Lv, Y., Wang, W., Feng, C., Zou, W., Su, L., & Jiao, J. (2020) · Trends in Cell Biology · doi:10.1016/j.tcb.2020.09.003 · Cited by 37
Kwon, D. Y., Xu, B., Zhao, Y.-T., Beagan, J. A., Beagan, J. A., Cui, Y., Xu, B., Zaitseva, D., Phillips‐Cremins, J. E., Blendy, J. A., et al. (2022) · Nature Communications · doi:10.1038/s41467-021-27571-3 · Cited by 39
Self-citation3D spatial genome organization in the nervous system: From development and plasticity to disease
Fujita, Y., Pather, S. R., Ming, G., & Song, H. (2022) · Neuron · doi:10.1016/j.neuron.2022.06.004 · Cited by 37
Generative modeling of multi-mapping reads with mHi-C advances analysis of Hi-C studies
Zheng, Y., Ay, F., & Keleş, S. (2019) · eLife · doi:10.7554/elife.38070 · Cited by 34
“More recently, ( Sun et al., 2018 ) and ( Cournac et al., 2016 ) argued for a fundamental role of repeat elements in the 3D folding of genomes, highlighting the role of higher order chromatin architecture in repeat expansion disorders.”
BackgroundTAD fusion score: discovery and ranking the contribution of deletions to genome structure
Huynh, L. N., & Hormozdiari, F. (2019) · Genome biology · doi:10.1186/s13059-019-1666-7 · Cited by 35
“A recent study [35] also reported that short tandem repeats related to diseases also co-localized at TAD boundaries.”
BackgroundThe polyG diseases: a new disease entity
Liufu, T., Zheng, Y., Yu, J., Yuan, Y., Wang, Z., Deng, J., & Hong, D. (2022) · Acta Neuropathologica Communications · doi:10.1186/s40478-022-01383-y · Cited by 40
Alcalá‐Vida, R., Séguin, J., Lotz, C., Molitor, A. M., Irastorza-Azcárate, I., Awada, A., Karasu, N., Bombardier, A., Cosquer, B., Gómez-Skármeta, J. L., et al. (2021) · Nature Communications · doi:10.1038/s41467-020-20605-2 · Cited by 39
Reddy, K., Jenquin, J. R., McConnell, O. L., Cleary, J. D., Richardson, J. I., Pinto, B. S., Haerle, M. C., Delgado, E., Planco, L., Nakamori, M., et al. (2019) · Proceedings of the National Academy of Sciences · doi:10.1073/pnas.1901893116 · Cited by 33
Xu, L., Yin, L., Qi, Y., Tan, X., Gao, M. Q., & Peng, J. (2021) · Acta Pharmaceutica Sinica B · doi:10.1016/j.apsb.2021.03.022 · Cited by 33
Wen, J., Trost, B., Engchuan, W., Halvorsen, M., Pallotto, L. M., Mitina, A., Ancalade, N., Farrell, M. S., Backstrom, I., Guo, K., et al. (2022) · Molecular Psychiatry · doi:10.1038/s41380-022-01857-4 · Cited by 33
Spatially coordinated heterochromatinization of long synaptic genes in fragile X syndrome
Malachowski, T., Chandradoss, K. R., Boya, R., Zhou, L., Cook, A. L., Chuanbin, S., Pham, K., Haws, S. A., Kim, J. H., Ryu, H.-S., et al. (2023) · Cell · doi:10.1016/j.cell.2023.11.019 · Cited by 32
Self-citationThree-dimensional chromatin organization in cardiac development and disease
Bertero, A., & Rosa‐Garrido, M. (2020) · Journal of Molecular and Cellular Cardiology · doi:10.1016/j.yjmcc.2020.11.008 · Cited by 32
DNA methylation in satellite repeats disorders
Francastel, C., & Magdinier, F. (2019) · Essays in Biochemistry · doi:10.1042/ebc20190028 · Cited by 32
Gaillard, M.-C., Broucqsault, N., Morere, J., Laberthonnìère, C., Dion, C., Badja, C., Roche, S., Nguyen, K., Magdinier, F., & Robin, J. D. (2019) · Scientific Reports · doi:10.1038/s41598-019-46861-x · Cited by 26
Neuron-specific chromosomal megadomain organization is adaptive to recent retrotransposon expansions
Chandrasekaran, S., Espeso‐Gil, S., Loh, Y. E., Javidfar, B., Kassim, B. S., Zhu, Y., Zhang, Y., Dong, Y., Bicks, L. K., Li, H., et al. (2021) · Nature Communications · doi:10.1038/s41467-021-26862-z · Cited by 26
“(genotype [0 IAPs,1+ IAPs]: WT1 [31,4]; WT2 [32,3]; WT3 [47,4]; WT4 [51,0]; KO1 [20,15]; KO2 [21,14]; KO3 [28, 23]; KO4 [26,28]), Student’s two-sided t-test (p=3.69×10-5).”
InfluentialXu, J., Xu, X., Huang, D., Luo, Y., Lin, L., Bai, X., Zheng, Y., Yang, Q., Cheng, Y., Huang, A., et al. (2024) · Nature Communications · doi:10.1038/s41467-024-48593-7 · Cited by 25
“3DNetMod identi fi es subTADs in ESCs to help discover the relationship between high-scale genome topology alteration and disease-associated short tandem repeats (STRs), which is well known to contribute to over 25 inherited disorders 71 .”
Grapotte, M., Saraswat, M., Bessière, C., Menichelli, C., Ramilowski, J. A., Severin, J., Hayashizaki, Y., Itoh, M., Tagami, M., Murata, M., et al. (2021) · Nature Communications · doi:10.1038/s41467-021-23143-7 · Cited by 32
“This observation suggests that, similar to other repeat-initiating RNAs 55,56 , RNAs initiating at STRs could also play roles at the nuclear/chromatin levels, for instance in DNA topology 56,57 .”
BackgroundSAFB restricts contact domain boundaries associated with L1 chimeric transcription
Hong, Y., Bie, L., Zhang, T., Yan, X., Jin, G., Chen, Z., Wang, Y., Li, X., Pei, G., Zhang, Y., et al. (2024) · Molecular Cell · doi:10.1016/j.molcel.2024.03.021 · Cited by 27
The role of GATA4 in mesenchymal stem cell senescence: A new frontier in regenerative medicine
Babu, M. A., Renuka Jyothi, S., Kaur, I., Kumar, S., Sharma, N., Kumar, M., Rajput, P., Ali, H., Gupta, G., Subramaniyan, V., et al. (2024) · Regenerative Therapy · doi:10.1016/j.reth.2024.11.017 · Cited by 25
“Currently, special strategies are being created in order to control it [65].”
RExPRT: a machine learning tool to predict pathogenicity of tandem repeat loci
Fazal, S., Danzi, M. C., Xu, I. R. L., Kobren, S. N., Sunyaev, S. R., Reuter, C. M., Marwaha, S., Wheeler, M. T., Dolzhenko, E., Lucas, F., et al. (2024) · Genome biology · doi:10.1186/s13059-024-03171-4 · Cited by 24
The dynamics of chromatin architecture in brain development and function
Harabula, I., & Pombo, A. (2021) · Current Opinion in Genetics & Development · doi:10.1016/j.gde.2020.12.008 · Cited by 26
Campion, L. N., Maza, A. M., Yadav, R., Penney, E. B., Murcar, M. G., Correia, K., Gillis, T., Fernandez‐Cerado, C., Velasco-Andrada, M. S., Legarda, G. P., et al. (2022) · Acta Neuropathologica Communications · doi:10.1186/s40478-022-01349-0 · Cited by 23
DNA-initiated epigenetic cascades driven by C9orf72 hexanucleotide repeat
Liu, Y., Huang, Z., Liu, H., Ji, Z., Arora, A., Cai, D., Wang, H., Liu, M., Simko, E. A. J., Zhang, Y., et al. (2023) · Neuron · doi:10.1016/j.neuron.2023.01.022 · Cited by 22
The 3D genome and its impacts on human health and disease
Wang, S., Luo, Z., Liu, W., Hu, T., Zhao, Z., Rosenfeld, M. G., & Song, X. (2023) · Life Medicine · doi:10.1093/lifemedi/lnad012 · Cited by 22
“In fragile X syndrome, the STRs within the FMR1 gene are unstable and expand with DNA methylation so that CTCF cannot bind, resulting in silencing of the FMR1 gene [169].”
Epigenetics of Neuromuscular Disorders
Coppedè, F. (2020) · Epigenomics · doi:10.2217/epi-2020-0282 · Cited by 24
Targeted Oligonucleotides for Treating Neurodegenerative Tandem Repeat Diseases
Zain, R., & Rjh, S. (2019) · Neurotherapeutics · doi:10.1007/s13311-019-00712-9 · Cited by 23
“recently reported to co-localize with short tandem repeats [118], and in plants, it was found that an intronic GAA•TTC”
BackgroundGhavi-Helm, Y. (2019) · Journal of Molecular Biology · doi:10.1016/j.jmb.2019.09.010 · Cited by 20
Xiao, X., Zhang, C., Zhang, Z., Hu, Z., Li, M., & Li, T. (2021) · Molecular Psychiatry · doi:10.1038/s41380-021-01329-1 · Cited by 22
Kumari, D., Gazy, I., & Usdin, K. (2019) · Brain Sciences · doi:10.3390/brainsci9020039 · Cited by 21
The molecular pathogenesis of repeat expansion diseases
Fujino, Y., & Nagai, Y. (2021) · Biochemical Society Transactions · doi:10.1042/bst20200143 · Cited by 20
Yin, B., Wang, H., Zhu, P., Weng, S., He, J., & Li, C. (2019) · Frontiers in Genetics · doi:10.3389/fgene.2019.01257 · Cited by 19
Three-dimensional chromatin interactions remain stable upon CAG/CTG repeat expansion
Buendía, G. A. R., Leleu, M., Marzetta, F., Vanzan, L., Tan, J. Y., Ythier, V., Randall, E. L., Marques, A. C., Baubec, T., Murr, R., et al. (2020) · Science Advances · doi:10.1126/sciadv.aaz4012 · Cited by 19
Machine and Deep Learning Methods for Predicting 3D Genome Organization
Wall, B. P. G., Nguyen, M., Harrell, J. C., & Dozmorov, M. G. (2024) · Methods in molecular biology · doi:10.1007/978-1-0716-4136-1_22 · Cited by 20
Epigenetics of Myotonic Dystrophies: A Minireview
Visconti, V. V., Centofanti, F., Fittipaldi, S., Macrì, E., Novelli, G., & Botta, A. (2021) · International Journal of Molecular Sciences · doi:10.3390/ijms222212594 · Cited by 18
“Finally, recent studies revealed a link between 3D genome folding and several expansion disorders in which genes are placed at the boundaries between topologically associating domains (TADs) that are highly enriched on CpG islands, suggesting that repeat expansions could disrupt TADs structure, resulting in a reorgani…”
BackgroundpreciseTAD: a transfer learning framework for 3D domain boundary prediction at base-pair resolution
Stilianoudakis, S. C., Marshall, M. A., & Dozmorov, M. G. (2021) · Bioinformatics · doi:10.1093/bioinformatics/btab743 · Cited by 19
Three‐dimensional genome structure and function
Liu, H., Tsai, H., Yang, M., Li, G., Bian, Q., Ding, G., Wu, D., & Dai, J. (2023) · MedComm · doi:10.1002/mco2.326 · Cited by 25
Fernandez, L. R., Gilgenast, T. G., & Phillips‐Cremins, J. E. (2020) · Genome biology · doi:10.1186/s13059-020-02061-9 · Cited by 17
“Raw 5C counts were subjected to our previously published 5C count modeling methods [32, 60, 62 – 65].”
MethodSelf-citationCell-type-specific loops linked to RNA polymerase II elongation in human neural differentiation
Titus, K. R., Simándi, Z., Chandrashekar, H., Paquet, D., & Phillips‐Cremins, J. E. (2024) · Cell Genomics · doi:10.1016/j.xgen.2024.100606 · Cited by 17
“20,36,37,74,75,78,79 Briefly, media was discarded, cells were washed with 6 mL of 1x PBS and 10 mL of freshly prepared fixation media (1% (v/v) formaldehyde in DMEM/F-12 (Thermo Fisher Scientific, #11320033)) was added to the cells growing on 10 cm cell culture dishes and incubated for 10 min at room…”
Self-citationGenomic Data in the Electronic Health Record
Walton, N., Johnson, D. K., Person, T. N., & Chamala, S. (2019) · Advances in Molecular Pathology · doi:10.1016/j.yamp.2019.07.001 · Cited by 16
Zhang, J., Ooi, J., Utami, K. H., Langley, S. R., Aning, O. A., Park, D. S., Renner, M., Ma, S., Cheok, C. F., Knoblich, J. A., et al. (2019) · bioRxiv (Cold Spring Harbor Laboratory) · doi:10.1101/850586 · Cited by 15
“A recent study has shown that repeat expansion disease genes, including HTT, localize to boundaries of chromatin domains associated with defined chromatin topology [57].”
A landscape of complex tandem repeats within individual human genomes
Ichikawa, K., Kawahara, R., Asano, T., & Morishita, S. (2023) · Nature Communications · doi:10.1038/s41467-023-41262-1 · Cited by 14
“WespeculatethatcomplexTRsinintronsor in intergenic regions may in fl uence promoter-enhancer interactions during brain development 39 because CTCF loops, the basic chromatin structures of the nucleus 40 , have been reported to be established at gastrulation 41 .”
Dynamics of transcriptional enhancers and chromosome topology in gene regulation
Yokoshi, M., & Fukaya, T. (2019) · Development Growth & Differentiation · doi:10.1111/dgd.12597 · Cited by 14
“More recently, many disease- associated tandem repeats were found to be located in topological boundaries (Sun et al., 2018).”
BackgroundRegulatory landscape in brain development and disease
Spiess, K., & Won, H. (2020) · Current Opinion in Genetics & Development · doi:10.1016/j.gde.2020.05.007 · Cited by 14
“A recent study has also shown that the expansion of tandem repeats in fragile X syndrome leads to the disruption of TAD boundaries, suggesting a role of TADs in brain disease [40].”
BackgroundInduction of a chromatin boundary in vivo upon insertion of a TAD border
Willemin, A., Lopez‐Delisle, L., Bolt, C. C., Gadolini, M.-L., Duboule, D., & Rodríguez-Carballo, E. (2021) · PLoS Genetics · doi:10.1371/journal.pgen.1009691 · Cited by 14
“In the vast majority of cases, TAD boundaries host binding sites for CTCF and they are associated with other features including housekeeping genes and CpG islands [2,5,6].”
BackgroundIntegrating transposable elements in the 3D genome
Bousios, A., Nützmann, H., Buck, D., & Michieletto, D. (2020) · Mobile DNA · doi:10.1186/s13100-020-0202-3 · Cited by 16
Three-dimensional chromatin organization in brain function and dysfunction
Dileep, V., & Tsai, L.-H. (2021) · Current Opinion in Neurobiology · doi:10.1016/j.conb.2021.04.006 · Cited by 14
Genetic and Epigenetic Interplay Define Disease Onset and Severity in Repeat Diseases
Barbé, L., & Finkbeiner, S. M. (2022) · Frontiers in Aging Neuroscience · doi:10.3389/fnagi.2022.750629 · Cited by 15
“Finally, a TAD boundary at the repeat region and CTCF binding site was recently shown to be disrupted in DM1, indicating that chromatin organization may be more broadly altered in the disease (Sun et al., 2018).”
BackgroundInfluentialWu, Z., Gong, H., Zhou, Z., Jiang, T., Lin, Z., Li, J., Xiao, S., Yang, B., & Huang, L. (2022) · Journal of Animal Science and Biotechnology/Journal of animal science and biotechnology · doi:10.1186/s40104-021-00658-z · Cited by 15
C9orf72 repeat expansion creates the unstable folate-sensitive fragile site FRA9A
Mirceta, M., Schmidt, M. H. M., Shum, N., Prasolava, T., Meikle, B., Lanni, S., Mohiuddin, M., McKeever, P. M., Zhang, M., Liang, M., et al. (2024) · NAR Molecular Medicine · doi:10.1093/narmme/ugae019 · Cited by 15
A subset of topologically associating domains fold into mesoscale core-periphery networks
Huang, H., Chen, S. T., Titus, K. R., Emerson, D. J., Bassett, D. S., & Phillips‐Cremins, J. E. (2019) · Scientific Reports · doi:10.1038/s41598-019-45457-9 · Cited by 14
Self-citationSpatial genome exploration in the context of cognitive and neurological disease
Rajarajan, P., Borrman, T. M., Liao, W., Espeso‐Gil, S., Chandrasekaran, S., Jiang, Y., Weng, Z., Brennand, K., & Akbarian, S. (2019) · Current Opinion in Neurobiology · doi:10.1016/j.conb.2019.05.007 · Cited by 13
“Unsurprisingly, given that TAD landscapes are largely invariant to cell type, the disease-relevant STR location at TAD boundaries was present in embryonic stem cell, blood, neural progenitor and postmortem brain tissue[45].”
BackgroundInfluentialRelatively semi-conservative replication and a folded slippage model for short tandem repeats
Zhang, H., Li, D., Zhao, X., Pan, S., Wu, X., Peng, S., Huang, H., Shi, R., & Tan, Z. (2020) · BMC Genomics · doi:10.1186/s12864-020-06949-5 · Cited by 12
Common Threads: Aphidicolin-Inducible and Folate-Sensitive Fragile Sites in the Human Genome
Lokanga, R. A., Kumari, D., & Usdin, K. (2021) · Frontiers in Genetics · doi:10.3389/fgene.2021.708860 · Cited by 13
Sorek, M., Cohen, L. R. Z., & Meshorer, E. (2019) · NAR Genomics and Bioinformatics · doi:10.1093/nargab/lqz003 · Cited by 11
“Interestingly, another recent work showed that most of the disease-associated short tandem repeats in the human genome are located at the boundaries between topologically associated domains (TADs) (36).”
Focused Strategies for Defining the Genetic Architecture of Congenital Heart Defects
Martin, L. J., & Benson, D. W. (2021) · Genes · doi:10.3390/genes12060827 · Cited by 13
Visualising three-dimensional genome organisation in two dimensions
Ing‐Simmons, E., & Vaquerizas, J. M. (2019) · Development · doi:10.1242/dev.177162 · Cited by 13
“…expression of developmental transcription factors and thus are associated with developmental defects and congenital disease, including limb malformation disorders and Fragile X syndrome (Franke et al., 2016; Ibn-Salem et al., 2014; Lupiáñez et al., 2015; Spielmann et al., 2018; Sun et al., 2018).”
Background
Metadata
- Authors
- Sun, J. H., Zhou, L., Emerson, D. J., Phyo, S. A., Titus, K. R., Gong, W., Gilgenast, T. G., Beagan, J. A., Davidson, B. L., Tassone, F., & Phillips-Cremins, J. E.
- Affiliations
- University of Pennsylvania (US)
- Children's Hospital of Philadelphia (US)
- University of California, Davis (US)
- ORCID
- Venue
- Cell
- Publisher
- Elsevier BV
- Published
- 2018-09
- Volume
- 175
- Issue
- 1
- Pages
- 224-238.e15
- ISSN
- 0092-8674 (ISSN-L)
- PMC
- PMC6175607
- OpenAlex
- W2889421335
- Semantic Scholar
- 68a0a360b6754c0c8f9f272f6ff06cd5b60de52a
- Cited by
- 249
- References
- 67
- Citations by year
- 2026: 12 · 2025: 24 · 2024: 42 · 2023: 26 · 2022: 41 · 2021: 41 · 2020: 28 · 2019: 32 · 2018: 3
- FWCI
- 12.41
- Type
- journal article
- Language
- en
- Open access
- bronze
- doi.org
- Licence
- Locations
- Cell (publishedVersion)
- PubMed (publishedVersion)
- Europe PMC (PubMed Central) (acceptedVersion)
- PubMed Central (acceptedVersion)
- eScholarship (California Digital Library) (submittedVersion)
- Funders
- The New York Stem Cell Foundation
- Alfred P. Sloan Foundation
- NIH Director’s New Innovator Award (1DP2MH11024701)
- 4D Nucleome Common Fund (1U01HL12999801)
- NIH (R01 GM113929)
- NSF-NIGMS (1562665)
- Topics
- Life Sciences › Neuroscience › Cellular and Molecular Neuroscience › Genetic Neurodegenerative Diseases
- Life Sciences › Biochemistry, Genetics and Molecular Biology › Molecular Biology › Genomics and Chromatin Dynamics
- Life Sciences › Biochemistry, Genetics and Molecular Biology › Genetics › Genetics and Neurodevelopmental Disorders
- Keywords
- microsatellite markers, repeat expansion disorders, chromatin domain boundaries, CpG islands, fragile X syndrome, chromatin topology
- MeSH terms
- CCCTC-Binding Factor, Adult, Brain, Cell Line, Chromatin, Disease, DNA, Female, Fragile X Syndrome, Humans, Male, Genome, Human, Microsatellite Repeats, CpG Islands, Trinucleotide Repeat Expansion, Chromatin Assembly and Disassembly, Fragile X Messenger Ribonucleoprotein 1
About these checks
Registry, retraction, Cites and statistics results are computed, not judged, with one exception: a printed reference that no index lists is read once by a model before it counts as a citation error. Claims are extracted by a model and kept only when their quote appears verbatim in the text; each cited source is then checked, with a model’s help, for whether it says what the claim relies on. Those verdicts can be wrong — read the claim’s quote and the cited source before relying on one.
A language model drew the claims from the paper on 2026-10-10, under version 3 of the claim definition (model deepseek-v4.1-flash, prompt extract-v3).
A second model labelled each claim on 2026-10-10 (model jev-1.13-20260917, definition revision gold-guideline-v0.2).
Cited sources are checked with a language model’s help (gpt-6-sol).
Statistics and arithmetic are recomputed, not judged.
Confidence bands are shown only for fields calibrated on our annotated test set. None is calibrated yet, so no band is shown.
What counts as a claim ›How we measure confidence ›How we check this ›
Are you an author, or do you see a problem with this page? Request a review
