The DOI matches its Crossref record; 66 of the 67 references it cites were found in a registry or an index; 1 of the 56 sources its claims cite were checked for support.
Disease-Associated Short Tandem Repeats Co-localize with Chromatin Domain Boundaries
Open accessAbstract
Summary More than 25 inherited human disorders are caused by the unstable expansion of repetitive DNA sequences termed short tandem repeats (STRs). A fundamental unresolved question is why some STRs are susceptible to pathologic expansion, whereas thousands of repeat tracts across the human genome are relatively stable. Here, we discover that nearly all disease-associated STRs (daSTRs) are located at boundaries demarcating 3D chromatin domains. We identify a subset of boundaries with markedly higher CpG island density compared to the rest of the genome. daSTRs specifically localize to ultra-high-density CpG island boundaries, suggesting they might be hotspots for epigenetic misregulation or topological disruption upon STR expansion. Fragile X Syndrome patients exhibit severe boundary disruption in a manner that correlates with local loss of CTCF occupancy and the degree of FMR1 silencing. Our data uncover higher-order chromatin architecture as a new dimension in understanding repeat expansion disorders.
Overview
AI snapshot
Written from the paper’s full text.
TL;DR
Nearly all disease-associated short tandem repeats (daSTRs) localize to 3D chromatin domain boundaries, especially boundaries with ultra-high CpG island density and high CTCF occupancy. In Fragile X syndrome, the FMR1 boundary is disrupted in patients, correlating with local CTCF loss and FMR1 silencing.
Key findings
- 22 of 27 daSTR loci localized to human ES cell boundaries, including 11 at TAD boundaries and 11 at subTAD boundaries; 21 of 23 neurological daSTRs localized to boundaries in human fetal cortical plate tissue.
- daSTRs were significantly closer to domain boundaries than matched normal-length repeats (0 bp versus 5,203 bp median; P = 0.00074 Mann-Whitney U; P = 0.0037 Kolmogorov-Smirnov) and enriched at boundaries (odds ratio = 4.77, Fisher’s exact P = 0.00056).
- daSTRs localized to CpG island-rich boundaries more than matched repeats (odds ratio = 10.4, P = 1.4E-8), with 65.7% of daSTRs at CpG island-rich boundaries versus 22.0% of matched repeats; no significant difference was found at CpG island-depleted boundaries or non-boundary CpG islands.
- In Fragile X syndrome patient samples, the FMR1 TAD boundary was ablated, a CTCF doublet ~100 kb upstream was lost, and boundary disruption correlated with FMR1 silencing; these topological changes occurred in at least three cell types and four patients.
Methods
- Analyzed published Hi-C data from human ES cells and human fetal cortical plate tissue, using DI+HMM for Mb-scale TADs and 3DNetMod for nested subTADs; daSTRs were mapped in hg19 and compared with normal-length repeats matched by repeat sequence, length range, and gene body placement.
- Performed 5C, CTCF ChIP-seq, qRT-PCR for FMR1 expression, and Sanger sequencing in Fragile X syndrome patient and control B-lymphocytes, fibroblasts, and postmortem brain tissue.
- Used Fisher’s exact, Kolmogorov-Smirnov, Cochran–Mantel–Haenszel, randomization, and bootstrapped tests to assess boundary localization and CpG island density.
Limitations
- The paper states it does not aim to identify specific genetic variants predicting which individuals develop repeat expansion disorders, and that cause-and-effect relationships among boundary disruption, DNA methylation, CTCF occupancy, CpG islands, STR expansion, and gene expression remain unresolved.
- The paper notes that statistical power was restricted by small daSTR class sizes, and that rigorous thresholds likely missed some visually evident boundaries, making boundary enrichment estimates conservative.
- Evident from the text: the Fragile X syndrome topological analyses rely on a small number of patient samples and cell types, and the link between boundary disruption and FMR1 silencing is correlative rather than causal.
Model-written summary. Check it against the paper before relying on it.
Integrity signals
Registry
Cites
Statistics
Verification
Claims the paper makes
48 Own result · 29 Not checked yet · 25 Own interpretation · 8 Own method · 3 No basis given · 1 Partly supported · accuracy not yet measured
A result the paper reports from its own data — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“Importantly, daSTRs localize with boundaries exhibiting ultra-high CpG island density (blue spheres, Figure 4A).”
§ Disease-associated short tandem repeats co-localize with chromatin domain boundaries > Results > Boundaries containing daSTRs are characterized by ultra-high density of CpG islands
plaincorrelational- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: passes — The paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
A result the paper reports from its own data — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“Third, the small subTAD encompassing the FMR1 gene dissolves in the ~935 FXS patient compared to the healthy sibling (Figure 5B-C, lower green arrow).”
§ Disease-associated short tandem repeats co-localize with chromatin domain boundaries > Results > TAD boundary at the FMR1 daSTR is ablated in Fragile X Syndrome
plaindirectSingle case- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: passes — The paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
A result the paper reports from its own data — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“We observed severe topological disruption around the FMR1 daSTR in both FXS patient B cell lines compared to the healthy sibling with normal-length repeats (Figure 5B-D).”
§ Disease-associated short tandem repeats co-localize with chromatin domain boundaries > Results > TAD boundary at the FMR1 daSTR is ablated in Fragile X Syndrome
plaincorrelationaln = 2- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: passes — The paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
A result the paper reports from its own data — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“Consistent with our observations in human ES cells, we found 8 out of the 23 neurological daSTR loci were detected at TAD boundaries in human fetal cortical plate tissue (Figure 3A).”
§ Disease-associated short tandem repeats co-localize with chromatin domain boundaries > Results > daSTRs linked to neurological disorders co-localize with boundaries in human cortical tissue
plaincorrelational- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: passes — The paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
A result the paper reports from its own data — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“Although statistical power was restricted by the small size of the groups, all four classes of daSTRs showed enrichment at boundaries compared to other normal-length repeats matched by sequence and gene body location (Figure S5A).”
§ Disease-associated short tandem repeats co-localize with chromatin domain boundaries > Results > daSTRs linked to neurological disorders co-localize with boundaries in human cortical tissue
plaincorrelational- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: passes — The paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
A result the paper reports from its own data — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“Boundaries containing matched normal-length repeat tracts show a striking increase in CpG island density compared to boundaries without repeats (Odds Ratio = 3.92, Fisher’s Exact Test, P = 1.69E-110, Figure 4A-B).”
§ Disease-associated short tandem repeats co-localize with chromatin domain boundaries > Results > Boundaries containing daSTRs are characterized by ultra-high density of CpG islands
boostedcorrelational- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: passes — The paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
A result the paper reports from its own data — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“The extent of boundary disruption correlates with the degree of FMR1 silencing and local loss of CTCF occupancy at specific sites.”
§ Disease-associated short tandem repeats co-localize with chromatin domain boundaries > Introduction
plaincorrelational- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: passes — The paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
A result the paper reports from its own data — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“First, a domain boundary separating FMR1 from the immediate upstream TAD in the healthy sibling was ablated in the ~935 FXS patient (Figure 5B-C, green bracket).”
§ Disease-associated short tandem repeats co-localize with chromatin domain boundaries > Results > TAD boundary at the FMR1 daSTR is ablated in Fragile X Syndrome
plaindirectSingle case- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: passes — The paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
A result the paper reports from its own data — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“The mean percentage of drawn repeats tracts that are boundary-associated increased from 49.5% (bootstrapped 95% CI: 30.3% < μpercent_boundary < 68.6%) in matched repeats compared to 81.1% (bootstrapped 95% CI: 66.2% < μpercent_boundary < 96.0%) in daSTRs, respectively (Figure 2C).”
§ Disease-associated short tandem repeats co-localize with chromatin domain boundaries > Results > daSTRs localize to boundaries significantly more than normal-length repeats genome-wide
plaindirect- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: passes — The paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
A result the paper reports from its own data — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“Importantly, there is no significant difference between matched repeats and daSTRs when the test is performed on CpG island-depleted boundaries (Fisher's Exact Test: Odds Ratio = 0.271 and P = 0.063; Cochran-Mantel-Haenszel Test: Odds Ratio = 0.364; Figure 4E)”
§ Disease-associated short tandem repeats co-localize with chromatin domain boundaries > Results > Boundaries containing daSTRs are characterized by ultra-high density of CpG islands
plain- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: passes — The paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
- Probably not a substantial claim. 32
- It may state two separate claims as one. 26
- The quote only partly states this claim. 1
The cited sources support only part of this claim — read each source’s verdict below.
In the paper
“Moreover, CpG islands are aberrantly hypermethylated in a subset of cancers that exhibit microsatellite instability (Sharma et al., 2010; You and Jones, 2012).”
§ Disease-associated short tandem repeats co-localize with chromatin domain boundaries > Discussion
What the sources say
- Partly supportedcites Sharma et al., 2010 sourceExperimental — accuracy not yet measured
The ‘DNA methylation aberrations in cancer’ section describes tumor-specific CpG-island hypermethylation and coordinated methylation of a subset of islands in tumors. It does not itself connect those tumors to microsatellite instability; that connection appears only in the title of reference 86, so the microsatellite-instability qualifier is not supported by the paper’s discussion. (LLM, conf=0.82)
- Not checked yetcites You and Jones, 2012
plaincorrelational- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: fails — The paper’s conclusions may not depend on it.
- Based: passes — The paper gives a reason why it holds.
Probably not a substantial claim. The paper’s conclusions may not depend on it.
- Partly supported
A result the paper reports from its own data — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“An additional 8 and 5 daSTRs localized to subTAD and qualitatively apparent boundaries, respectively (Figure 3B, Figure S4A-C).”
§ Disease-associated short tandem repeats co-localize with chromatin domain boundaries > Results > daSTRs linked to neurological disorders co-localize with boundaries in human cortical tissue
plaincorrelational- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: passes — The paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
It may state two separate claims as one.
A result the paper reports from its own data — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“We observed that nearly all daSTRs are specifically targeted to CpG island-rich boundaries, but not boundaries devoid of CpG islands or CpG islands internal to domains.”
§ Disease-associated short tandem repeats co-localize with chromatin domain boundaries > Introduction
plaincorrelational- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: passes — The paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
It may state two separate claims as one.
A result the paper reports from its own data — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“Noteworthy, we also observed a marked increase in the density of CpG islands at boundaries vs. non-boundaries, whereas classic repressive chromatin marks such as H3K9me3 were slightly depleted at boundaries compared to loci internal to domains.”
§ Disease-associated short tandem repeats co-localize with chromatin domain boundaries > Results > Boundaries containing daSTRs are characterized by ultra-high density of CpG islands
plaincorrelational- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: unclear — It is unclear whether the paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
It may state two separate claims as one.
A result the paper reports from its own data — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“We found severe reduction of FMR1 expression in all FXS patient samples with boundary disruption, whereas boundaries remained intact if FMR1 was not silenced (Figure 6G-H, Figure S7I-K).”
§ Disease-associated short tandem repeats co-localize with chromatin domain boundaries > Results > Boundary disruption in Fragile X Syndrome patients correlates with FMR1 silencing
plaincorrelational- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: passes — The paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
It may state two separate claims as one.
A result the paper reports from its own data — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“The CTCF doublet is located directly at the base of the upstream loop and TAD boundary; disruption of these structural features in FXS patients correlated with lost CTCF occupancy (Figure 6C-D).”
§ Disease-associated short tandem repeats co-localize with chromatin domain boundaries > Results > CTCF occupancy at the FMR1 daSTR is ablated in Fragile X Syndrome
plaincorrelational- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: passes — The paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
It may state two separate claims as one.
A result the paper reports from its own data — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“We also noticed that the specific long-range contacts between FMR1 and the downstream TAD were lost in FXS but not mediated by CTCF (Figure 6E, Figure S7G), suggesting that additional architectural proteins are affected by repeat expansion.”
§ Disease-associated short tandem repeats co-localize with chromatin domain boundaries > Results > CTCF occupancy at the FMR1 daSTR is ablated in Fragile X Syndrome
plain- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: passes — The paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
It may state two separate claims as one.
In the paper
“Consistent with the established principles of CTCF motif convergency (Rao et al., 2014), the doublet CTCF sites contained CTCF motifs in the reverse orientation and looped to distal CTCF occupied motifs oriented in the forward direction (Figure 6C-D).”
§ Disease-associated short tandem repeats co-localize with chromatin domain boundaries > Results > CTCF occupancy at the FMR1 daSTR is ablated in Fragile X Syndrome
What the sources say
- Not checked yetcites Rao et al., 2014 source
boostedcorrelational- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: unclear — It is unclear whether the paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
It may state two separate claims as one.
A result the paper reports from its own data — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“We found increased density of H3K27ac+ putative enhancers in the downstream TAD and minimal H3K27ac+ signal in the TAD upstream of the FMR1 daSTR (Figure 6I).”
§ Disease-associated short tandem repeats co-localize with chromatin domain boundaries > Results > Boundary disruption in Fragile X Syndrome patients correlates with FMR1 silencing
plaincorrelational- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: passes — The paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
It may state two separate claims as one.
A result the paper reports from its own data — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“FMR1 is biased towards downstream contacts (positive DI) in healthy individuals and transitions to upstream contacts (negative DI) in diseased individuals.”
§ Disease-associated short tandem repeats co-localize with chromatin domain boundaries > Results > TAD boundary at the FMR1 daSTR is ablated in Fragile X Syndrome
plaincorrelational- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: passes — The paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
It may state two separate claims as one.
A result the paper reports from its own data — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“One final gene (CSTB) was queried for boundary localization but dropped from all analyses that compared daSTRs to matched, normal-length repeats because there are no other repeats matching its sequence, length, and gene body location requirements in hg19.”
§ Disease-associated short tandem repeats co-localize with chromatin domain boundaries > STAR Methods > QUANTIFICATION AND STATISTICAL ANALYSES
plaindirect- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: fails — The paper’s conclusions may not depend on it.
- Based: passes — The paper gives a reason why it holds.
Probably not a substantial claim. The paper’s conclusions may not depend on it.
The paper states this without a source or data behind it here, so there is nothing to check it against. The quote shows it is in the paper.
In the paper
“Of these 29, two (TBP, NOP56) were dropped from our analyses because they were located at the far edges of chromosomes beyond where Hi-C can query domains.”
§ Disease-associated short tandem repeats co-localize with chromatin domain boundaries > STAR Methods > QUANTIFICATION AND STATISTICAL ANALYSES
plaindirect- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: fails — The paper’s conclusions may not depend on it.
- Based: passes — The paper gives a reason why it holds.
Probably not a substantial claim. The paper’s conclusions may not depend on it.
None of the sources cited for this claim have been checked yet.
In the paper
“Mammalian genomes are organized into a hierarchy of Megabase (Mb)-scale topologically associating domains (TADs) (Dixon et al., 2012; Nora et al., 2012) and smaller, nested subTADs (Dixon et al., 2012; Nora et al., 2012; Phillips-Cremins et al., 2013; Rao et al., 2014).”
§ Disease-associated short tandem repeats co-localize with chromatin domain boundaries > Introduction
What the sources say
plain- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: passes — The paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
Probably not a substantial claim.
None of the sources cited for this claim have been checked yet.
In the paper
“By a process that is poorly understood, a small number of specific normal-length STRs undergo somatic or germline expansion and transition to intermediate, pre-mutation, and mutation (affected) repeat unit tract lengths (Mirkin, 2007; Pearson et al., 2005).”
§ Disease-associated short tandem repeats co-localize with chromatin domain boundaries > Introduction
What the sources say
plaindirect- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: fails — The paper’s conclusions may not depend on it.
- Based: passes — The paper gives a reason why it holds.
Probably not a substantial claim. The paper’s conclusions may not depend on it.
None of the sources cited for this claim have been checked yet.
In the paper
“Such chromatin domains span >90% of the genome and are thought to create insulated neighborhoods demarcating the search space of specific long-range interactions between enhancers and their target genes (Dowen et al., 2014; Narendra et al., 2015; Symmons et al., 2014).”
§ Disease-associated short tandem repeats co-localize with chromatin domain boundaries > Introduction
What the sources say
hedged- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: passes — The paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
Probably not a substantial claim. It may state two separate claims as one.
In the paper
“Normal-length STR tracts are generally stable across generations and among somatic tissues in the same individual (McMurray, 2010).”
§ Disease-associated short tandem repeats co-localize with chromatin domain boundaries > Introduction
What the sources say
- Not checked yetcites McMurray, 2010 source
plain- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: passes — The paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
Probably not a substantial claim. It may state two separate claims as one.
In the paper
“daSTRs consist predominantly of a trinucleotide unit, but expandable tetra-, penta-, and hexa-nucleotide repeat sequences have also been reported (Iyer et al., 2015).”
§ Disease-associated short tandem repeats co-localize with chromatin domain boundaries > Introduction
What the sources say
- Not checked yetcites Iyer et al., 2015 source
plain- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: fails — The paper’s conclusions may not depend on it.
- Based: passes — The paper gives a reason why it holds.
Probably not a substantial claim. The paper’s conclusions may not depend on it. It may state two separate claims as one.
None of the sources cited for this claim have been checked yet.
In the paper
“Pre-mutation and mutation lengths vary widely among the repeat expansion disorders (Iyer et al., 2015; McMurray, 2010).”
§ Disease-associated short tandem repeats co-localize with chromatin domain boundaries > Introduction
What the sources say
plain- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: fails — The paper’s conclusions may not depend on it.
- Based: passes — The paper gives a reason why it holds.
Probably not a substantial claim. The paper’s conclusions may not depend on it.
None of the sources cited for this claim have been checked yet.
In the paper
“Healthy individuals have tens of thousands of relatively short STR tracts distributed throughout their genomes (Gymrek and Erlich, 2013; Gymrek et al., 2016; Willems et al., 2017).”
§ Disease-associated short tandem repeats co-localize with chromatin domain boundaries > Introduction
What the sources say
plain- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: fails — The paper’s conclusions may not depend on it.
- Based: passes — The paper gives a reason why it holds.
Probably not a substantial claim. The paper’s conclusions may not depend on it.
In the paper
“daSTRs also exhibit a wide range of repeat unit sequences and can be localized across the gene body in introns, exons, promoters and 3’/5’ untranslated regions (UTRs) (La Spada and Taylor, 2010).”
§ Disease-associated short tandem repeats co-localize with chromatin domain boundaries > Introduction
What the sources say
- Not checked yetcites La Spada and Taylor, 2010
plain- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: fails — The paper’s conclusions may not depend on it.
- Based: passes — The paper gives a reason why it holds.
Probably not a substantial claim. The paper’s conclusions may not depend on it. It may state two separate claims as one.
None of the sources cited for this claim have been checked yet.
In the paper
“Disease-associated STR tracts (hereafter referred to as daSTRs) exhibit tremendous diversity in sequence, gene body location, and tract length.”
§ Disease-associated short tandem repeats co-localize with chromatin domain boundaries > Introduction
plain- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: fails — The paper’s conclusions may not depend on it.
- Based: passes — The paper gives a reason why it holds.
Probably not a substantial claim. The paper’s conclusions may not depend on it. It may state two separate claims as one.
None of the sources cited for this claim have been checked yet.
In the paper
“More than 25 inherited human disorders are caused by the unstable expansion of repetitive DNA sequences termed short tandem repeats (STRs).”
§ Disease-associated short tandem repeats co-localize with chromatin domain boundaries > Abstract
What the sources say
plaindirect- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: fails — The paper’s conclusions may not depend on it.
- Based: passes — The paper gives a reason why it holds.
Probably not a substantial claim. The paper’s conclusions may not depend on it.
In the paper
“CpG islands are generally hypomethylated in normal somatic cells and can acquire aberrant hypermethylation in disease (Robertson, 2005).”
§ Disease-associated short tandem repeats co-localize with chromatin domain boundaries > Results > TAD boundary at the FMR1 daSTR is ablated in Fragile X Syndrome
What the sources say
- Not checked yetcites Robertson, 2005 source
plaincorrelational- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: passes — The paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
Probably not a substantial claim. It may state two separate claims as one.
A conclusion the paper draws from its own results — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“Together, these results indicate that daSTRs are present at boundaries in embryonic and somatic cell lineages and also in at least one stage of spermatogenesis when daSTR instability is paternally inherited.”
§ Disease-associated short tandem repeats co-localize with chromatin domain boundaries > Results > daSTRs co-localize with TADs that are invariant across somatic cell types
hedgedcorrelational- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: passes — The paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
It may state two separate claims as one.
In the paper
“The mutation-length CGG STR acquires DNA methylation, which is thought to cause FMR1 silencing (Park et al., 2015).”
§ Disease-associated short tandem repeats co-localize with chromatin domain boundaries > Results > Boundary disruption in Fragile X Syndrome patients correlates with FMR1 silencing
What the sources say
- Not checked yetcites Park et al., 2015 source
hedgedconditional- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: fails — The paper’s conclusions may not depend on it.
- Based: passes — The paper gives a reason why it holds.
Probably not a substantial claim. The paper’s conclusions may not depend on it. It may state two separate claims as one.
A conclusion the paper draws from its own results — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“This boundary disruption results in a dramatic re-organization of genome topology around the FMR1 gene, such that it no longer contacts genomic loci in the downstream TAD marked by histone modifications characteristic of active enhancers. Rather, FMR1 merges with the upstream TAD largely devoid of active enhancer marks, suggesting that the topological reconfiguration of the genome could be related”
§ Disease-associated short tandem repeats co-localize with chromatin domain boundaries > Discussion
hedgeddirectn = 4- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: passes — The paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
It may state two separate claims as one.
A conclusion the paper draws from its own results — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“Together, these results reveal severe topological disruption at the FMR1 daSTR in at least three cell types and at least four patients with FXS.”
§ Disease-associated short tandem repeats co-localize with chromatin domain boundaries > Results > TAD boundary at the FMR1 daSTR is ablated in Fragile X Syndrome
plaincorrelationaln = 4- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: passes — The paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
It may state two separate claims as one.
In the paper
“FXS is caused by the loss of the fragile X mental retardation protein (FMRP) encoded by FMR1 (Verkerk et al., 1991).”
§ Disease-associated short tandem repeats co-localize with chromatin domain boundaries > Results > Boundary disruption in Fragile X Syndrome patients correlates with FMR1 silencing
What the sources say
- Not checked yetcites Verkerk et al., 1991 source
plaindirect- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: passes — The paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
Probably not a substantial claim.
A conclusion the paper draws from its own results — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“These results demonstrate that FMR1 is associated with the downstream TAD in healthy B cells and shifts to the upstream TAD in two patients with FXS.”
§ Disease-associated short tandem repeats co-localize with chromatin domain boundaries > Results > TAD boundary at the FMR1 daSTR is ablated in Fragile X Syndrome
boostedcorrelationaln = 2- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: passes — The paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
It may state two separate claims as one.
None of the sources cited for this claim have been checked yet.
In the paper
“In congenital myotonic dystrophy, the region flanking the DM1 gene is hypermethylated and this methylation disrupts binding of adjacent CTCF binding sites (Filippova et al., 2001; Steinbach et al., 1998).”
§ Disease-associated short tandem repeats co-localize with chromatin domain boundaries > Discussion
What the sources say
plaindirect- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: unclear — It is unclear whether the paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
It may state two separate claims as one.
What the paper did — it cites no source for this, so there is none to check. The quote shows it is in the paper.
In the paper
“The null distribution was created by taking 10,000 draws without replacement of n=26 matched repeats, where each draw is proportionally matched to the daSTR group with respect to repeat unit sequence and gene body location, and computing the test statistic each time.”
§ Disease-associated short tandem repeats co-localize with chromatin domain boundaries > STAR Methods > QUANTIFICATION AND STATISTICAL ANALYSES
plainn = 26- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: passes — The paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
Probably not a substantial claim.
None of the sources cited for this claim have been checked yet.
In the paper
“A total of 29 genes associated with trinucleotide repeat expansion disorders were initially selected for analysis based on previous reports (Tables S1-S3) (Iyer et al., 2015; La Spada and Taylor, 2010).”
§ Disease-associated short tandem repeats co-localize with chromatin domain boundaries > STAR Methods > QUANTIFICATION AND STATISTICAL ANALYSES
What the sources say
- Not checked yetcites Iyer et al., 2015 source
- Not checked yetcites La Spada and Taylor, 2010
plain- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: passes — The paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
Probably not a substantial claim.
What the paper did — it cites no source for this, so there is none to check. The quote shows it is in the paper.
In the paper
“This method ensures that both boundaries and non-boundary bins are the same size, and that non-boundary bins are not dominated by hard to query regions of the genome.”
§ Disease-associated short tandem repeats co-localize with chromatin domain boundaries > STAR Methods > QUANTIFICATION AND STATISTICAL ANALYSES
plaindirect- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: passes — The paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
Probably not a substantial claim.
A conclusion the paper draws from its own results — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“We discover that boundaries at a specific daSTR in the FMR1 gene are disrupted in FXS in a manner that markedly alters the enhancer landscape accessible to the gene and correlates with the loss of CTCF occupancy and FMR1 silencing.”
§ Disease-associated short tandem repeats co-localize with chromatin domain boundaries > Discussion
plaindirect- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: passes — The paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
It may state two separate claims as one.
What the paper did — it cites no source for this, so there is none to check. The quote shows it is in the paper.
In the paper
“Raw 5C counts distributions were quantile normalized to address minor sequencing depth differences.”
§ Disease-associated short tandem repeats co-localize with chromatin domain boundaries > STAR Methods > QUANTIFICATION AND STATISTICAL ANALYSES
plaindirect- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: fails — The paper’s conclusions may not depend on it.
- Based: passes — The paper gives a reason why it holds.
Probably not a substantial claim. The paper’s conclusions may not depend on it.
What the paper did — it cites no source for this, so there is none to check. The quote shows it is in the paper.
In the paper
“To ensure that our results from the Fisher’s Exact test (Figure 2B, Figure 4D-F) were not artifacts of using a null repeat set that was not weighted similarly to the daSTRs set with respect to STR type group (Table S3), we also randomly created n=1000 subsets of the null repeat set that were weighted similarly to the daSTRs.”
- Also stated in: § QUANTIFICATION AND STATISTICAL ANALYSES · plain
“We then used the Python StatsModel package implementation of the Cochran–Mantel–Haenszel test on the 1000 subsets to calculate a pooled odds ratio of the empirical distribution.”
§ Disease-associated short tandem repeats co-localize with chromatin domain boundaries > STAR Methods > QUANTIFICATION AND STATISTICAL ANALYSES
plainn = 1,000- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: passes — The paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
Probably not a substantial claim.
- Also stated in: § QUANTIFICATION AND STATISTICAL ANALYSES · plain
In the paper
“A recent genome-wide association study in Huntington’s disease patients identified a link between genetic variation in DNA repair machinery and the age of onset of the disease (Genetic Modifiers of Huntington's Disease, 2015).”
§ Disease-associated short tandem repeats co-localize with chromatin domain boundaries > Discussion
What the sources say
- Not checked yetcites Genetic Modifiers of Huntington's Disease, 2015
plaincorrelational- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: passes — The paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
Probably not a substantial claim.
A conclusion the paper draws from its own results — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“We posit that STR instability at CpG island-rich boundaries manifests in individuals already genetically pre-disposed to repeat expansion.”
§ Disease-associated short tandem repeats co-localize with chromatin domain boundaries > Discussion
hedgedconditional- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: fails — The paper’s conclusions may not depend on it.
- Based: fails — The paper may give no reason why it holds.
Probably not a substantial claim. The paper’s conclusions may not depend on it. The paper may give no reason why it holds.
None of the sources cited for this claim have been checked yet.
In the paper
“Recent high-resolution Chromosome-Conformation-Capture sequencing studies have revealed that TAD boundaries are perturbed in rare human limb malformation diseases (Lupianez et al., 2015) and certain types of cancers (Flavahan et al., 2016; Hnisz et al., 2016), leading to enhancer miswiring and pathogenic disruption of gene expression.”
§ Disease-associated short tandem repeats co-localize with chromatin domain boundaries > Discussion
What the sources say
plaindirect- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: passes — The paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
Probably not a substantial claim. It may state two separate claims as one.
None of the sources cited for this claim have been checked yet.
In the paper
“STR instability is known to occur in the germline, but tissue-specific somatic variation in STR tract length has been reported (Leeflang et al., 1995; Telenius et al., 1994; Wohrle et al., 1993; Wong et al., 1995; Zhang et al., 1994).”
§ Disease-associated short tandem repeats co-localize with chromatin domain boundaries > Discussion
What the sources say
plain- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: fails — The paper’s conclusions may not depend on it.
- Based: passes — The paper gives a reason why it holds.
Probably not a substantial claim. The paper’s conclusions may not depend on it. It may state two separate claims as one.
In the paper
“By contrast, many other daSTRS are co-localized to subTAD boundaries, which are known to be dynamically reconfigured across cell state transitions in development (Norton et al., 2018).”
§ Disease-associated short tandem repeats co-localize with chromatin domain boundaries > Discussion
What the sources say
- Not checked yetcites Norton et al., 2018 source
boostedcorrelational- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: passes — The paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
It may state two separate claims as one.
What the paper did — it cites no source for this, so there is none to check. The quote shows it is in the paper.
In the paper
“This method ensures that both boundaries and non-boundary bins are the same size, and that non-boundary bins are not dominated by hard to query regions of the genome.”
§ Disease-associated short tandem repeats co-localize with chromatin domain boundaries > STAR Methods > QUANTIFICATION AND STATISTICAL ANALYSES
plaindirect- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: passes — The paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
Probably not a substantial claim.
In the paper
“These groups are motivated by prior literature showing that daSTRs with similar sequence and gene body locations behave similarly with respect to number of repeats required for disease and expansion mechanisms (Iyer et al., 2015).”
§ Disease-associated short tandem repeats co-localize with chromatin domain boundaries > STAR Methods > QUANTIFICATION AND STATISTICAL ANALYSES
What the sources say
- Not checked yetcites Iyer et al., 2015 source
plaincorrelational- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: passes — The paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
Probably not a substantial claim.
In the paper
“We used these published Mb-scale TAD calls in Figure S2 because Ren and colleagues used an independent study and an independent TAD calling method to compare TADs across H1 ES cell (Human H1) and H1 ESC-derived lineages—mesendoderm (MES), mesenchymal stem cells (MSC), neural progenitor cells (NPC), and trophoblast-like cells (TRO).”
§ Disease-associated short tandem repeats co-localize with chromatin domain boundaries > STAR Methods > QUANTIFICATION AND STATISTICAL ANALYSES
What the sources say
- Not checked yetcites Schmitt et al., 2016 source
plain- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: fails — The paper’s conclusions may not depend on it.
- Based: passes — The paper gives a reason why it holds.
Probably not a substantial claim. The paper’s conclusions may not depend on it. It may state two separate claims as one.
In the paper
“Finally, restriction fragment biases were normalized by applying matrix balancing as previously reported (Imakaev et al., 2012).”
§ Disease-associated short tandem repeats co-localize with chromatin domain boundaries > STAR Methods > QUANTIFICATION AND STATISTICAL ANALYSES
What the sources say
- Not checked yetcites Imakaev et al., 2012 source
plain- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: passes — The paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
Probably not a substantial claim.
What the paper did — it cites no source for this, so there is none to check. The quote shows it is in the paper.
In the paper
“To facilitate the comparison of ChIPseq libraries across cell types, the mapped reads were filtered to remove optical and PCR duplicates and then downsampled to equivalent read numbers across cellular states.”
§ Disease-associated short tandem repeats co-localize with chromatin domain boundaries > STAR Methods > QUANTIFICATION AND STATISTICAL ANALYSES
plaindirect- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: passes — The paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
Probably not a substantial claim.
What the paper did — it cites no source for this, so there is none to check. The quote shows it is in the paper.
In the paper
“The 120kb boundary size was chosen to address the resolution limit of the Hi-C assays, 40 kb, used in this study.”
§ Disease-associated short tandem repeats co-localize with chromatin domain boundaries > STAR Methods > QUANTIFICATION AND STATISTICAL ANALYSES
plaindirect- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: passes — The paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
Probably not a substantial claim.
What the paper did — it cites no source for this, so there is none to check. The quote shows it is in the paper.
In the paper
“Bootstrapped confidence intervals for percent of repeats at boundary and CpG island density were constructed by randomly selecting groups of 26 repeats from both the matched repeat set and the daSTRs 1,000 times with replacement and computing the percent of the randomly chosen repeats at a boundary in each sampling.”
§ Disease-associated short tandem repeats co-localize with chromatin domain boundaries > STAR Methods > QUANTIFICATION AND STATISTICAL ANALYSES
plainn = 26- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: passes — The paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
Probably not a substantial claim. The quote only partly states this claim.
The paper relies on this without support.
The role for TAD boundaries in neurological disorders has not yet been reported.
“but the role for TAD boundaries in neurological disorders has not yet been reported.”
The paper relies on this without support.
Mapping daSTRs to normal-length repeat tracts in the hg19 reference genome is representative of disease-associated STR loci.
“Because the samples are not diseased, we mapped daSTRs to the normal-length repeat tracts found in the hg19 reference genome (Tables S1-S3).”
The paper relies on this without support.
Domain boundaries called in human ES cells and fetal cortical plate are relevant to the cell types of pathology for all daSTRs.
“Thus, although the target cell type(s) for many unstable repeat expansion disorders are unknown, the strong enrichment at boundaries regardless of tissue origin suggests that daSTR co-localization with boundaries might be robust across cell types relevant for the pathology.”
Claims other papers make about this one
Each is checked against this paper’s own text: does it say what the citing paper says it does?
In the citing paper
“the disruption of 3D genome organization has been demonstrated in neurodevelopmental and neurological neurodegenerative disorders such as Huntington’s disease, Fragile X syndrome, Down syndrome, etc.”
From Neuronal DNA double-strand breaks lead to genome structural variations and 3D genome disruption in neurodegeneration (2023) · cites this paper as [43]
In the citing paper
“Genome misfolding has been reported in fragile X syndrome48, the leading monogenic cause of ASD, as well as other human diseases49”
From Three-dimensional genome restructuring across timescales of activity-induced neuronal gene expression (2020) · cites this paper as [48]
Self-check
Percentages, sums and reported differences re-computed from the paper’s own numbers.
Rated minor: it would not touch a result — a value no result rests on, a p-value that stays on the same side of the significance level, or a conflict that is clerical, resolved elsewhere in the paper, or outside its own findings.
In the paper
“The classes are: (1) Repeat unit CAG in exons and 5’UTRs (9 daSTRs), (2) Repeat unit GCG/CGG in exons and 5’UTRs (8 daSTRs), (3) Unique repeat units in introns (5 daSTRs), and (4) CTG introns in 3’UTRs (3 daSTRs).”
§ Disease-associated short tandem repeats co-localize with chromatin domain boundaries > STAR Methods > QUANTIFICATION AND STATISTICAL ANALYSES
Reported 26 · recomputed 25
Citations
Cites
Fast gapped-read alignment with Bowtie 2
Langmead, B., & Salzberg, S. L. (2012) · Nature Methods · doi:10.1038/nmeth.1923 · Cited by 56,400 · cited 1×
“…for CTCF peak 2 F: TCTTGTCTGGCCT GTATGGTTR: CCATATTGCACAATGCAGCTCT This paper N/A Software and Algorithms Bowtie/Bowtie2 Langmead et al., 2009; Langmead and Salzberg, 2012 http://bowtie-bio.sourceforge.net/ Python MACS Zhang et al., 2008 https://github.com/taoliu/MACS BEDTools Quinlan 2014…”
BackgroundUltrafast and memory-efficient alignment of short DNA sequences to the human genome.
Langmead, B., Trapnell, C., Pop, M., & Salzberg, S. L. (2009) · Genome Biology · doi:10.1186/gb-2009-10-3-r25 · Cited by 21,849
Model-based Analysis of ChIP-Seq (MACS)
Zhang, Y., Liu, T., Meyer, C. A., Eeckhoute, J., Johnson, D. S., Bernstein, B. E., Nusbaum, C., Myers, R. M., Brown, M., Li, W., et al. (2008) · Genome Biology · doi:10.1186/gb-2008-9-9-r137 · Cited by 18,386
MEME SUITE: tools for motif discovery and searching
Bailey, T. L., Boden, M., Buske, F. A., Frith, M., Grant, C. E., Clementi, L., Ren, J., Li, W. W., & Noble, W. S. (2009) · Nucleic Acids Research · doi:10.1093/nar/gkp335 · Cited by 10,648
A 3D Map of the Human Genome at Kilobase Resolution Reveals Principles of Chromatin Looping
Rao, S. S. P., Huntley, M. H., Durand, N. C., Stamenova, E. K., Bochkov, I. D., Robinson, J. T., Sanborn, A. L., Machol, I., Omer, A. D., Lander, E. S., et al. (2014) · Cell · doi:10.1016/j.cell.2014.11.021 · Cited by 9,212 · cited 1×
“Consistent with the established principles of CTCF motif convergency (Rao et al., 2014), the doublet CTCF sites contained CTCF motifs in the reverse orientation and looped to distal CTCF occupied motifs oriented in the forward direction (Figures 6C and 6D).”
BackgroundBolstad, B. M., Irizarry, R. A., Åstrand, M., & Speed, T. P. (2003) · Bioinformatics · doi:10.1093/bioinformatics/19.2.185 · Cited by 8,328
deepTools2: a next generation web server for deep-sequencing data analysis
Ramírez, F., Ryan, D. P., Grüning, B., Bhardwaj, V., Kilpert, F., Richter, A. S., Heyne, S., Dündar, F., & Manke, T. (2016) · Nucleic Acids Research · doi:10.1093/nar/gkw257 · Cited by 8,096 · cited 1×
“…matrix balancing Imakaev et al., 2012 https://github.com/hiclib/iced MEME Suite Bailey et al., 2009 http://meme-suite.org Quantile normalization Bolstad et al., 2003 https://www.ncbi.nlm.nih.gov/pubmed/ 12538238 deepTools Ramı́rez et al., 2016 https://github.com/deeptools/deepTools”
Topological domains in mammalian genomes identified by analysis of chromatin interactions
Dixon, J. R., Selvaraj, S., Yue, F., Kim, A., Li, Y., Shen, Y., Hu, M., Liu, J. S., & Ren, B. (2012) · Nature · doi:10.1038/nature11082 · Cited by 6,829 · cited 3×
“Mammalian genomes are organized into a hierarchy of megabase (Mb)-scale topologically associating domains (TADs) (Dixon et al., 2012; Nora et al., 2012) and smaller, nested subTADs (Dixon et al.”
BackgroundResultHistone H3K27ac separates active from poised enhancers and predicts developmental state
Creyghton, M. P., Cheng, A. W., Welstead, G. G., Kooistra, T., Carey, B. W., Steine, E. J., Hanna, J., Lodato, M. A., Frampton, G. M., Sharp, P. A., et al. (2010) · Proceedings of the National Academy of Sciences · doi:10.1073/pnas.1016071107 · Cited by 4,302 · cited 1×
“Finally, to better understand how the FXS topological changes might be connected to FMR1 trancriptional silencing, we mined published ChIP-seq data in GM12878 cells for H3K27ac, an established mark of active enhancers (Creyghton et al., 2010).”
MethodVerkerk, A. J. M. H., Pieretti, M., Sutcliffe, J. S., Fu, Y.-H., Kuhl, D. P. A., Pizzuti, A., Reiner, O., Richards, S., Victoria, M. F., Zhang, F., et al. (1991) · Cell · doi:10.1016/0092-8674(91)90397-h · Cited by 3,481 · cited 1×
“Boundary Disruption in Fragile X Syndrome Patients Correlates with FMR1 Silencing FXS is caused by the loss of the fragile X mental retardation protein (FMRP) encoded by FMR1 (Verkerk et al., 1991).”
BackgroundSpatial partitioning of the regulatory landscape of the X-inactivation centre
Nora, E. P., Lajoie, B. R., Schulz, E. G., Giorgetti, L., Okamoto, I., Servant, N., Piolot, T., van Berkum, N. L., Meisig, J., Sedat, J., et al. (2012) · Nature · doi:10.1038/nature11049 · Cited by 2,895 · cited 3×
“Mammalian genomes are organized into a hierarchy of megabase (Mb)-scale topologically associating domains (TADs) (Dixon et al., 2012; Nora et al., 2012) and smaller, nested subTADs (Dixon et al.”
BackgroundResultDNA methylation and human disease
Robertson, K. D. (2005) · Nature Reviews Genetics · doi:10.1038/nrg1655 · Cited by 2,864 · cited 2×
“TAD Boundary at the FMR1 daSTR Is Ablated in Fragile X Syndrome CpG islands are generally hypomethylated in normal somatic cells and can acquire aberrant hypermethylation in disease (Robertson, 2005).”
BackgroundSharma, S., Kelly, T. K., & Jones, P. A. (2010) · Carcinogenesis · doi:10.1093/carcin/bgp220 · Cited by 2,637 · cited 1×
“Moreover, CpG islands are aberrantly hypermethylated in a subset of cancers that exhibit microsatellite instability (Sharma et al., 2010; You and Jones, 2012).”
BackgroundThe UCSC Table Browser data retrieval tool
Karolchik, D. (2003) · Nucleic Acids Research · doi:10.1093/nar/gkh103 · Cited by 2,314
BEDTools: The Swiss‐Army Tool for Genome Feature Analysis
Quinlan, A. R. (2014) · Current Protocols in Bioinformatics · doi:10.1002/0471250953.bi1112s47 · Cited by 2,286 · cited 2×
“…et al., 2009; Langmead and Salzberg, 2012 http://bowtie-bio.sourceforge.net/ Python MACS Zhang et al., 2008 https://github.com/taoliu/MACS BEDTools Quinlan 2014 https://github.com/arq5x/bedtools2 ICED matrix balancing Imakaev et al., 2012 https://github.com/hiclib/iced MEME Suite Bailey et al.,…”
BackgroundDisruptions of Topological Chromatin Domains Cause Pathogenic Rewiring of Gene-Enhancer Interactions
Lupiáñez, D. G., Kraft, K., Heinrich, V., Krawitz, P., Brancati, F., Klopocki, E., Horn, D., Kayserili, H., Opitz, J. M., Laxova, R., et al. (2015) · Cell · doi:10.1016/j.cell.2015.04.004 · Cited by 2,132 · cited 3×
“Recent high-resolution chromosomeconformation-capture sequencing studies have revealed that TAD boundaries are perturbed in rare human limb malformation diseases (Lupiáñez et al., 2015) and certain types of cancers (Flavahan et al.”
BackgroundChromatin architecture reorganization during stem cell differentiation
Dixon, J. R., Jung, I., Selvaraj, S., Shen, Y., Antosiewicz-Bourget, J. E., Lee, A. Y., Ye, Z., Kim, A., Rajagopal, N., Xie, W., et al. (2015) · Nature · doi:10.1038/nature14222 · Cited by 1,646 · cited 8×
“Therefore, we focused on only Mb-scale TADs reported in an independent study by Schmitt et al. (2016) (STAR Methods) in human ESCs (n = 2,502) and ESC-derived differentiated cells including: mesendoderm (n = 2,479), mesenchymal stem cells (n = 2,290), neural progenitor cells (n = 2,378), and trophoblast-like cells (n…”
MethodInfluentialIterative correction of Hi-C data reveals hallmarks of chromosome organization
Imakaev, M., Fudenberg, G., McCord, R. P., Naumova, N., Goloborodko, A., Lajoie, B. R., Dekker, J., & Mirny, L. A. (2012) · Nature Methods · doi:10.1038/nmeth.2148 · Cited by 1,423
Trinucleotide Repeat Disorders
Orr, H. T., & Zoghbi, H. Y. (2007) · Annual Review of Neuroscience · doi:10.1146/annurev.neuro.29.051605.113042 · Cited by 1,394 · cited 1×
“hyperactivity, low IQ, social deficits, respiratory defects, and seizures (Orr and Zoghbi, 2007).”
BackgroundInsulator dysfunction and oncogene activation in IDH mutant gliomas
Flavahan, W. A., Drier, Y., Liau, B. B., Gillespie, S. M., Venteicher, A. S., Stemmer-Rachamimov, A. O., Suvà, M. L., & Bernstein, B. E. (2016) · Nature · doi:10.1038/nature16490 · Cited by 1,288 · cited 3×
“, 2015) and certain types of cancers (Flavahan et al., 2016; Hnisz et al., 2016), leading to enhancer miswiring and pathogenic disruption of gene expression.”
BackgroundDostie, J., Richmond, T., Arnaout, R., Selzer, R. R., Lee, W. L., Honan, T., Rubio, E. D., Krumm, A., Lamb, J., Nusbaum, C., et al. (2006) · Genome Research · doi:10.1101/gr.5571506 · Cited by 1,237 · cited 1×
“We performed chromosome-conformation-capture-carbon-copy (5C) (Dostie and Dekker, 2007; Dostie et al., 2006) on B-lymphocytes from an FXS patient with 935 CGG repeats (GM09237 from the Coriell Cell Repository), his healthy male sibling (GM09236), and a genetically unrelated FXS male with 645 repeats (GM04025) (Figure…”
MethodCancer Genetics and Epigenetics: Two Sides of the Same Coin?
You, J. S., & Jones, P. A. (2012) · Cancer Cell · doi:10.1016/j.ccr.2012.06.008 · Cited by 1,206 · cited 1×
“Moreover, CpG islands are aberrantly hypermethylated in a subset of cancers that exhibit microsatellite instability (Sharma et al., 2010; You and Jones, 2012).”
BackgroundArchitectural protein subclasses shape 3D organization of genomes during lineage commitment
Phillips-Cremins, J. E., Sauria, M. E. G., Sanyal, A., Gerasimova, T. I., Lajoie, B. R., Bell, J. S. K., Ong, C.-T., Hookway, T. A., Guo, C., Sun, Y., et al. (2013) · Cell · doi:10.1016/j.cell.2013.04.053 · Cited by 1,187 · cited 2×
“Paired-end reads were mapped to a pseudo-reference genome representing all possible 5C primer ligation junctions as previously described (Beagan et al., 2016, 2016; Phillips-Cremins et al., 2013) (Table S6B).”
Self-citationActivation of proto-oncogenes by disruption of chromosome neighborhoods
Hnisz, D., Weintraub, A. S., Day, D. S., Valton, A.-L., Bak, R. O., Li, C. H., Goldmann, J., Lajoie, B. R., Fan, Z. P., Sigova, A. A., et al. (2016) · Science · doi:10.1126/science.aad9024 · Cited by 1,042 · cited 6×
“CTCF Occupancy at the FMR1 daSTR Is Ablated in Fragile X Syndrome CTCF occupancy is disrupted at boundaries that lose structural integrity in diseases of limb development and cancer (Flavahan et al., 2016; Hnisz et al., 2016; Lupiáñez et al., 2015).”
InfluentialRefSeq: an update on mammalian reference sequences
Pruitt, K. D., Brown, G., Hiatt, S. M., Thibaud‐Nissen, F., Astashyn, A., Ermolaeva, O. D., Farrell, C. M., Hart, J. A., Landrum, M., McGarvey, K. M., et al. (2013) · Nucleic Acids Research · doi:10.1093/nar/gkt1114 · Cited by 936
Expandable DNA repeats and human disease
Mirkin, S. M. (2007) · Nature · doi:10.1038/nature05977 · Cited by 934 · cited 4×
“Studies in model organisms show that mutations in genes encoding key machinery involved in DNA replication, repair, and recombination are linked to STR instability (Iyer et al., 2015; McMurray, 2010; Mirkin, 2007; Pearson et al., 2005).”
BackgroundInfluentialRepeat instability: mechanisms of dynamic mutations
Pearson, C. E., Edamura, K. N., & Cleary, J. D. (2005) · Nature Reviews Genetics · doi:10.1038/nrg1689 · Cited by 924 · cited 4×
“Studies in model organisms show that mutations in genes encoding key machinery involved in DNA replication, repair, and recombination are linked to STR instability (Iyer et al., 2015; McMurray, 2010; Mirkin, 2007; Pearson et al., 2005).”
BackgroundInfluentialControl of cell identity genes occurs in insulated neighborhoods in mammalian chromosomes
Dowen, J. M., Fan, Z. P., Hnisz, D., Ren, G., Abraham, B. J., Zhang, L. N., Weintraub, A. S., Schuijers, J., Lee, T. I., Zhao, K., et al. (2014) · Cell · doi:10.1016/j.cell.2014.09.030 · Cited by 884
A compendium of chromatin contact maps reveals spatially active regions in the human genome
Schmitt, A. D., Hu, M., Jung, I., Xu, Z., Qiu, Y., Tan, C. L., Li, Y., Lin, S., Lin, Y., Barr, C. L., et al. (2016) · Cell Reports · doi:10.1016/j.celrep.2016.10.061 · Cited by 866 · cited 1×
“(2016) (STAR Methods) in human ESCs (n = 2,502) and ESC-derived differentiated cells including: mesendoderm (n = 2,479), mesenchymal stem cells (n = 2,290), neural progenitor cells (n = 2,378), and trophoblast-like cells (n = 2,435) (Schmitt et al., 2016).”
BackgroundENCODE Data in the UCSC Genome Browser: year 5 update
Rosenbloom, K., Sloan, C. A., Malladi, V., Dreszer, T. R., Learned, K., Kirkup, V. M., Wong, M., Maddren, M., Fang, R.-H., Heitner, S. G., et al. (2012) · Nucleic Acids Res. · doi:10.1093/nar/gks1172 · Cited by 827
Distinct epigenomic landscapes of pluripotent and lineage-committed human cells
Hawkins, R. D., Hon, G. C., Lee, L. K., Ngo, Q., Lister, R., Pelizzola, M., Edsall, L. E., Kuan, S., Luu, Y., Klugman, S., et al. (2010) · Cell stem cell · doi:10.1016/j.stem.2010.03.018 · Cited by 806
Repeat instability : mechanisms of dynamic mutations
Pearson, C. E. (2005) · Medical Entomology and Zoology · Cited by 711
Identification of Genetic Factors that Modify Clinical Onset of Huntington’s Disease
Lee, J.-M., Wheeler, V. C., Chao, M. J., Vonsattel, J. P. G., Pinto, R. M., Lucente, D., Abu-Elneel, K., Ramos, E. M., Mysore, J. S., Gillis, T., et al. (2015) · Cell · doi:10.1016/j.cell.2015.07.003 · Cited by 655
Chromosome conformation elucidates regulatory relationships in developing human brain
Won, H., de la Torre-Ubieta, L., Stein, J. L., Parikshak, N. N., Huang, J., Opland, C. K., Gandal, M. J., Sutton, G. J., Hormozdiari, F., Lu, D., et al. (2016) · Nature · doi:10.1038/nature19847 · Cited by 584 · cited 2×
“, 2015) and human fetal cortical plate tissue (Won et al., 2016).”
BackgroundResultCTCF establishes discrete functional chromatin domains at the Hox clusters during differentiation
Narendra, V., Rocha, P. P., An, D., Raviram, R., Skok, J. A., Mazzoni, E. O., & Reinberg, D. (2015) · Science · doi:10.1126/science.1262088 · Cited by 535 · cited 1×
“Such chromatin domains span >90% of the genome and are thought to create insulated neighborhoods demarcating the search space of specific long-range interactions between enhancers and their target genes (Dowen et al., 2014; Narendra et al., 2015; Symmons et al., 2014).”
BackgroundAllelic reprogramming of 3D chromatin architecture during early mammalian development
Du, Z., Zheng, H., Huang, B., Ma, R., Wu, J., Zhang, X., He, J., Xiang, Y., Wang, Q., Li, Y., et al. (2017) · Nature · doi:10.1038/nature23263 · Cited by 533 · cited 1×
“, 2005) co-localized to boundaries in mouse sperm and not in mouse oocytes (Du et al., 2017), suggesting that daSTRs could be at boundaries at the developmental stage when germline expansion takes place (Figure S3).”
BackgroundRepeat expansion disease: progress and puzzles in disease pathogenesis
Spada, A. R. L., & Taylor, J. P. (2010) · Nature Reviews Genetics · doi:10.1038/nrg2748 · Cited by 497
Mechanisms of trinucleotide repeat instability during human development
McMurray, C. T. (2010) · Nature Reviews Genetics · doi:10.1038/nrg2828 · Cited by 496 · cited 8×
“Normal-length STR tracts are generally stable across generations and among somatic tissues in the same individual (McMurray, 2010).”
InfluentialFunctional and topological characteristics of mammalian regulatory domains
Symmons, O., Uslu, V. V., Tsujimura, T., Ruf, S., Nassari, S., Schwarzer, W., Ettwiller, L., & Spitz, F. (2014) · Genome Research · doi:10.1101/gr.163519.113 · Cited by 455 · cited 1×
“Such chromatin domains span >90% of the genome and are thought to create insulated neighborhoods demarcating the search space of specific long-range interactions between enhancers and their target genes (Dowen et al., 2014; Narendra et al., 2015; Symmons et al., 2014).”
BackgroundSomatic and gonadal mosaicism of the Huntington disease gene CAG repeat in brain and sperm
Telenius, H., Kremer, B., Goldberg, Y. P., Theilmann, J., Andrew, S. E., Zeisler, J., Adam, S., Greenberg, C., Ives, E. J., Clarke, L. A., et al. (1994) · Nature Genetics · doi:10.1038/ng0494-409 · Cited by 439 · cited 1×
“STR instability is known to occur in the germline, but tissuespecific somatic variation in STR tract length has been reported (Leeflang et al., 1995; Telenius et al., 1994; Wöhrle et al., 1993; Wong et al., 1995; Zhang et al., 1994).”
BackgroundAbundant contribution of short tandem repeats to gene expression variation in humans
Gymrek, M., Willems, T., Guilmatre, A., Zeng, H., Markus, B., Georgiev, S., Daly, M. J., Price, A. L., Pritchard, J. K., Sharp, A. J., et al. (2016) · Nature Genetics · doi:10.1038/ng.3461 · Cited by 410 · cited 1×
“Healthy individuals have tens of thousands of relatively short STR tracts distributed throughout their genomes (Gymrek and Erlich, 2013; Gymrek et al., 2016; Willems et al., 2017).”
BackgroundCTCF-binding sites flank CTG/CAG repeats and form a methylation-sensitive insulator at the DM1 locus
Filippova, G. N., Thienes, C. P., Penn, B. H., Cho, D. H., Hu, Y. J., Moore, J. M., Klesert, T. R., Lobanenkov, V. V., & Tapscott, S. J. (2001) · Nature Genetics · doi:10.1038/ng570 · Cited by 332 · cited 2×
“Our observations add a 3D component to the locus-specific evidence that STR instability is linked to alterations of CTCF occupancy (Brock et al., 1999; Cleary et al., 2010; Filippova et al., 2001; Libby et al., 2008; Sopher et al., 2011).”
BackgroundGenome-wide profiling of heritable and de novo STR variations
Willems, T., Zielinski, D., Yuan, J., Gordon, A., Gymrek, M., & Erlich, Y. (2017) · Nature Methods · doi:10.1038/nmeth.4267 · Cited by 329 · cited 1×
“Healthy individuals have tens of thousands of relatively short STR tracts distributed throughout their genomes (Gymrek and Erlich, 2013; Gymrek et al., 2016; Willems et al., 2017).”
BackgroundYY1 and CTCF orchestrate a 3D chromatin looping switch during early neural lineage commitment
Beagan, J. A., Duong, M. T., Titus, K. R., Zhou, L., Cao, Z., Ma, J., Lachanski, C. V., Gillis, D. R., & Phillips-Cremins, J. E. (2017) · Genome Research · doi:10.1101/gr.215160.116 · Cited by 299
Self-citationThe Unstable Repeats—Three Evolving Faces of Neurological Disease
Nelson, D. L., Orr, H. T., & Warren, S. T. (2013) · Neuron · doi:10.1016/j.neuron.2013.02.022 · Cited by 207 · cited 1×
“Unstable expansion of repetitive DNA sequences termed short tandem repeats (STRs) serves as the mechanistic basis for more than 25 inherited human disorders, including fragile X syndrome, Huntington’s disease, amyotrophic lateral sclerosis, and Friedreich’s ataxia (La Spada and Taylor, 2010;McMurray, 2010; Mirkin, 200…”
BackgroundSomatic heterogeneity of the CTG repeat in myotonic dystrophy is age and size dependent.
Wong, L.-J., Ashizawa, T., Monckton, D. G., Caskey, C. T., & Richards, C. S. (1995) · Europe PMC (PubMed Central) · Cited by 202
Characterization of the full fragile X syndrome mutation in fetal gametes
Malter, H. E., Iber, J. C., Willemsen, R., Graaff, E. D., Tarleton, J. C., Leisti, J., Warren, S. T., & Oostra, B. A. (1997) · Nature Genetics · doi:10.1038/ng0297-165 · Cited by 197 · cited 1×
“We reasoned that boundaries might be disrupted in unstable repeat expansion disorders given that: (1) daSTRs are hypermethylated in fragile X syndrome (FXS) and myotonic dystrophy (Burman et al., 1999; Malter et al., 1997; Wöhrle et al., 1998, 2001) and (2) DNA methylation disrupts occupancy of the key architectural p…”
BackgroundMapping networks of physical interactions between genomic elements using 5C technology
Dostie, J., & Dekker, J. (2007) · Nature Protocols · doi:10.1038/nprot.2007.116 · Cited by 189 · cited 1×
“We performed chromosome-conformation-capture-carbon-copy (5C) (Dostie and Dekker, 2007; Dostie et al., 2006) on B-lymphocytes from an FXS patient with 935 CGG repeats (GM09237 from the Coriell Cell Repository), his healthy male sibling (GM09236), and a genetically unrelated FXS male with 645 repeats (GM04025) (Figure…”
MethodP.Leeflang, E., Zhang, L., Tavare, S., Hubert, R., Srinidhi, J., E.MacDonald, M., H.Myers, R., Young, M. D., S.Wexler, N., F.Gusella, J., et al. (1995) · Human Molecular Genetics · doi:10.1093/hmg/4.9.1519 · Cited by 182 · cited 1×
“STR instability is known to occur in the germline, but tissuespecific somatic variation in STR tract length has been reported (Leeflang et al., 1995; Telenius et al., 1994; Wöhrle et al., 1993; Wong et al., 1995; Zhang et al., 1994).”
BackgroundPark, C.-Y., Halevy, T., Lee, D. R., Sung, J. J., Lee, J. S., Yanuka, O., Benvenisty, N., & Kim, D.-W. (2015) · Cell Reports · doi:10.1016/j.celrep.2015.08.084 · Cited by 178 · cited 1×
“The mutation-length CGG STR acquires DNA methylation, which is thought to cause FMR1 silencing (Park et al., 2015).”
BackgroundWöhrle, D., Hennig, I., Vogel, W., & Steinbach, P. (1993) · Nature Genetics · doi:10.1038/ng0693-140 · Cited by 174 · cited 1×
“STR instability is known to occur in the germline, but tissuespecific somatic variation in STR tract length has been reported (Leeflang et al., 1995; Telenius et al., 1994; Wöhrle et al., 1993; Wong et al., 1995; Zhang et al., 1994).”
BackgroundCritical DNA Binding Interactions of the Insulator Protein CTCF
Renda, M., Baglivo, I., Burgess-Beusse, B. L., Esposito, S., Fattorusso, R., Felsenfeld, G., & Pedone, P. V. (2007) · Journal of Biological Chemistry · doi:10.1074/jbc.m706213200 · Cited by 152 · cited 1×
“, 1998, 2001) and (2) DNA methylation disrupts occupancy of the key architectural protein CTCF (Renda et al., 2007).”
BackgroundDetecting hierarchical genome folding with network modularity
Norton, H. K., Emerson, D. J., Huang, H., Kim, J., Titus, K. R., Gu, S., Bassett, D. S., & Phillips-Cremins, J. E. (2018) · Nature Methods · doi:10.1038/nmeth.4560 · Cited by 146 · cited 2×
“By contrast, many other daSTRS are colocalized to subTAD boundaries, which are known to be dynamically reconfigured across cell-state transitions in development (Norton et al., 2018).”
BackgroundMethodSelf-citationLibby, R. T., Hagerman, K. A., Pineda, V. V., Lau, R., Cho, D. H., Baccam, S. L., Axford, M. M., Cleary, J. D., Moore, J. M., Sopher, B. L., et al. (2008) · PLoS Genetics · doi:10.1371/journal.pgen.1000257 · Cited by 138 · cited 2×
“Our observations add a 3D component to the locus-specific evidence that STR instability is linked to alterations of CTCF occupancy (Brock et al., 1999; Cleary et al., 2010; Filippova et al., 2001; Libby et al., 2008; Sopher et al., 2011).”
BackgroundBeagan, J. A., Gilgenast, T. G., Kim, J., Plona, Z., Norton, H. K., Hu, G., Hsu, S. C., Shields, E. J., Lyu, X., Apostolou, E., et al. (2016) · Cell Stem Cell · doi:10.1016/j.stem.2016.04.004 · Cited by 134
Self-citationDNA triplet repeat expansion and mismatch repair
Iyer, R. R., Pluciennik, A., Napierala, M., & Wells, R. D. (2015) · Annual Review of Biochemistry · doi:10.1146/annurev-biochem-060614-034010 · Cited by 130 · cited 3×
“Studies in model organisms show that mutations in genes encoding key machinery involved in DNA replication, repair, and recombination are linked to STR instability (Iyer et al., 2015; McMurray, 2010; Mirkin, 2007; Pearson et al., 2005).”
BackgroundSopher, B. L., Ladd, P. D., Pineda, V. V., Libby, R. T., Sunkin, S. M., Hurley, J. B., Thienes, C. P., Gaasterland, T., Filippova, G. N., & Spada, A. R. L. (2011) · Neuron · doi:10.1016/j.neuron.2011.05.027 · Cited by 128 · cited 1×
“Our observations add a 3D component to the locus-specific evidence that STR instability is linked to alterations of CTCF occupancy (Brock et al., 1999; Cleary et al., 2010; Filippova et al., 2001; Libby et al., 2008; Sopher et al., 2011).”
Wöhrle, D., Salat, U., Hameister, H., Vogel, W., & Steinbach, P. J. (2001) · The American Journal of Human Genetics · doi:10.1086/322739 · Cited by 125
Brock, G. (1999) · Human Molecular Genetics · doi:10.1093/hmg/8.6.1061 · Cited by 122 · cited 1×
“Our observations add a 3D component to the locus-specific evidence that STR instability is linked to alterations of CTCF occupancy (Brock et al., 1999; Cleary et al., 2010; Filippova et al., 2001; Libby et al., 2008; Sopher et al., 2011).”
BackgroundSteinbach, P., Gläser, D., Vogel, W., Wolf, M., & Schwemmle, S. (1998) · The American Journal of Human Genetics · doi:10.1086/301711 · Cited by 116 · cited 1×
“In congenital myotonic dystrophy, the region flanking the DM1 gene is hypermethylated and this methylation disrupts binding of adjacent CTCF binding sites (Filippova et al., 2001; Steinbach et al., 1998).”
BackgroundZhang, L., Leeflang, E. P., Yu, J., & Arnheim, N. (1994) · Nature Genetics · doi:10.1038/ng0894-531 · Cited by 110 · cited 1×
“STR instability is known to occur in the germline, but tissuespecific somatic variation in STR tract length has been reported (Leeflang et al., 1995; Telenius et al., 1994; Wöhrle et al., 1993; Wong et al., 1995; Zhang et al., 1994).”
BackgroundWöhrle, D., Salat, U., Gläser, D., Mücke, J., Meisel-Stosiek, M., Schindler, D., Vogel, W., & Steinbach, P. J. (1998) · Journal of Medical Genetics · doi:10.1136/jmg.35.2.103 · Cited by 99 · cited 1×
“…repeat expansion disorders given that: (1) daSTRs are hypermethylated in fragile X syndrome (FXS) and myotonic dystrophy (Burman et al., 1999; Malter et al., 1997; Wöhrle et al., 1998, 2001) and (2) DNA methylation disrupts occupancy of the key architectural protein CTCF (Renda et al., 2007).”
Slipping while sleeping? Trinucleotide repeat expansions in germ cells
Pearson, C. E. (2003) · Trends in Molecular Medicine · doi:10.1016/j.molmed.2003.09.006 · Cited by 79 · cited 1×
“Future studies focused on creating high-resolution genome folding maps at distinct stages in spermatogenesis and oogenesis (Pearson, 2003) will yield insight into the role for boundaries in the developmental timing of germline instability.”
BackgroundCleary, J. D., Tomé, S., López Castel, A., Panigrahi, G. B., Foiry, L., Hagerman, K. A., Sroka, H., Chitayat, D., Gourdon, G., & Pearson, C. E. (2010) · Nature Structural & Molecular Biology · doi:10.1038/nsmb.1876 · Cited by 69 · cited 1×
“Our observations add a 3D component to the locus-specific evidence that STR instability is linked to alterations of CTCF occupancy (Brock et al., 1999; Cleary et al., 2010; Filippova et al., 2001; Libby et al., 2008; Sopher et al., 2011).”
Hypomethylation of an Expanded FMR1 Allele Is Not Associated with a Global DNA Methylation Defect
Burman, R., Yates, P. A., Green, L. D., Jacky, P. B., Turker, M. S., & Popovich, B. W. (1999) · The American Journal of Human Genetics · doi:10.1086/302628 · Cited by 20 · cited 2×
“…be disrupted in unstable repeat expansion disorders given that: (1) daSTRs are hypermethylated in fragile X syndrome (FXS) and myotonic dystrophy (Burman et al., 1999; Malter et al., 1997; Wöhrle et al., 1998, 2001) and (2) DNA methylation disrupts occupancy of the key architectural protein…”
Profiling Short Tandem Repeats from Short Reads
Gymrek, M., & Erlich, Y. (2013) · Methods in molecular biology · doi:10.1007/978-1-62703-514-9_7 · Cited by 5 · cited 1×
“Healthy individuals have tens of thousands of relatively short STR tracts distributed throughout their genomes (Gymrek and Erlich, 2013; Gymrek et al., 2016; Willems et al., 2017).”
BackgroundDetecting hierarchical 3-D genome domain reconfiguration with network modularity
Norton, H. K., Huang, H., Emerson, D. J., Kim, J., Gu, S., Bassett, D. S., & Phillips-Cremins, J. E. (2016) · doi:10.1101/089011
Self-citation
Cited by
Sorted by citations
Transcription factors and 3D genome conformation in cell-fate decisions
Stadhouders, R., Filion, G. J. P., & Graf, T. (2019) · Nature · doi:10.1038/s41586-019-1182-7 · Cited by 530
On the existence and functionality of topologically associating domains
Beagan, J. A., & Phillips‐Cremins, J. E. (2020) · Nature Genetics · doi:10.1038/s41588-019-0561-1 · Cited by 381
Self-citationIncomplete Penetrance and Variable Expressivity: From Clinical Studies to Population Cohorts
Kingdom, R., & Wright, C. F. (2022) · Frontiers in Genetics · doi:10.3389/fgene.2022.920390 · Cited by 326
“Non-coding variants within enhancer regions can be a cause of phenotypic diversity through alterations in gene expression, therefore affecting overall disease phenotype presentation (Sun et al., 2018).”
BackgroundOn the wrong DNA track: Molecular mechanisms of repeat-mediated genome instability
Khristich, A. N., & Mirkin, S. M. (2020) · Journal of Biological Chemistry · doi:10.1074/jbc.rev119.007678 · Cited by 289
Mismatch Repair Pathway, Genome Stability and Cancer
Pećina‐Šlaus, N., Kafka, A., Salamon, I., & Bukovac, A. (2020) · Frontiers in Molecular Biosciences · doi:10.3389/fmolb.2020.00122 · Cited by 303
“Recently it has been demonstrated that disease associated microsatellites are located in nexuses between chromatin domains (Sun et al., 2018) suggesting affected gene replication and expression.”
Background
Metadata
- Authors
- Sun, J. H., Zhou, L., Emerson, D. J., Phyo, S. A., Titus, K. R., Gong, W., Gilgenast, T. G., Beagan, J. A., Davidson, B. L., Tassone, F., & Phillips-Cremins, J. E.
- Affiliations
- University of Pennsylvania (US)
- Children's Hospital of Philadelphia (US)
- University of California, Davis (US)
- ORCID
- Venue
- Cell
- Publisher
- Elsevier BV
- Published
- 2018-09
- Volume
- 175
- Issue
- 1
- Pages
- 224-238.e15
- ISSN
- 0092-8674 (ISSN-L)
- PMC
- PMC6175607
- OpenAlex
- W2889421335
- Semantic Scholar
- 68a0a360b6754c0c8f9f272f6ff06cd5b60de52a
- Cited by
- 249
- References
- 67
- Citations by year
- 2026: 12 · 2025: 24 · 2024: 42 · 2023: 26 · 2022: 41 · 2021: 41 · 2020: 28 · 2019: 32 · 2018: 3
- FWCI
- 12.41
- Type
- journal article
- Language
- en
- Open access
- bronze
- doi.org
- Licence
- Locations
- Cell (publishedVersion)
- PubMed (publishedVersion)
- Europe PMC (PubMed Central) (acceptedVersion)
- PubMed Central (acceptedVersion)
- eScholarship (California Digital Library) (submittedVersion)
- Funders
- The New York Stem Cell Foundation
- Alfred P. Sloan Foundation
- NIH Director’s New Innovator Award (1DP2MH11024701)
- 4D Nucleome Common Fund (1U01HL12999801)
- NIH (R01 GM113929)
- NSF-NIGMS (1562665)
- Topics
- Life Sciences › Neuroscience › Cellular and Molecular Neuroscience › Genetic Neurodegenerative Diseases
- Life Sciences › Biochemistry, Genetics and Molecular Biology › Molecular Biology › Genomics and Chromatin Dynamics
- Life Sciences › Biochemistry, Genetics and Molecular Biology › Genetics › Genetics and Neurodevelopmental Disorders
- Keywords
- microsatellite markers, repeat expansion disorders, chromatin domain boundaries, CpG islands, fragile X syndrome, chromatin topology
- MeSH terms
- CCCTC-Binding Factor, Adult, Brain, Cell Line, Chromatin, Disease, DNA, Female, Fragile X Syndrome, Humans, Male, Genome, Human, Microsatellite Repeats, CpG Islands, Trinucleotide Repeat Expansion, Chromatin Assembly and Disassembly, Fragile X Messenger Ribonucleoprotein 1
About these checks
Registry, retraction, Cites and statistics results are computed, not judged, with one exception: a printed reference that no index lists is read once by a model before it counts as a citation error. Claims are extracted by a model and kept only when their quote appears verbatim in the text; each cited source is then checked, with a model’s help, for whether it says what the claim relies on. Those verdicts can be wrong — read the claim’s quote and the cited source before relying on one.
A language model drew the claims from the paper on 2026-10-10, under version 3 of the claim definition (model deepseek-v4.1-flash, prompt extract-v3).
A second model labelled each claim on 2026-10-10 (model jev-1.13-20260917, definition revision gold-guideline-v0.2).
Cited sources are checked with a language model’s help (gpt-6-sol).
Statistics and arithmetic are recomputed, not judged.
Confidence bands are shown only for fields calibrated on our annotated test set. None is calibrated yet, so no band is shown.
What counts as a claim ›How we measure confidence ›How we check this ›
Are you an author, or do you see a problem with this page? Request a review
