Maternal Nicotinamide Riboside Enhances Postpartum Weight Loss, Juvenile Offspring Development, and Neurogenesis of Adult Offspring
Open accessAbstract
Conditions of metabolic stress dysregulate the NAD metabolome. By restoring NAD, nicotinamide riboside (NR) provides resistance to such conditions. We tested the hypotheses that postpartum might dysregulate maternal NAD and that increasing systemic NAD with NR might benefit mothers and offspring. In postpartum mothers, the liver NAD metabolome is depressed while blood increases circulation of NAD metabolites to enable a >20-fold increase in mammary NAD + and NADP + . Lactation and NR synergize in stimulating prolactin synthesis and mammary biosynthetic programs. NR supplementation of new mothers increases lactation and nursing behaviors and stimulates maternal transmission of macronutrients, micronutrients, and BDNF into milk. Pups of NR-supplemented mothers are advantaged in glycemic control, size at weaning, and synaptic pruning. Adult offspring of mothers supplemented during nursing retain advantages in physical performance, anti-anxiety, spatial memory, delayed onset of behavioral immobility, and promotion of adult hippocampal neurogenesis. Thus, postgestational maternal micronutrition confers lasting advantages to offspring.
Integrity signals
Registry
Cites
Statistics
Claims the paper makes
Claims other papers make about this one
Each is checked against this paper’s own text: does it say what the citing paper says it does?
Altering or disrupting metabolic status, for example by a high-fat diet, postpartum weight loss, or disruption of circadian rhythm, can lead to lower NAD+ levels and thereby reduced activity of sirtuins and other NAD+-dependent cellular processes.
“Altering or disrupting metabolic status, for example as a consequence of a high-fat diet81,82, postpartum weight loss83 and disruption of the circadian rhythm1,83, can lead to lower NAD+ levels, and thereby reduced activity of sirtuins as well as other NAD+-dependent cellular processes (see Supplementary Box 2 for details).”
From NAD+ metabolism and its roles in cellular processes during ageing (2021) · cites this paper as [83]
Cites
1 retracted
Braidy, N., Poljak, A., Grant, R., Jayasena, T., Mansour, H., Chan‐Ling, T., Guillemin, G. J., Smythe, G. A., & Sachdev, P. S. (2013) · Biogerontology · doi:10.1007/s10522-013-9489-5 · Cited by 121 · see citing works
RetractedNeurotrophins: Roles in Neuronal Development and Function
Huang, E. J., & Reichardt, L. F. (2001) · Annual Review of Neuroscience · doi:10.1146/annurev.neuro.24.1.677 · Cited by 4,394 · see citing works
Egan, M. F., Kojima, M., Callicott, J. H., Goldberg, T. E., Kolachana, B. S., Bertolino, A., Zaitsev, E., Gold, B., Goldman, D., Dean, M., et al. (2003) · Cell · doi:10.1016/s0092-8674(03)00035-7 · Cited by 3,888 · see citing works
New neurons and new memories: how does adult hippocampal neurogenesis affect learning and memory?
Deng, W., Aimone, J. B., & Gage, F. H. (2010) · Nature reviews. Neuroscience · doi:10.1038/nrn2822 · Cited by 2,120 · see citing works
Bauman, D. E., & Currie, W. B. (1980) · Journal of Dairy Science · doi:10.3168/jds.s0022-0302(80)83111-0 · Cited by 1,871 · see citing works
Bourin, M., & Hascoët, M. (2003) · European Journal of Pharmacology · doi:10.1016/s0014-2999(03)01274-3 · Cited by 1,440 · see citing works
Caldji, C., Tannenbaum, B., Sharma, S., Francis, D., Plotsky, P. M., & Meaney, M. J. (1998) · Proceedings of the National Academy of Sciences · doi:10.1073/pnas.95.9.5335 · Cited by 1,437 · see citing works
Zhang, H., Ryu, D., Wu, Y., Gariani, K., Wang, X., Luan, P., D’Amico, D., Ropelle, E. R., Lutolf, M. P., Aebersold, R., et al. (2016) · Science · doi:10.1126/science.aaf2693 · Cited by 1,255 · see citing works
Cantó, C., Houtkooper, R. H., Pirinen, E., Youn, D. Y., Oosterveer, M. H., Cen, Y., Fernandez-Marcos, P. J., Yamamoto, H., Andreux, P. A., Cettour-Rose, P., et al. (2012) · Cell Metabolism · doi:10.1016/j.cmet.2012.04.022 · Cited by 1,238 · see citing works
New insights into BDNF function in depression and anxiety
Martinowich, K., Manji, H., & Lu, B. (2007) · Nature Neuroscience · doi:10.1038/nn1971 · Cited by 1,221 · see citing works
Huang, Z. J., Kirkwood, A., Pizzorusso, T., Porciatti, V., Morales, B., Bear, M. F., Maffei, L., & Tonegawa, S. (1999) · Cell · doi:10.1016/s0092-8674(00)81509-3 · Cited by 1,198 · see citing works
Maternal care, hippocampal synaptogenesis and cognitive development in rats
Liu, D., Diorio, J., Day, J. C., Francis, D. D., & Meaney, M. J. (2000) · Nature Neuroscience · doi:10.1038/77702 · Cited by 1,195 · see citing works
Cederbaum, A. I. (2012) · Clinics in Liver Disease · doi:10.1016/j.cld.2012.08.002 · Cited by 1,145 · see citing works
NAD+ metabolism in health and disease
Belenky, P. A., Bogan, K. L., & Brenner, C. (2006) · Trends in Biochemical Sciences · doi:10.1016/j.tibs.2006.11.006 · Cited by 983 · see citing works
Self-citationUsing the rat forced swim test to assess antidepressant-like activity in rodents
Slattery, D. A., & Cryan, J. F. (2012) · Nature Protocols · doi:10.1038/nprot.2012.044 · Cited by 903 · see citing works
Bieganowski, P., & Brenner, C. (2004) · Cell · doi:10.1016/s0092-8674(04)00416-7 · Cited by 750 · see citing works
Self-citationCarola, V., D'Olimpio, F., Brunamonti, E., Mangia, F., & Renzi, P. (2002) · Behavioural Brain Research · doi:10.1016/s0166-4328(01)00452-1 · Cited by 735 · see citing works
Bogan, K. L., & Brenner, C. (2008) · Annual Review of Nutrition · doi:10.1146/annurev.nutr.28.061807.155443 · Cited by 707 · see citing works
Self-citationNicotinamide riboside is uniquely and orally bioavailable in mice and humans
Trammell, S. A. J., Schmidt, M. S., Weidemann, B. J., Redpath, P., Jaksch, F., Dellinger, R. W., Li, Z., Abel, E. D., Migaud, M. E., & Brenner, C. (2016) · Nature Communications · doi:10.1038/ncomms12948 · Cited by 697 · see citing works
Self-citationChampagne, D. L., Bagot, R. C., van Hasselt, F., Ramakers, G., Meaney, M. J., de Kloet, E. R., Joels, M., & Krugers, H. (2008) · Journal of Neuroscience · doi:10.1523/jneurosci.0526-08.2008 · Cited by 661 · see citing works
Martens, C. R., Denman, B. A., Mazzo, M. R., Armstrong, M. L., Reisdorph, N., McQueen, M. B., Chonchol, M., & Seals, D. R. (2018) · Nature Communications · doi:10.1038/s41467-018-03421-7 · Cited by 588 · see citing works
Quantitative Analysis of NAD Synthesis-Breakdown Fluxes
Liu, L., Su, X., Quinn, W. J., Hui, S., Krukenberg, K., Frederick, D. W., Redpath, P., Zhan, L., Chellappa, K., White, E., et al. (2018) · Cell Metabolism · doi:10.1016/j.cmet.2018.03.018 · Cited by 564 · see citing works
Self-citationChampagne, F. A., & Meaney, M. J. (2006) · Biological Psychiatry · doi:10.1016/j.biopsych.2005.10.016 · Cited by 510 · see citing works
Motor Coordination and Balance in Rodents
Carter, R. J., Morton, J. P., & Dunnett, S. B. (2001) · Current Protocols in Neuroscience · doi:10.1002/0471142301.ns0812s15 · Cited by 479 · see citing works
Hou, Y., Lautrup, S., Cordonnier, S., Wang, Y., Croteau, D. L., Zavala, E., Zhang, Y., Moritoh, K., O’Connell, J. F., Baptiste, B. A., et al. (2018) · Proceedings of the National Academy of Sciences · doi:10.1073/pnas.1718819115 · Cited by 472 · see citing works
A method for the routine assessment of fore- and hindlimb grip strength of rats and mice.
Oa, M., Ha, T., Wc, B., & Mt, R. (1979) · PubMed · Cited by 415 · see citing works
Impact of maternal diet on human milk composition and neurological development of infants
Innis, S. M. (2014) · American Journal of Clinical Nutrition · doi:10.3945/ajcn.113.072595 · Cited by 397 · see citing works
Colostrum and milk-derived peptide growth factors for the treatment of gastrointestinal disorders
Playford, R. J., MACDONALD, C. E., & Johnson, W. S. (2000) · American Journal of Clinical Nutrition · doi:10.1093/ajcn/72.1.5 · Cited by 392 · see citing works
PARP-1, a determinant of cell survival in response to DNA damage
Bouchard, V. J., Rouleau, M., & Poirier, G. G. (2003) · Experimental Hematology · doi:10.1016/s0301-472x(03)00083-3 · Cited by 390 · see citing works
NRK1 controls nicotinamide mononucleotide and nicotinamide riboside metabolism in mammalian cells
Ratajczak, J., Joffraud, M., Trammell, S. A. J., Ras, R., Canela, N., Boutant, M., Kulkarni, S. S., Rodrigues, M., Redpath, P., Migaud, M. E., et al. (2016) · Nature Communications · doi:10.1038/ncomms13103 · Cited by 378 · cited 10× · see citing works
“NMNAT1 forward: TGGCTCTTTTAACCCCATCAC (Ratajczak et al., 2016)”
MethodInfluentialSelf-citationCircadian Reprogramming in the Liver Identifies Metabolic Pathways of Aging
Sato, S., Solanas, G., Peixoto, F. O., Bee, L., Symeonidi, A., Schmidt, M. S., Brenner, C., Masri, S., Benitah, S. A., & Sassone‐Corsi, P. (2017) · Cell · doi:10.1016/j.cell.2017.07.042 · Cited by 358 · see citing works
Self-citationNicotinamide Riboside Preserves Cardiac Function in a Mouse Model of Dilated Cardiomyopathy
Diguet, N., Trammell, S. A. J., Tannous, C., Deloux, R., Piquereau, J., Mougenot, N., Gouge, A., Gressette, M., Manoury, B., Blanc, J., et al. (2018) · Circulation · doi:10.1161/circulationaha.116.026099 · Cited by 358 · see citing works
Self-citationNicotinamide Riboside Opposes Type 2 Diabetes and Neuropathy in Mice
Trammell, S. A. J., Weidemann, B. J., Chadda, A., Yorek, M. S., Holmes, A., Coppey, L. J., Obrosov, A., Kardon, R. H., Yorek, M. A., & Brenner, C. (2016) · Scientific Reports · doi:10.1038/srep26933 · Cited by 301 · cited 4× · see citing works
“hepatic NADP and NADPH (Trammell et al., 2016b), we aimed to determine whether postpartum might alter the liver NAD system.”
BackgroundInfluentialSelf-citationNoble, E. E., Billington, C. J., Kotz, C. M., & Wang, C. (2011) · American Journal of Physiology-Regulatory, Integrative and Comparative Physiology · doi:10.1152/ajpregu.00776.2010 · Cited by 284 · see citing works
Dollerup, O. L., Christensen, B., Svart, M., Schmidt, M. S., Sulek, K., Ringgaard, S., Stødkilde-Jørgensen, H., Møller, N., Brenner, C., Treebak, J. T., et al. (2018) · The American Journal of Clinical Nutrition · doi:10.1093/ajcn/nqy132 · Cited by 282 · see citing works
Self-citationBrown, K. D., Maqsood, S., Huang, J.-Y., Pan, Y., Harkcom, W., Li, W., Sauve, A., Verdin, E., & Jaffrey, S. R. (2014) · Cell Metabolism · doi:10.1016/j.cmet.2014.11.003 · Cited by 277 · see citing works
The Hippocampus, Neurotrophic Factors and Depression
Masi, G., & Brovedani, P. (2011) · CNS Drugs · doi:10.2165/11595900-000000000-00000 · Cited by 262 · see citing works
FRANTZ, A. G. (1978) · New England Journal of Medicine · doi:10.1056/nejm197801262980408 · Cited by 256 · see citing works
Pellegrini-Giampietro, D. E., Bennett, M. V., & Zukin, R. S. (1991) · Proceedings of the National Academy of Sciences · doi:10.1073/pnas.88.10.4157 · Cited by 249 · see citing works
NAD Deficiency, Congenital Malformations, and Niacin Supplementation
Shi, H., Enriquez, A., Rapadas, M., Martin, E. M. M. A., Wang, R., Moreau, J., Lim, C. K., Szot, J. O., Ip, E., Hughes, J. N., et al. (2017) · New England Journal of Medicine · doi:10.1056/nejmoa1616361 · Cited by 246 · see citing works
NAD Kinase Levels Control the NADPH Concentration in Human Cells
Pollak, N., Niere, M., & Ziegler, M. (2007) · Journal of Biological Chemistry · doi:10.1074/jbc.m704442200 · Cited by 197 · see citing works
TARGETED, LCMS-BASED METABOLOMICS FOR QUANTITATIVE MEASUREMENT OF NAD + METABOLITES
Trammell, S. A. J., & Brenner, C. (2013) · Computational and Structural Biotechnology Journal · doi:10.5936/csbj.201301012 · Cited by 194 · see citing works
Self-citationHabbout, A., Li, N., Rochette, L., & Vergely, C. (2013) · Journal of Nutrition · doi:10.3945/jn.112.172825 · Cited by 138 · see citing works
Nicotinamide Riboside Is a Major NAD+ Precursor Vitamin in Cow Milk
Trammell, S. A., Yu, L., Redpath, P., Migaud, M. E., & Brenner, C. (2016) · The Journal of Nutrition · doi:10.3945/jn.116.230078 · Cited by 112 · see citing works
Self-citationChen, Y., Zheng, Z., Zhu, X., Shi, Y., Tian, D., Zhao, F., Liu, N., Hüppi, P. S., Troy, F. A., & Wang, B. (2014) · Molecular Neurobiology · doi:10.1007/s12035-014-8856-9 · Cited by 112 · see citing works
BARBER, M. C., CLEGG, R. A., Finley, E., et al. (1992) · Journal of Endocrinology · doi:10.1677/joe.0.1350195 · Cited by 98 · see citing works
Evaluation of Mammary Gland Development and Function in Mouse Models
Plante, I., Stewart, M. K. G., & Laird, D. W. (2011) · Journal of Visualized Experiments · doi:10.3791/2828 · Cited by 96 · see citing works
Vaur, P., Brugg, B., Mericskay, M., Li, Z., Schmidt, M. S., Vivien, D., Orset, C., Jacotot, E. D., Brenner, C., & Duplus, E. (2017) · The FASEB Journal · doi:10.1096/fj.201700221rr · Cited by 86 · see citing works
Self-citationMaternal health study: a prospective cohort study of nulliparous women recruited in early pregnancy
Brown, S., Lumley, J., McDonald, E., & Krastev, A. H. (2006) · BMC Pregnancy and Childbirth · doi:10.1186/1471-2393-6-12 · Cited by 86 · see citing works
Hamity, M. V., White, S. R., Walder, R. Y., Schmidt, M. S., Brenner, C., & Hammond, D. L. (2017) · Pain · doi:10.1097/j.pain.0000000000000862 · Cited by 80 · see citing works
Self-citationCross fostering in mice: behavioral and physiological carry‐over effects in adulthood
Bartolomucci, A., Gioiosa, L., Chirieleison, A., Ceresini, G., Parmigiani, S., & Palanza, P. (2004) · Genes Brain & Behavior · doi:10.1111/j.1601-183x.2003.00059.x · Cited by 76 · see citing works
Vitamin Profile of 563 Gravidas during Trimesters of Pregnancy
Baker, H., DeAngelis, B., Holland, B. K., et al. (2002) · Journal of the American College of Nutrition · doi:10.1080/07315724.2002.10719191 · Cited by 70 · see citing works
Jensen Peña, C., & Champagne, F. A. (2013) · Behavioral Neuroscience · doi:10.1037/a0031219 · Cited by 54 · see citing works
Use of Domperidone as a Galactagogue Drug
Paul, C., Zénut, M., Dorut, A., et al. (2014) · Journal of Human Lactation · doi:10.1177/0890334414561265 · Cited by 47 · see citing works
Forcato, D. O., Carmine, M. P., Echeverría, G. E., et al. (2005) · Journal of Dairy Science · doi:10.3168/jds.s0022-0302(05)72709-0 · Cited by 42 · see citing works
Li, R., Xia, W. T., Zhang, Z., et al. (2011) · PLoS ONE · doi:10.1371/journal.pone.0021663 · Cited by 41 · see citing works
Kimura, N., Kimura, N., Cathala, G., et al. (1983) · DNA · doi:10.1089/dna.1983.2.195 · Cited by 34 · see citing works
Flagged first, then by citations
Cited by
Sorted by citations
NAD+ metabolism and its roles in cellular processes during ageing
Covarrubias, A. J., Perrone, R., Grozio, A., & Verdin, E. (2021) · Nature Reviews Molecular Cell Biology · doi:10.1038/s41580-020-00313-x · Cited by 1,617 · see citing works
NAD+ homeostasis in health and disease
Katsyuba, E., Romani, M., Hofer, D., & Auwerx, J. (2020) · Nature Metabolism · doi:10.1038/s42255-019-0161-5 · Cited by 627 · see citing works
Conze, D., Brenner, C., & Kruger, C. L. (2019) · Scientific Reports · doi:10.1038/s41598-019-46120-z · Cited by 210 · see citing works
Self-citationIntergenerational Metabolic Syndrome and Neuronal Network Hyperexcitability in Autism
Rivell, A., & Mattson, M. P. (2019) · Trends in Neurosciences · doi:10.1016/j.tins.2019.08.006 · Cited by 50 · see citing works
- Authors
- Ear, P. H., Chadda, A., Gumusoglu, S. B., Schmidt, M. S., Vogeler, S., Malicoat, J., Kadel, J., Moore, M. M., Migaud, M. E., Stevens, H. E., & Brenner, C.
- Affiliations
- University of Iowa (US)
- Corresponding author
- Brenner, Charles
- ORCID
- Venue
- Cell Reports
- Publisher
- Elsevier BV
- Published
- 2019-01
- Volume
- 26
- Issue
- 4
- Pages
- 969-983.e4
- ISSN
- 2211-1247 (ISSN-L)
- OpenAlex
- W2913580175
- Cited by
- 72
- References
- 57
- Citations by year
- 2026: 4 · 2025: 8 · 2024: 10 · 2023: 7 · 2022: 9 · 2021: 12 · 2020: 15 · 2019: 7
- FWCI
- 5.66
- Type
- journal article
- Language
- en
- Open access
- gold
- doi.org
- Licence
- Locations
- Cell Reports (publishedVersion, cc-by)
- PubMed (publishedVersion)
- Funders
- Roy J. Carver Trust
- ChromaDex
- Topics
- Health Sciences › Medicine › Geriatrics and Gerontology › Sirtuins and Resveratrol in Medicine
- Health Sciences › Medicine › Pediatrics, Perinatology and Child Health › Birth, Development, and Health
- Health Sciences › Medicine › Rheumatology › Folate and B Vitamins Research
- Keywords
- nicotinamide riboside, NAD+ metabolism, postpartum weight loss, lactation, maternal nutrition, mammary gland, prolactin, brain-derived neurotrophic factor, milk composition, offspring development, glycemic control, synaptic pruning, hippocampal neurogenesis, anxiety, spatial memory
- MeSH terms
- Animals, Female, Lactation, Liver, NAD, Niacinamide, Pregnancy, Prenatal Exposure Delayed Effects, Pyridinium Compounds, Weight Loss, Maternal Exposure, Postpartum Period, Mice, Neurogenesis
About these checks
Registry, retraction, Cites and statistics results are computed, not judged, with one exception: a printed reference that no index lists is read once by a model before it counts as a citation error. Claims are extracted by a model and kept only when their quote appears verbatim in the text; each cited source is then checked, with a model’s help, for whether it says what the claim relies on. Those verdicts can be wrong — read the claim’s quote and the cited source before relying on one.
Statistics and arithmetic are recomputed, not judged.
Confidence bands are shown only for fields calibrated on our annotated test set. None is calibrated yet, so no band is shown.
What counts as a claim ›How we measure confidence ›How we check this ›
Are you an author, or do you see a problem with this page? Request a review
