A Cytoplasmic ATM-TRAF6-cIAP1 Module Links Nuclear DNA Damage Signaling to Ubiquitin-Mediated NF-κB Activation

Hinz, Michael; Stilmann, Michael; Arslan, Seda Çöl; Khanna, Kum Kum; Dittmar, Gunnar; Scheidereit, Claus

doi:10.1016/j.molcel.2010.09.008

Cited by 280NF-κB Signaling PathwaysDNA Repair MechanismsGenomics and Chromatin Dynamics

A Cytoplasmic ATM-TRAF6-cIAP1 Module Links Nuclear DNA Damage Signaling to Ubiquitin-Mediated NF-κB Activation

Open access

Hinz, Michael, Stilmann, Michael, Arslan, Seda Çöl, Khanna, Kum Kum, Dittmar, Gunnar, Scheidereit, Claus·2010·Molecular Cell

DOI 10.1016/j.molcel.2010.09.008

Open this paper in CoChat — free account

Abstract

As part of the genotoxic stress response, cells activate the transcription factor NF-κB. The DNA strand break sensor poly(ADP-ribose)-polymerase-1 (PARP-1) and the kinase ataxia telangiectasia mutated (ATM) act as proximal signal mediators. PARP-1 assembles a nucleoplasmic signalosome, which triggers PIASy-mediated IKKγ SUMOylation. ATM-dependent IKKγ phosphorylation and subsequent ubiquitination were implicated to activate the cytoplasmic IκB kinase (IKK) complex by unknown mechanisms. We show that activated ATM translocates in a calcium-dependent manner to cytosol and membrane fractions. Through a TRAF-binding motif, ATM activates TRAF6, resulting in Ubc13-mediated K63-linked polyubiquitin synthesis and cIAP1 recruitment. The ATM-TRAF6-cIAP1 module stimulates TAB2-dependent TAK1 phosphorylation. Both nuclear PARP-1- and cytoplasmic ATM-driven signaling branches converge at the IKK complex to catalyze monoubiquitination of IKKγ at K285. Our data indicate that exported SUMOylated IKKγ acts as a substrate. IKKγ monoubiquitination is a prerequisite for genotoxic IKK and NF-κB activation, but also promotes cytokine signaling.

Integrity signals

Registry

Crossref · 10.1016/j.molcel.2010.09.008

Cites

42 of 42 references verified0 citation errors · 0 not checkable

Statistics

Recomputing p-values needs the paper’s full text.

Claims the paper makes

We couldn’t retrieve this paper’s full text, so its claims and self-check weren’t run. The registry and citation checks still apply.

Claims other papers make about this one

Each is checked against this paper’s own text: does it say what the citing paper says it does?

Following DSB induction, activated ATM couples with protein intermediates leading to its cytoplasmic transport and downstream activation of NF-kB.
“Subsequent studies confirmed that following DSB induction, activated ATM couples with a number of protein intermediates leading to its cytoplasmic transport and downstream activation of NF‐kB (Hinz et al, 2010; Wu et al, 2010; Miyamoto, 2011).”
From Mechanisms of DNA damage-mediated neurotoxicity in neurodegenerative disease (2022) · cites this paper as Hinz et al, 2010

MaxQuant enables high peptide identification rates, individualized p.p.b.-range mass accuracies and proteome-wide protein quantification
Cox, J., & Mann, M. (2008) · Nature Biotechnology · doi:10.1038/nbt.1511 · Cited by 14,855 · see citing works
The DNA-damage response in human biology and disease
Jackson, S. P., & Bartek, J. (2009) · Nature · doi:10.1038/nature08467 · Cited by 6,092 · see citing works
Shared Principles in NF-κB Signaling
Hayden, M. S., & Ghosh, S. (2008) · Cell · doi:10.1016/j.cell.2008.01.020 · Cited by 4,814 · see citing works
Rapid detection of octamer binding proteins with ‘mini extracts’, prepared from a small number of cells
Schreiber, E. H., Matthias, P., Müller, M. M., & Schaffner, W. (1989) · Nucleic Acids Research · doi:10.1093/nar/17.15.6419 · Cited by 4,179 · see citing works
Genome maintenance mechanisms for preventing cancer
Hoeijmakers, J. H. J. (2001) · Nature · doi:10.1038/35077232 · Cited by 3,939 · see citing works
DNA damage activates ATM through intermolecular autophosphorylation and dimer dissociation
Bakkenist, C. J., & Kastan, M. B. (2003) · Nature · doi:10.1038/nature01368 · Cited by 3,466 · see citing works
Cell-cycle checkpoints and cancer
Kastan, M. B., & Bartek, J. (2004) · Nature · doi:10.1038/nature03097 · Cited by 2,836 · see citing works
ATM and related protein kinases: safeguarding genome integrity
Shiloh, Y. (2003) · Nature Reviews Cancer · doi:10.1038/nrc1011 · Cited by 2,577 · see citing works
Poly(ADP-ribose): novel functions for an old molecule
Schreiber, V., Dantzer, F., Amé, J., & de MURCIA, G. (2006) · Nature Reviews Molecular Cell Biology · doi:10.1038/nrm1963 · Cited by 1,917 · see citing works
The DNA Damage Response: Ten Years After
Harper, J. W., & Elledge, S. J. (2007) · Molecular Cell · doi:10.1016/j.molcel.2007.11.015 · Cited by 1,705 · see citing works
Regulation and Function of IKK and IKK-Related Kinases
Häcker, H., & Karin, M. (2006) · Science s STKE · doi:10.1126/stke.3572006re13 · Cited by 1,269 · see citing works
Activation of IKK by TNFα Requires Site-Specific Ubiquitination of RIP1 and Polyubiquitin Binding by NEMO
Ea, C.-K., Deng, L., Xia, Z.-P., Pineda, G., & Chen, Z. J. (2006) · Molecular Cell · doi:10.1016/j.molcel.2006.03.026 · Cited by 998 · see citing works
TAB2 and TAB3 Activate the NF-κB Pathway through Binding to Polyubiquitin Chains
Kanayama, A., Seth, R. B., Sun, L., Ea, C.-K., Hong, M., Shaito, A. A., Chiu, Y., Deng, L., & Chen, Z. J. (2004) · Molecular Cell · doi:10.1016/j.molcel.2004.08.008 · Cited by 890 · see citing works
Comprehensive mass-spectrometry-based proteome quantification of haploid versus diploid yeast
de Godoy, L. M. F., Olsen, J. V., Cox, J., Nielsen, M. L., Hubner, N. C., Fröhlich, F., Walther, T. C., & Mann, M. (2008) · Nature · doi:10.1038/nature07341 · Cited by 873 · see citing works
Poly(ADP-ribosyl)ation by PARP-1: `PAR-laying' NAD + into a nuclear signalPreprint
Kim, M. Y., Zhang, T., & Kraus, W. L. (2005) · Genes & Development · doi:10.1101/gad.1331805 · Cited by 803 · see citing works
Distinct molecular mechanism for initiating TRAF6 signalling
Ye, H., Arron, J. R., Lamothe, B., Cirilli, M., Kobayashi, T., Shevde, N. K., Segal, D., Dzivenu, O. K., Vologodskaia, M., Yim, M., et al. (2002) · Nature · doi:10.1038/nature00888 · Cited by 665 · see citing works
IκB kinase complexes: gateways to NF-κB activation and transcription
Scheidereit, C. (2006) · Oncogene · doi:10.1038/sj.onc.1209934 · Cited by 652 · see citing works
Self-citation
Ubiquitylation in innate and adaptive immunity
Bhoj, V. G., & Chen, Z. J. (2009) · Nature · doi:10.1038/nature07959 · Cited by 632 · see citing works
Sensing of Lys 63-linked polyubiquitination by NEMO is a key event in NF-κB activation
Wu, C.-J., Conze, D. B., Li, T., Srinivasula, S. M., & Ashwell, J. D. (2006) · Nature Cell Biology · doi:10.1038/ncb1384 · Cited by 607 · see citing works
Direct activation of protein kinases by unanchored polyubiquitin chains
Xia, Z.-P., Sun, L., Chen, X., Pineda, G., Jiang, X., Adhikari, A., Zeng, W., & Chen, Z. J. (2009) · Nature · doi:10.1038/nature08247 · Cited by 570 · see citing works
Sequential Modification of NEMO/IKKγ by SUMO-1 and Ubiquitin Mediates NF-κB Activation by Genotoxic Stress
Huang, T. T., Wuerzberger‐Davis, S. M., Wu, Z., & Miyamoto, S. (2003) · Cell · doi:10.1016/s0092-8674(03)00895-x · Cited by 560 · see citing works
Activation and regulation of ATM kinase activity in response to DNA double-strand breaks
Lee, J.-H., & Paull, T. T. (2007) · Oncogene · doi:10.1038/sj.onc.1210872 · Cited by 545 · see citing works
Molecular Linkage Between the Kinase ATM and NF-κB Signaling in Response to Genotoxic Stimuli
Wu, Z., Shi, Y., Tibbetts, R. S., & Miyamoto, S. (2006) · Science · doi:10.1126/science.1121513 · Cited by 515 · see citing works
ATM associates with and phosphorylates p53: mapping the region of interaction
Khanna, K. K., Keating, K. E., Kozlov, S., Scott, S. P., Gatei, M. H., Hobson, K., Taya, Y., Gabrielli, B. G., Chan, D. W., Lees‐Miller, S. P., et al. (1998) · Nature Genetics · doi:10.1038/3882 · Cited by 481 · see citing works
Self-citation
Structure, dynamics and function of nuclear pore complexes
D’Angelo, M. A., & Hetzer, M. W. (2008) · Trends in Cell Biology · doi:10.1016/j.tcb.2008.07.009 · Cited by 377 · see citing works
DNA damage and ageing: new-age ideas for an age-old problem
Garinis, G. A., van der Horst, G. T. J., Vijg, J., & H.J. Hoeijmakers, J. (2008) · Nature Cell Biology · doi:10.1038/ncb1108-1241 · Cited by 366 · see citing works
Signals from within: the DNA-damage-induced NF-κB response
Janssens, S., & Tschopp, J. (2006) · Cell Death and Differentiation · doi:10.1038/sj.cdd.4401843 · Cited by 321 · see citing works
Feedback-regulated poly(ADP-ribosyl)ation by PARP-1 is required for rapid response to DNA damage in living cells
Mortusewicz, O., Amé, J., Schreiber, V., & Leonhardt, H. (2007) · Nucleic Acids Research · doi:10.1093/nar/gkm933 · Cited by 321 · see citing works
Interleukin-1 (IL-1) Receptor-Associated Kinase-Dependent IL-1-Induced Signaling Complexes Phosphorylate TAK1 and TAB2 at the Plasma Membrane and Activate TAK1 in the Cytosol
Jiang, Z., Ninomiya‐Tsuji, J., Qian, Y., Matsumoto, K., & Li, X. (2002) · Molecular and Cellular Biology · doi:10.1128/mcb.22.20.7158-7167.2002 · Cited by 284 · see citing works
IAPs contain an evolutionarily conserved ubiquitin-binding domain that regulates NF-κB as well as cell survival and oncogenesis
Gyrd‐Hansen, M., Darding, M., Miasari, M., Santoro, M. M., Zender, L., Xue, W., Tenev, T., da Fonseca, P. C. A., Zvelebil, M., Bujnicki, J. M., et al. (2008) · Nature Cell Biology · doi:10.1038/ncb1789 · Cited by 255 · see citing works
A nuclear poly(ADP-Ribose)-dependent signalosome confers DNA damage-induced IκB kinase activation.
Stilmann, M., Hinz, M., Arslan, S. Ç., Zimmer, A., Schreiber, V., & Scheidereit, C. (2009) · Molecular Cell · doi:10.1016/j.molcel.2009.09.032 · Cited by 232 · see citing works
Self-citation
PIASy mediates NEMO sumoylation and NF-κB activation in response to genotoxic stress
Mabb, A. M., Wuerzberger‐Davis, S. M., & Miyamoto, S. (2006) · Nature Cell Biology · doi:10.1038/ncb1458 · Cited by 226 · see citing works
ATM Is Required for IκB Kinase (IKK) Activation in Response to DNA Double Strand Breaks
Li, N., Banin, S., Ouyang, H., Li, G. C., Courtois, G., Shiloh, Y., Karin, M., & Rotman, G. (2001) · Journal of Biological Chemistry · doi:10.1074/jbc.m009809200 · Cited by 188 · see citing works
Coordinated Regulation of Toll-Like Receptor and NOD2 Signaling by K63-Linked Polyubiquitin Chains
Abbott, D. W., Yang, Y., Hutti, J. E., Madhavarapu, S., Kelliher, M. A., & Cantley, L. C. (2007) · Molecular and Cellular Biology · doi:10.1128/mcb.00270-07 · Cited by 183 · see citing works
The ATM protein is required for sustained activation of NF-κB following DNA damage
Piret, B., Schoonbroodt, S., & Piette, J. (1999) · Oncogene · doi:10.1038/sj.onc.1202541 · Cited by 176 · cited 3× · see citing works
“NF-kB activation requires ATM and PARP-1 (Li et al., 2001; Piret et al., 1999; Stilmann et al., 2009).”
TRAF6 Autoubiquitination-Independent Activation of the NFκB and MAPK Pathways in Response to IL-1 and RANKL
Walsh, M. C., Kim, G. K., Maurizio, P. L., Molnar, E. E., & Choi, Y. (2008) · PLoS ONE · doi:10.1371/journal.pone.0004064 · Cited by 175 · see citing works
The death domain kinase RIP has an essential role in DNA damage-induced NF-κB activationPreprint
Hur, G. M., Lewis, J., Yang, Q., Lin, Y., Nakano, H., Nedospasov, S. A., & Liu, Z.-G. (2003) · Genes & Development · doi:10.1101/gad.1062403 · Cited by 140 · see citing works
Many faces of NF-κB signaling induced by genotoxic stress
Wu, Z., & Miyamoto, S. (2007) · Journal of Molecular Medicine · doi:10.1007/s00109-007-0227-9 · Cited by 129 · see citing works
cIAP1, cIAP2, and XIAP Act Cooperatively via Nonredundant Pathways to Regulate Genotoxic Stress–Induced Nuclear Factor-κB Activation
Jin, H., Lee, D.-H., Kim, D., Chung, J.-H., Lee, S.-J., & Lee, T. H. (2009) · Cancer Research · doi:10.1158/0008-5472.can-08-2256 · Cited by 102 · see citing works
Chromatin Recruitment of DNA Repair Proteins: Lessons from the Fanconi Anemia and Double-Strand Break Repair Pathways
Cohn, M. A., & D’Andrea, A. D. (2008) · Molecular Cell · doi:10.1016/j.molcel.2008.10.009 · Cited by 76 · see citing works
Signal Responsiveness of IκB Kinases Is Determined by Cdc37-assisted Transient Interaction with Hsp90
Hinz, M., Broemer, M., Arslan, S. Ç., Otto, A., Mueller, E., Dettmer, R., & Scheidereit, C. (2007) · Journal of Biological Chemistry · doi:10.1074/jbc.m705785200 · Cited by 76 · see citing works
Self-citation
Calcium-Dependent Regulation of NEMO Nuclear Export in Response to Genotoxic Stimuli
Berchtold, C. M., Wu, Z., Huang, T. T., & Miyamoto, S. (2006) · Molecular and Cellular Biology · doi:10.1128/mcb.01772-06 · Cited by 31 · see citing works

Flagged first, then by citations

Sorted by citations

NF-κB, the first quarter-century: remarkable progress and outstanding questions
Hayden, M. S., & Ghosh, S. (2012) · Genes & Development · doi:10.1101/gad.183434.111 · Cited by 1,693 · see citing works
The Ripoptosome, a Signaling Platform that Assembles in Response to Genotoxic Stress and Loss of IAPs
Tenev, T., Bianchi, K., Darding, M., Broemer, M., Langlais, C., Wållberg, F., Zachariou, A., Lopez, J. S., MacFarlane, M., Cain, K., et al. (2011) · Molecular Cell · doi:10.1016/j.molcel.2011.06.006 · Cited by 818 · see citing works
Emerging role of NF-κB signaling in the induction of senescence-associated secretory phenotype (SASP)
Salminen, A., Kauppinen, A., & Kaarniranta, K. (2012) · Cellular Signalling · doi:10.1016/j.cellsig.2011.12.006 · Cited by 763 · see citing works
Non-canonical activation of the DNA sensing adaptor STING by ATM and IFI16 mediates NF-κB signaling after nuclear DNA damage
Dunphy, G., Flannery, S. M., Almine, J. F., Connolly, D. J., Paulus, C., Jønsson, K. L., Jakobsen, M. R., Nevels, M. M., Bowie, A. G., & Unterholzner, L. (2018) · Molecular Cell · doi:10.1016/j.molcel.2018.07.034 · Cited by 648 · see citing works
“involves the DNA damage kinase ataxia telangiectasia mutated (ATM) and the enzyme poly(ADP-ribose) polymerase 1 (PARP-1) (Hinz et al., 2010; Piret et al., 1999; Stilmann et al., 2009).”
BackgroundInfluential
The IκB kinase complex in NF‐κB regulation and beyond
Hinz, M., & Scheidereit, C. (2014) · The EMBO Reports · doi:10.1002/embr.201337983 · Cited by 572 · see citing works
Self-citation
TRAF molecules in cell signaling and in human diseases
Xie, P. (2013) · Journal of Molecular Signaling · doi:10.1186/1750-2187-8-7 · Cited by 467 · see citing works
Chronic inflammation and the hallmarks of aging
Baechle, J. J., Chen, N., Makhijani, P., Winer, S., Furman, D., & Winer, D. A. (2023) · Molecular Metabolism · doi:10.1016/j.molmet.2023.101755 · Cited by 471 · see citing works
DNA damage and repair in age-related inflammation
Zhao, Y., Simon, M. A., Seluanov, A., & Gorbunova, V. A. (2022) · Nature reviews. Immunology · doi:10.1038/s41577-022-00751-y · Cited by 393 · see citing works
Targeting of TAK1 in inflammatory disorders and cancer
Sakurai, H. (2012) · Trends in Pharmacological Sciences · doi:10.1016/j.tips.2012.06.007 · Cited by 377 · see citing works
Cellular stress response and innate immune signaling: integrating pathways in host defense and inflammation
Muralidharan, S., & Mandrekar, P. (2013) · Journal of Leukocyte Biology · doi:10.1189/jlb.0313153 · Cited by 329 · see citing works
Targeting the DNA damage response in immuno-oncology: developments and opportunities
Chabanon, R. M., Rouanne, M., Lord, C. J., Soria, J., Pasero, P., & Postel-Vinay, S. C. (2021) · Nature reviews. Cancer · doi:10.1038/s41568-021-00386-6 · Cited by 300 · see citing works
Cellular functions of the protein kinase ATM and their relevance to human disease
Lee, J., & Paull, T. T. (2021) · Nature Reviews Molecular Cell Biology · doi:10.1038/s41580-021-00394-2 · Cited by 290 · see citing works
The DNA damage-induced cell death response: a roadmap to kill cancer cells
Matt, S., & Hofmann, T. G. (2016) · Cellular and Molecular Life Sciences · doi:10.1007/s00018-016-2130-4 · Cited by 288 · see citing works
Regulation of cell death and autophagy by IKK and NF‐κB: critical mechanisms in immune function and cancer
Baldwin, A. S. (2012) · Immunological Reviews · doi:10.1111/j.1600-065x.2012.01095.x · Cited by 277 · see citing works
NEMO and RIP1 Control Cell Fate in Response to Extensive DNA Damage via TNF-α Feedforward Signaling
Biton, S., & Ashkenazi, A. (2011) · Cell · doi:10.1016/j.cell.2011.02.023 · Cited by 262 · see citing works
Nuclear initiated NF-κB signaling: nemo and ATM take center stage
Miyamoto, S. (2011) · Cell Research · doi:10.1038/cr.2010.179 · Cited by 253 · see citing works
DNA damage‐dependent NF‐κB activation: NEMO turns nuclear signaling inside out
McCool, K. W., & Miyamoto, S. (2012) · Immunological Reviews · doi:10.1111/j.1600-065x.2012.01101.x · Cited by 251 · see citing works
Expanding role of ubiquitination in NF-κB signaling
Liu, S., & Chen, Z. J. (2010) · Cell Research · doi:10.1038/cr.2010.170 · Cited by 243 · see citing works
ATM and the Molecular Pathogenesis of Ataxia Telangiectasia
McKinnon, P. J. (2011) · Annual Review of Pathology Mechanisms of Disease · doi:10.1146/annurev-pathol-011811-132509 · Cited by 239 · see citing works
Dnase2a deficiency uncovers lysosomal clearance of damaged nuclear DNA via autophagy
Lan, Y. Y., Londoño, D., Bouley, R., Rooney, M. S., & Hacohen, N. (2014) · Cell Reports · doi:10.1016/j.celrep.2014.08.074 · Cited by 236 · see citing works
Multifaceted Role of PARP-1 in DNA Repair and Inflammation: Pathological and Therapeutic Implications in Cancer and Non-Cancer Diseases
Pazzaglia, S., & Pioli, C. (2019) · Cells · doi:10.3390/cells9010041 · Cited by 223 · see citing works
Beyond ATM: The protein kinase landscape of the DNA damage response
Bensimon, A., Aebersold, R. H., & Shiloh, Y. (2011) · FEBS Letters · doi:10.1016/j.febslet.2011.05.013 · Cited by 206 · see citing works
Inhibitory feedback control of NF-κB signalling in health and disease
Prescott, J. A., Mitchell, J. P., & Cook, S. J. (2021) · Biochemical Journal · doi:10.1042/bcj20210139 · Cited by 193 · see citing works
A ROS rheostat for cell fate regulation
Maryanovich, M., & Gross, A. (2012) · Trends in Cell Biology · doi:10.1016/j.tcb.2012.09.007 · Cited by 181 · see citing works
Beyond DNA repair, the immunological role of PARP ‐1 and its siblings
Rosado, M. M., Bennici, E., Novelli, F., & Pioli, C. (2013) · Immunology · doi:10.1111/imm.12099 · Cited by 178 · see citing works
TAK1, more than just innate immunity
Dai, L. X., Thu, C. A., Liu, X., Xi, J., & Cheung, P. (2012) · IUBMB Life · doi:10.1002/iub.1078 · Cited by 177 · see citing works
A hMTR4‐PDIA3P1‐miR‐125/124‐TRAF6 Regulatory Axis and Its Function in NF kappa B Signaling and Chemoresistance
Xie, C., Zhang, L., Chen, Z., Zhong, W., Fang, J., Zhu, Y., Xiao, M.-H., Guo, Z., Zhao, N., He, X., et al. (2019) · Hepatology · doi:10.1002/hep.30931 · Cited by 159 · see citing works
The senescence-associated secretory phenotype is potentiated by feedforward regulatory mechanisms involving Zscan4 and TAK1.
Zhang, B., Fu, D., Xu, Q., Cong, X., Wu, C., Zhong, X., Ma, Y., Lv, Z., Chen, F., Han, L., et al. (2018) · Nature Communications · doi:10.1038/s41467-018-04010-4 · Cited by 157 · see citing works
Targeted and Off-Target (Bystander and Abscopal) Effects of Radiation Therapy: Redox Mechanisms and Risk/Benefit Analysis
Pouget, J., Georgakilas, A. G., & Ravanat, J. (2018) · Antioxidants and Redox Signaling · doi:10.1089/ars.2017.7267 · Cited by 160 · see citing works
Post-Translational Modifications of the TAK1-TAB Complex
Hirata, Y., Takahashi, M., Morishita, T., Noguchi, T., & Matsuzawa, A. (2017) · International Journal of Molecular Sciences · doi:10.3390/ijms18010205 · Cited by 155 · see citing works
Genome-Wide Association Study in East Asians Identifies Novel Susceptibility Loci for Breast Cancer
Long, J., Cai, Q., Sung, H., Shi, J., Zhang, B., Choi, J., Wen, W., Delahanty, R., Lu, W., Gao, Y.-T., et al. (2012) · PLoS Genetics · doi:10.1371/journal.pgen.1002532 · Cited by 150 · see citing works
Upregulation of miR-146a contributes to the suppression of inflammatory responses in LPS-induced acute lung injury
Zeng, Z., Gong, H., Li, Y., Jie, K., Ding, C., Shao, Q., Liu, F., Zhan, Y., Nie, C. X., Zhu, W., et al. (2013) · Experimental Lung Research · doi:10.3109/01902148.2013.808285 · Cited by 150 · see citing works
DNA damage and innate immunity: links and trade-offs
Chatzinikolaou, G., Karakasilioti, I., & Garinis, G. A. (2014) · Trends in Immunology · doi:10.1016/j.it.2014.06.003 · Cited by 139 · see citing works
Endogenous modulators and pharmacological inhibitors of histone deacetylases in cancer therapy
Spiegel, S., Milstien, S., & Grant, S. (2011) · Oncogene · doi:10.1038/onc.2011.267 · Cited by 141 · see citing works
The Nuclear Factor κB pathway: A link to the immune system in the radiation response
Hellweg, C. E. (2015) · Cancer Letters · doi:10.1016/j.canlet.2015.02.019 · Cited by 139 · see citing works
DNA Damage Triggers a Chronic Autoinflammatory Response, Leading to Fat Depletion in NER Progeria
Karakasilioti, I., Kamileri, I., Chatzinikolaou, G., Kosteas, T., Vergadi, E., Robinson, A. R., Tsamardinos, I., Rozgaja, T. A., Siakouli, S., Tsatsanis, C., et al. (2013) · Cell Metabolism · doi:10.1016/j.cmet.2013.08.011 · Cited by 137 · see citing works
A Cytosolic ATM/NEMO/RIP1 Complex Recruits TAK1 To Mediate the NF-κB and p38 Mitogen-Activated Protein Kinase (MAPK)/MAPK-Activated Protein 2 Responses to DNA Damage
Yang, Y., Xia, F., Hermance, N. M., Mabb, A. M., Simonson, S. J. S., Morrissey, S., Gandhi, P., Munson, M., Miyamoto, S., & Kelliher, M. A. (2011) · Molecular and Cellular Biology · doi:10.1128/mcb.01139-10 · Cited by 140 · see citing works
Wip1-Dependent Regulation of Autophagy, Obesity, and Atherosclerosis
Guezennec, X. L., Brichkina, A. I., Huang, Y.-F., Kostromina, E. Y., Han, W., & Bulavin, D. V. (2012) · Cell Metabolism · doi:10.1016/j.cmet.2012.06.003 · Cited by 137 · see citing works
DNA single-strand break-induced DNA damage response causes heart failure
Higo, T., Naito, A. T., Sumida, T. S., Shibamoto, M., Okada, K., Nomura, S., Nakagawa, A., Yamaguchi, T., Sakai, T., Hashimoto, A., et al. (2017) · Nature Communications · doi:10.1038/ncomms15104 · Cited by 134 · see citing works
IAP proteins as targets for drug development in oncology
Dubrez, L., Berthelet, J., & Glorian, V. (2013) · OncoTargets and Therapy · doi:10.2147/ott.s33375 · Cited by 133 · see citing works
Mechanisms of DNA damage-mediated neurotoxicity in neurodegenerative disease
Welch, G., & Tsai, L. (2022) · The EMBO Reports · doi:10.15252/embr.202154217 · Cited by 129 · see citing works
LUBAC regulates NF‐κB activation upon genotoxic stress by promoting linear ubiquitination of NEMO
Niu, J., Shi, Y., Iwaï, K., & Wu, Z.-H. (2011) · The EMBO Journal · doi:10.1038/emboj.2011.264 · Cited by 129 · see citing works
IAP Family of Cell Death and Signaling Regulators
Silke, J., & Vucic, D. (2014) · Methods in enzymology on CD-ROM/Methods in enzymology · doi:10.1016/b978-0-12-801430-1.00002-0 · Cited by 127 · see citing works
K63-linked polyubiquitination of transcription factor IRF1 is essential for IL-1-induced production of chemokines CXCL10 and CCL5
Harikumar, K. B., Yester, J., Surace, M. J., Oyeniran, C., Price, M. M., Huang, W., Hait, N. C., Allegood, J. C., Yamada, A., Kong, X., et al. (2014) · Nature Immunology · doi:10.1038/ni.2810 · Cited by 121 · see citing works
Induction of microRNA-155 is TLR- and type IV secretion system-dependent in macrophages and inhibits DNA-damage induced apoptosis
Koch, M., Mollenkopf, H., Klemm, U., & Meyer, T. F. (2012) · Proceedings of the National Academy of Sciences · doi:10.1073/pnas.1116125109 · Cited by 121 · see citing works
DNA Damage Response and Immune Defense
Nastasi, C., Mannarino, L., & D’Incalci, M. (2020) · International Journal of Molecular Sciences · doi:10.3390/ijms21207504 · Cited by 119 · see citing works
ATM protein kinase: the linchpin of cellular defenses to stress
Bhatti, S., Kozlov, S., Farooqi, A. A., Naqi, A., Lavin, M., & Khanna, K. K. (2011) · Cellular and Molecular Life Sciences · doi:10.1007/s00018-011-0683-9 · Cited by 116 · see citing works
Self-citation
The role of autophagy in targeted therapy for acute myeloid leukemia
Du, W., Xu, A., Huang, Y., Cao, J., Zhu, H., Yang, B., Shao, X., He, Q., & Ying, M. (2020) · Autophagy · doi:10.1080/15548627.2020.1822628 · Cited by 116 · see citing works
RC3H1 post-transcriptionally regulates A20 mRNA and modulates the activity of the IKK/NF-κB pathway
Murakawa, Y., Hinz, M., Mothes, J., Schuetz, A., Uhl, M., Wyler, E., Yasuda, T., Mastrobuoni, G., Friedel, C. C., Dölken, L., et al. (2015) · Nature Communications · doi:10.1038/ncomms8367 · Cited by 112 · see citing works
Self-citation
K63-Linked Ubiquitination in Kinase Activation and Cancer
Wang, G., Gao, Y., Li, L., Jin, G., Cai, Z., Chao, J. I., & Lin, H.-K. (2012) · Frontiers in Oncology · doi:10.3389/fonc.2012.00005 · Cited by 108 · see citing works
PARP inhibition protects mitochondria and reduces ROS production via PARP-1-ATF4-MKP-1-MAPK retrograde pathway
Hocsák, E., Szabó, V., Kálmán, N., Antus, C., Cseh, A. M., Sümegi, K., Erős, K., Hegedüs, Z., Gallyas, F., Sümegi, B., et al. (2017) · Free Radical Biology and Medicine · doi:10.1016/j.freeradbiomed.2017.04.018 · Cited by 110 · see citing works
A hypoxia-responsive TRAF6–ATM–H2AX signalling axis promotes HIF1α activation, tumorigenesis and metastasis
Rezaeian, A.-H., Li, C., Wu, C., Zhang, X., Delacerda, J., You, M. J., Han, F., Cai, Z., Jeong, Y. S., Jin, G., et al. (2016) · Nature Cell Biology · doi:10.1038/ncb3445 · Cited by 109 · see citing works
Inhibitors of apoptosis (IAPs) regulate intestinal immunity and inflammatory bowel disease (IBD) inflammation
Pedersen, J., LaCasse, E. C., Seidelin, J. B., Coskun, M., & Nielsen, O. H. (2014) · Trends in Molecular Medicine · doi:10.1016/j.molmed.2014.09.006 · Cited by 105 · see citing works
DNA damage-induced nuclear factor-kappa B activation and its roles in cancer progression
Wang, W., Mani, A. M., & Wu, Z. (2017) · Journal of Cancer Metastasis and Treatment · doi:10.20517/2394-4722.2017.03 · Cited by 109 · see citing works
USP10 inhibits genotoxic NF‐κB activation by MCPIP1‐facilitated deubiquitination of NEMO
Niu, J., Shi, Y., Xue, J., Miao, R., Huang, S., Wang, T., Wu, J., Fu, M., & Wu, Z. (2013) · The EMBO Journal · doi:10.1038/emboj.2013.247 · Cited by 104 · see citing works
TRAF Family Member-associated NF-κB Activator (TANK) Inhibits Genotoxic Nuclear Factor κB Activation by Facilitating Deubiquitinase USP10-dependent Deubiquitination of TRAF6 Ligase
Wang, W., Huang, X., Xin, H.-B., Fu, M., Xue, A., & Wu, Z. (2015) · Journal of Biological Chemistry · doi:10.1074/jbc.m115.643767 · Cited by 103 · see citing works
Role of poly(ADP‐ribose) polymerases in the regulation of inflammatory processes
Bai, P., & Virág, L. (2012) · FEBS Letters · doi:10.1016/j.febslet.2012.09.026 · Cited by 101 · see citing works
Opposing roles of NF-κB in anti-cancer treatment outcome unveiled by cross-species investigationsPreprint
Hua, J., Kase, J., Dörr, J. R., Milanovic, M., Lenze, D., Grau, M., Beuster, G., Ji, S., Reimann, M., Lenz, P., et al. (2011) · Genes & Development · doi:10.1101/gad.17620611 · Cited by 99 · see citing works
Self-citation
TAK1 regulates hepatic cell survival and carcinogenesis
Roh, Y. S., Song, J., & Seki, E. (2014) · Journal of Gastroenterology · doi:10.1007/s00535-013-0931-x · Cited by 95 · see citing works
Ubc13: the Lys63 ubiquitin chain building machine
Hodge, C. D., Spyracopoulos, L., & Glover, J. N. M. (2016) · Oncotarget · doi:10.18632/oncotarget.10948 · Cited by 93 · see citing works
Multifaceted roles of TAK1 signaling in cancer
Mukhopadhyay, H., & Lee, N. Y. (2019) · Oncogene · doi:10.1038/s41388-019-1088-8 · Cited by 91 · see citing works
Perturbing mitosis for anti‐cancer therapy: is cell death the only answer?
Haschka, M. D., Karbon, G., Fava, L. L., & Villunger, A. (2018) · EMBO Reports · doi:10.15252/embr.201745440 · Cited by 89 · see citing works
Aging and radiation: bad companions
Hernández, L., Terradas, M., Camps, J., Martı́n, M., Tusell, L., & Genescà, A. (2015) · Aging Cell · doi:10.1111/acel.12306 · Cited by 89 · see citing works
LUBAC, a novel ubiquitin ligase for linear ubiquitination, is crucial for inflammation and immune responses
Tokunaga, F., & Iwaï, K. (2012) · Microbes and Infection · doi:10.1016/j.micinf.2012.01.011 · Cited by 91 · see citing works
Reactive Oxygen Species (ROS)-Activated ATM-Dependent Phosphorylation of Cytoplasmic Substrates Identified by Large-Scale Phosphoproteomics Screen
Kozlov, S., Waardenberg, A. J., Engholm‐Keller, K., Arthur, J. W., Graham, M. E., & Lavin, M. F. (2016) · Molecular & Cellular Proteomics · doi:10.1074/mcp.m115.055723 · Cited by 89 · see citing works
Deciphering the role of Nuclear Factor-κB in cellular senescence
Vaughan, S., & Jat, P. (2011) · Aging · doi:10.18632/aging.100390 · Cited by 89 · see citing works
Linking JNK Activity to the DNA Damage Response
Picco, V., & Pagès, G. (2013) · Genes & Cancer · doi:10.1177/1947601913486347 · Cited by 84 · see citing works
Autophagy-dependent senescence in response to DNA damage and chronic apoptotic stress
Singh, K., Matsuyama, S., Drazba, J. A., & Almasan, A. (2012) · Autophagy · doi:10.4161/auto.8.2.18600 · Cited by 85 · see citing works
Two may be better than one: PD-1/PD-L1 blockade combination approaches in metastatic breast cancer
Page, D. B., Bear, H. D., Prabhakaran, S., Gatti-Mays, M. E., Thomas, A., Cobain, E. F., McArthur, H. L., Balko, J. M., Gameiro, S. R., Nanda, R., et al. (2019) · npj Breast Cancer · doi:10.1038/s41523-019-0130-x · Cited by 84 · see citing works
Linear ubiquitination-mediated NF- B regulation and its related disorders
Tokunaga, F. (2013) · The Journal of Biochemistry · doi:10.1093/jb/mvt079 · Cited by 83 · see citing works
Transcriptional repression of NFKBIA triggers constitutive IKK‐ and proteasome‐independent p65/RelA activation in senescence
Kolesnichenko, M., Mikuda, N., Höpken, U. E., Kärgel, E., Uyar, B., Tufan, A. B., Milanovic, M., Sun, W., Krahn, I., Schleich, K., et al. (2021) · The EMBO Journal · doi:10.15252/embj.2019104296 · Cited by 81 · see citing works
Self-citation
The Nucleoshuttling of the ATM Protein: A Unified Model to Describe the Individual Response to High- and Low-Dose of Radiation?
Berthel, É., Foray, N., & Ferlazzo, M. L. (2019) · Cancers · doi:10.3390/cancers11070905 · Cited by 80 · see citing works
NF-κB Induction of the SUMO Protease SENP2: A Negative Feedback Loop to Attenuate Cell Survival Response to Genotoxic Stress
Lee, M. H., Mabb, A. M., Gill, G., Yeh, E. T. H., & Miyamoto, S. (2011) · Molecular Cell · doi:10.1016/j.molcel.2011.06.017 · Cited by 79 · see citing works
TRAF6 Mediates Basal Activation of NF-κB Necessary for Hematopoietic Stem Cell Homeostasis
Fang, J., Muto, T., Kleppe, M., Bolanos, L. C., Hueneman, K. M., Walker, C. S., Sampson, L. L., Wellendorf, A. M., Chetal, K., Choi, K., et al. (2018) · Cell Reports · doi:10.1016/j.celrep.2018.01.013 · Cited by 78 · see citing works
Epithelial cell senescence: an adaptive response to pre-carcinogenic stresses?
Abbadie, C., Pluquet, O., & Pourtier, A. (2017) · Cellular and Molecular Life Sciences · doi:10.1007/s00018-017-2587-9 · Cited by 74 · see citing works
The DNA Damage Response Induced by Infection with Human Cytomegalovirus and Other Viruses
Xiaofei, E., & Kowalik, T. F. (2014) · Viruses · doi:10.3390/v6052155 · Cited by 75 · see citing works
ATM regulation of IL-8 links oxidative stress to cancer cell migration and invasion
Chen, W.-T., Ebelt, N. D., Stracker, T. H., Xhemalce, B., Van Den Berg, C. L., & Miller, K. M. (2015) · eLife · doi:10.7554/elife.07270 · Cited by 73 · see citing works
“The sequence for siNEMO is GGAAGAGCCAACUGUGUGAUU (Hinz et al., 2010).”
NF-κB-dependent MicroRNA-125b Up-regulation Promotes Cell Survival by Targeting p38α upon Ultraviolet Radiation
Tan, G., Niu, J., Shi, Y., Ouyang, H., & Wu, Z. (2012) · Journal of Biological Chemistry · doi:10.1074/jbc.m112.383273 · Cited by 71 · see citing works
HER2 Overexpression Renders Human Breast Cancers Sensitive to PARP Inhibition Independently of Any Defect in Homologous Recombination DNA Repair
Nowsheen, S., Cooper, T. S., Bonner, J. A., LoBuglio, A. F., & Yang, E. S.-H. (2012) · Cancer Research · doi:10.1158/0008-5472.can-12-1287 · Cited by 71 · see citing works
ATM regulates NF-κB-dependent immediate-early genes via RelA Ser 276 phosphorylation coupled to CDK9 promoter recruitment
Fang, L., Choudhary, S., Zhao, Y., Edeh, C. B., Yang, C., Boldogh, I. R., & Brasier, A. R. (2014) · Nucleic Acids Research · doi:10.1093/nar/gku529 · Cited by 70 · see citing works
Enhancing bone regeneration and immunomodulation via gelatin methacryloyl hydrogel-encapsulated exosomes from osteogenic pre-differentiated mesenchymal stem cells.
Li, X., Si, Y., Liang, J., Li, M., Wang, Z., Qin, Y., & Sun, L. (2024) · Journal of Colloid and Interface Science · doi:10.1016/j.jcis.2024.05.209 · Cited by 72 · see citing works
USP10 as a Potential Therapeutic Target in Human Cancers
Li, T., Liu, X., Jiang, X., Zhang, K., Wang, Y., Li, X., Jiang, S., & Han, T. (2022) · Genes · doi:10.3390/genes13050831 · Cited by 66 · see citing works
Interleukin 6 augments lung cancer chemotherapeutic resistance via ataxia‐telangiectasia mutated/ NF ‐kappaB pathway activation
Yan, H. Q., Huang, X. B., Ke, S. Z., Jiang, Y., Zhang, Y. H., Wang, Y. N., Li, J., & GAO, F. G. (2014) · Cancer Science · doi:10.1111/cas.12478 · Cited by 64 · see citing works
Role of the TWEAK-Fn14-cIAP1-NF-κB Signaling Axis in the Regulation of Myogenesis and Muscle Homeostasis
Enwere, E. K., LaCasse, E. C., Adam, N., & Korneluk, R. G. (2014) · Frontiers in Immunology · doi:10.3389/fimmu.2014.00034 · Cited by 62 · see citing works
Transcriptome-wide identification of the RNA-binding landscape of the chromatin-associated protein PARP1 reveals functions in RNA biogenesis
Melikishvili, M., Chariker, J. H., Rouchka, E. C., & Fondufe‐Mittendorf, Y. N. (2017) · Cell Discovery · doi:10.1038/celldisc.2017.43 · Cited by 62 · see citing works
Diversification of NAD biological role : the importance of location
Stefano, M. D., & Conforti, L. (2013) · FEBS Journal · doi:10.1111/febs.12433 · Cited by 61 · see citing works
The intricate interplay between RNA viruses and NF-κB
Schmitz, M. L., Kracht, M., & Saul, V. V. (2014) · Biochimica et Biophysica Acta (BBA) - Molecular Cell Research · doi:10.1016/j.bbamcr.2014.08.004 · Cited by 61 · see citing works
TAK -ing aim at chemoresistance: The emerging role of MAP3K7 as a target for cancer therapy
Santoro, R., Carbone, C., Piro, G., Chiao, P. J., & Melisi, D. (2017) · Drug Resistance Updates · doi:10.1016/j.drup.2017.10.004 · Cited by 61 · see citing works
When DNA-damage responses meet innate and adaptive immunity
Tong, J., Song, J., Zhang, W., Zhai, J., Guan, Q., Wang, H., Liu, G., & Zheng, C. (2024) · Cellular and Molecular Life Sciences · doi:10.1007/s00018-024-05214-2 · Cited by 63 · see citing works
IAP-Mediated Protein Ubiquitination in Regulating Cell Signaling
Dumétier, B., Zadoroznyj, A., & Dubrez, L. (2020) · Cells · doi:10.3390/cells9051118 · Cited by 60 · see citing works
Unlocking the NF-κB Conundrum: Embracing Complexity to Achieve Specificity
Begalli, F., Bennett, J., Capece, D., Verzella, D., D’Andrea, D., Tornatore, L., & Franzoso, G. (2017) · Biomedicines · doi:10.3390/biomedicines5030050 · Cited by 60 · see citing works
Emerging roles of Lys63‐linked polyubiquitylation in immune responses
Wu, X., & Karin, M. (2015) · Immunological Reviews · doi:10.1111/imr.12310 · Cited by 57 · see citing works
The Many Roles of Ubiquitin in NF-κB Signaling
Courtois, G., & Fauvarque, M. (2018) · Biomedicines · doi:10.3390/biomedicines6020043 · Cited by 58 · see citing works
Signals from the Nucleus: Activation of NF-κB by Cytosolic ATM in the DNA Damage Response
Hadian, K., & Krappmann, D. (2011) · Science Signaling · doi:10.1126/scisignal.2001712 · Cited by 57 · see citing works
Linear ubiquitination: A novel NF-κB regulatory mechanism for inflammatory and immune responses by the LUBAC ubiquitin ligase complex [Review]
Tokunaga, F., & Iwaï, K. (2012) · Endocrine Journal · doi:10.1507/endocrj.ej12-0148 · Cited by 56 · see citing works
IAP proteins: regulators of cell migration and development
Kenneth, N. S., & Duckett, C. S. (2012) · Current Opinion in Cell Biology · doi:10.1016/j.ceb.2012.11.004 · Cited by 56 · see citing works
No one can whistle a symphony alone – how different ubiquitin linkages cooperate to orchestrate NF-κB activity
Schmukle, A. C., & Walczak, H. (2012) · Journal of Cell Science · doi:10.1242/jcs.091793 · Cited by 56 · see citing works
DNA damage response in vascular endothelial senescence: Implication for radiation-induced cardiovascular diseases
Nagane, M., Yasui, H., Kuppusamy, P., Yamashita, T., & Inanami, O. (2021) · Journal of Radiation Research · doi:10.1093/jrr/rrab032 · Cited by 55 · see citing works
Tumor suppressive effect of PARP1 and FOXO3A in gastric cancers and its clinical implications
Park, S., Jang, K. Y., Kim, M. J., Yoon, S., Jo, Y., Kwon, S. M., Kim, K. M., Kwon, K. S., Kim, C. Y., & Woo, H. G. (2015) · Oncotarget · doi:10.18632/oncotarget.6264 · Cited by 55 · see citing works
Poly(ADP-Ribose)Polymerase-1 in Lung Inflammatory Disorders: A Review
Sethi, G. S., Dharwal, V., & Naura, A. S. (2017) · Frontiers in Immunology · doi:10.3389/fimmu.2017.01172 · Cited by 53 · see citing works

Signals from the Nucleus: Activation of NF-κB by Cytosolic ATM in the DNA Damage Response
Hadian, K., & Krappmann, D. (2011) · Science Signaling · doi:10.1126/scisignal.2001712 · Cited by 57 · see citing works
A nuclear poly(ADP-Ribose)-dependent signalosome confers DNA damage-induced IκB kinase activation.
Stilmann, M., Hinz, M., Arslan, S. Ç., Zimmer, A., Schreiber, V., & Scheidereit, C. (2009) · Molecular Cell · doi:10.1016/j.molcel.2009.09.032 · Cited by 232 · see citing works
Self-citation
ATM- and NEMO-Dependent ELKS Ubiquitination Coordinates TAK1-Mediated IKK Activation in Response to Genotoxic Stress
Wu, Z.-H., Wong, E. T., Shi, Y., Niu, J., Chen, Z. J., Miyamoto, S., & Tergaonkar, V. (2010) · Molecular Cell · doi:10.1016/j.molcel.2010.09.010 · Cited by 207 · see citing works
Molecular Linkage Between the Kinase ATM and NF-κB Signaling in Response to Genotoxic Stimuli
Wu, Z., Shi, Y., Tibbetts, R. S., & Miyamoto, S. (2006) · Science · doi:10.1126/science.1121513 · Cited by 515 · see citing works
Sumoylating NEMO
(2003) · Science s STKE · doi:10.1126/stke.2112003tw464

Authors: Hinz, M., Stilmann, M., Arslan, S. Ç., Khanna, K. K., Dittmar, G., & Scheidereit, C.
Affiliations: Max Delbrück Center (DE)
QIMR Berghofer Medical Research Institute (AU)
Corresponding author: Scheidereit, Claus
ORCID: Khanna, Kum Kum
Dittmar, Gunnar
Scheidereit, Claus
Venue: Molecular Cell
Publisher: Elsevier BV
Published: 2010-10
Volume: 40
Issue: 1
Pages: 63-74
ISSN: 1097-2765 (ISSN-L)
DOI: 10.1016/j.molcel.2010.09.008
OpenAlex: W2083922442
Cited by: 280
References: 42
Citations by year: 2026: 11 · 2025: 7 · 2024: 17 · 2023: 10 · 2022: 19 · 2021: 21 · 2020: 18 · 2019: 13 · 2018: 16 · 2017: 18 · 2016: 9 · 2015: 12 · 2014: 20 · 2013: 21 · 2012: 44
FWCI: 8.97
Type: journal article
Language: en
Open access: bronze
doi.org
Licence: www.elsevier.com/tdm/userlicense/1.0/ (tdm)
www.elsevier.com/legal/tdmrep-license (tdm)
www.elsevier.com/open-access/userlicense/1.0/ (vor, 1056 d)
doi.org/10.15223/policy-017 (stm-asf)
doi.org/10.15223/policy-037 (stm-asf)
doi.org/10.15223/policy-012 (stm-asf)
doi.org/10.15223/policy-029 (stm-asf)
doi.org/10.15223/policy-004 (stm-asf)
Locations: Molecular Cell (publishedVersion)
PubMed (publishedVersion)
MDC Repository (Max-Delbrueck-Center for Molecular Medicine) (submittedVersion)
Topics: Life Sciences › Biochemistry, Genetics and Molecular Biology › Cancer Research › NF-κB Signaling Pathways
Life Sciences › Biochemistry, Genetics and Molecular Biology › Molecular Biology › DNA Repair Mechanisms
Life Sciences › Biochemistry, Genetics and Molecular Biology › Molecular Biology › Genomics and Chromatin Dynamics
Keywords: ATM kinase, TRAF6, cIAP1, NF-κB activation, DNA damage signaling, genotoxic stress response, PARP1, K63-linked ubiquitination, Ubc13, SUMOylation, PIASy, TAB2, TAK1, IKK complex
MeSH terms: Poly (ADP-Ribose) Polymerase-1, MAP Kinase Kinase Kinase 7, Calcium, Cell Nucleus, Cytosol, DNA Damage, DNA-Binding Proteins, HeLa Cells, Humans, Mutation, Phosphorylation, Poly(ADP-ribose) Polymerases, Protein Binding, Recombinant Proteins, Time Factors, Transfection, Tumor Necrosis Factor-alpha, Signal Transduction, NF-kappa B, Protein Serine-Threonine Kinases, Cell Cycle Proteins, MAP Kinase Kinase Kinases, Protein Transport, Tumor Suppressor Proteins, Ubiquitin, RNA Interference, Ubiquitin-Conjugating Enzymes, Ubiquitin-Protein Ligases, TNF Receptor-Associated Factor 6, Adaptor Proteins, Signal Transducing, Inhibitor of Apoptosis Proteins, I-kappa B Kinase, DNA Breaks, Double-Stranded, Ubiquitination, Hep G2 Cells, Ataxia Telangiectasia Mutated Proteins

About these checks

Registry, retraction, Cites and statistics results are computed, not judged, with one exception: a printed reference that no index lists is read once by a model before it counts as a citation error. Claims are extracted by a model and kept only when their quote appears verbatim in the text; each cited source is then checked, with a model’s help, for whether it says what the claim relies on. Those verdicts can be wrong — read the claim’s quote and the cited source before relying on one.

Statistics and arithmetic are recomputed, not judged.

Confidence bands are shown only for fields calibrated on our annotated test set. None is calibrated yet, so no band is shown.

What counts as a claim ›How we measure confidence ›How we check this ›

Are you an author, or do you see a problem with this page? Request a review

A Cytoplasmic ATM-TRAF6-cIAP1 Module Links Nuclear DNA Damage Signaling to Ubiquitin-Mediated NF-κB Activation

Abstract

Integrity signals

Claims the paper makes

Claims other papers make about this one

Cites

Cited by

Related

Record

About these checks