ATM regulation of IL-8 links oxidative stress to cancer cell migration and invasion
Open accessAbstract
Ataxia-telangiectasia mutated (ATM) protein kinase regulates the DNA damage response (DDR) and is associated with cancer suppression. Here we report a cancer-promoting role for ATM. ATM depletion in metastatic cancer cells reduced cell migration and invasion. Transcription analyses identified a gene network, including the chemokine IL-8, regulated by ATM. IL-8 expression required ATM and was regulated by oxidative stress. IL-8 was validated as an ATM target by its ability to rescue cell migration and invasion defects in ATM-depleted cells. Finally, ATM-depletion in human breast cancer cells reduced lung tumors in a mouse xenograft model and clinical data validated IL-8 in lung metastasis. These findings provide insights into how ATM activation by oxidative stress regulates IL-8 to sustain cell migration and invasion in cancer cells to promote metastatic potential. Thus, in addition to well-established roles in tumor suppression, these findings identify a role for ATM in tumor progression.
The claims and statistics of this paper haven’t been checked yet.
Run the check — free, no account needed. It reads the open-access text and checks the sources it cites.
Integrity signals
Registry
Cites
Statistics
Claims the paper makes
The claims and statistics of this paper haven’t been checked yet.
Run the check — free, no account needed. It reads the open-access text and checks the sources it cites.
Claims other papers make about this one
Each is checked against this paper’s own text: does it say what the citing paper says it does?
ATM drives IL8 secretion by breast cancer cells independently of its DNA damage response role, promoting disease progression through autocrine or paracrine mechanisms.
“similar lines, ATM reportedly drives IL8 secretion by breast cancer cells independently of its role in the DDR, ultimately favoring disease progression via autocrine or paracrine mechanisms (Chen et al., 2015).”
From Immunomodulation by targeted anticancer agents (2021) · cites this paper as Chen et al., 2015
Self-check
Percentages, sums and reported differences re-computed from the paper’s own numbers.
The self-check needs the paper’s full text.
Cites
Hallmarks of Cancer: The Next Generation
Hanahan, D., & Weinberg, R. A. (2011) · Cell · doi:10.1016/j.cell.2011.02.013 · Cited by 66,590 · see citing works
Systematic and integrative analysis of large gene lists using DAVID bioinformatics resources
Huang, D. W., Sherman, B. T., & Lempicki, R. A. (2009) · Nature Protocols · doi:10.1038/nprot.2008.211 · Cited by 35,890 · cited 1× · see citing works
“GO analysis was analyzed using the ‘Functional Annotation Tool’ in DAVID (http://david.abcc.ncifcrf.gov/home.jsp) and biological process terms are shown (Huang da et al., 2009).”
MethodThe DNA-damage response in human biology and disease
Jackson, S. P., & Bartek, J. (2009) · Nature · doi:10.1038/nature08467 · Cited by 6,092 · cited 1× · see citing works
“These cancer therapies activate complex signaling networks, termed the DNA damage response (DDR), that detect and signal the presence of DNA damage to promote cell cycle arrest and DNA repair (Jackson and Bartek, 2009; Ciccia and Elledge, 2010).”
BackgroundThe senescence-associated secretory phenotype: the dark side of tumor suppression
Coppé, J.-P., Desprez, P.-Y., Krtolica, A., & Campisi, J. (2010) · Annual Review of Pathology: Mechanisms of Disease · doi:10.1146/annurev-pathol-121808-102144 · Cited by 5,206 · cited 2× · see citing works
“ATM is known to regulate several pro-inflammatory cytokines as part of a senescence-associated secretory phenotype (SASP) in senescent cells (Rodier et al., 2009; Coppe et al., 2010).”
BackgroundThe DNA Damage Response: Making It Safe to Play with Knives
Ciccia, A., & Elledge, S. J. (2010) · Molecular Cell · doi:10.1016/j.molcel.2010.09.019 · Cited by 4,368 · see citing works
Tumor Metastasis: Molecular Insights and Evolving Paradigms
Valastyan, S., & Weinberg, R. A. (2011) · Cell · doi:10.1016/j.cell.2011.09.024 · Cited by 4,011 · see citing works
DNA damage activates ATM through intermolecular autophosphorylation and dimer dissociation
Bakkenist, C. J., & Kastan, M. B. (2003) · Nature · doi:10.1038/nature01368 · Cited by 3,466 · cited 1× · see citing works
“DOI: 10.7554/eLife.07270.001”
InfluentialThe complexity of NF-κB signaling in inflammation and cancer
Hoesel, B., & Schmid, J. A. (2013) · Molecular Cancer · doi:10.1186/1476-4598-12-86 · Cited by 3,194 · cited 1× · see citing works
“Both ATM and p53 are known to be required for NF-κB localization and activation in the nucleus upon various stimuli including cellular stress (Wuerzberger-Davis et al., 2007; Hoesel and Schmid, 2013).”
BackgroundATM and ATR Substrate Analysis Reveals Extensive Protein Networks Responsive to DNA Damage
Matsuoka, S., Ballif, B. A., Smogorzewska, A., McDonald, E. R., Hurov, K. E., Luo, J., Bakalarski, C. E., Zhao, Z., Solimini, N., Lerenthal, Y., et al. (2007) · Science · doi:10.1126/science.1140321 · Cited by 3,075 · cited 16× · see citing works
“The IL-8 promoter contains many transcription factor binding sites, including NF-κB, which regulates IL-8 expression and is linked to the DDR through ATM activation by DSBs (Mukaida et al., 1990; Biton and Ashkenazi, 2011; McCool and Miyamoto, 2012).”
BackgroundInfluentialGenes that mediate breast cancer metastasis to lung
Minn, A. J., Gupta, G. P., Siegel, P. M., Bos, P. D., Shu, W., Giri, D. D., Viale, A., Olshen, A. B., Gerald, W. L., & Massagué, J. (2005) · Nature · doi:10.1038/nature03799 · Cited by 2,922 · cited 2× · see citing works
“Analysis of breast cancer patient gene expression data Publically available breast cancer patient gene expression data from GEO was pooled (GSE2603, GSE2034, GSE5327, and GSE12276) as previously described (Minn et al., 2005; Barrett et al., 2007; Morales et al., 2014).”
MethodDNA damage response as a candidate anti-cancer barrier in early human tumorigenesis
Bartkova, J., Hořejší, Z., Koed, K., Krämer, A., Tort, F., Zieger, K., Guldberg, P., Sehested, M., Nesland, J. M., Lukas, C., et al. (2005) · Nature · doi:10.1038/nature03482 · Cited by 2,688 · cited 2× · see citing works
“…tumor suppressive anti-cancer barriers to limit proliferation in response to, and in the presence of, DNA damage (Norbury and Zhivotovsky, 2004; Bartkova et al., 2005; Gorgoulis et al., 2005; Bartkova et al., 2006; Di Micco et al., 2006; Vousden and Lane, 2007; Sherman et al., 2011; Roos and…”
BackgroundVousden, K. H., & Lane, D. P. (2007) · Nature Reviews Molecular Cell Biology · doi:10.1038/nrm2147 · Cited by 2,275 · see citing works
Persistent DNA damage signalling triggers senescence-associated inflammatory cytokine secretion
Rodier, F., Coppé, J.-P., Patil, C. K., Hoeijmakers, W. A. M., Muñoz, D. P., Raza, S. R., Freund, A., Campeau, E., Davalos, A. R., & Campisi, J. (2009) · Nature Cell Biology · doi:10.1038/ncb1909 · Cited by 2,232 · see citing works
Interleukin-8 as a macrophage-derived mediator of angiogenesis
Koch, A. E., Polverini, P. J., Kunkel, S. L., Harlow, L. A., DiPietro, L. A., Elner, V. M., Elner, S. G., & Strieter, R. M. (1992) · Science · doi:10.1126/science.1281554 · Cited by 2,135 · cited 1× · see citing works
“Our results provide additional insights into other disease pathways involving ATM including angiogenesis, a pathway triggered by oxidative stress and dependent on IL-8 (Koch et al., 1992; Okuno et al., 2012).”
ResultThe Interleukin-8 Pathway in Cancer
Waugh, D. J. J., & Wilson, C. (2008) · Clinical Cancer Research · doi:10.1158/1078-0432.ccr-07-4843 · Cited by 2,103 · cited 1× · see citing works
“Inhibitors of the IL-8 pathway are actively being developed and evaluated in pre-clinical studies and clinical trials for cancer and inflammatory diseases (Waugh and Wilson, 2008; Singh et al., 2013).”
BackgroundActivation of the DNA damage checkpoint and genomic instability in human precancerous lesions
Gorgoulis, V. G., Vassiliou, L.-V. F., Karakaidos, P., Zacharatos, P., Kotsinas, A., Liloglou, T., Venere, M., DiTullio, R. A., Kastrinakis, N. G., Levy, B., et al. (2005) · Nature · doi:10.1038/nature03485 · Cited by 2,009 · cited 2× · see citing works
“…anti-cancer barriers to limit proliferation in response to, and in the presence of, DNA damage (Norbury and Zhivotovsky, 2004; Bartkova et al., 2005; Gorgoulis et al., 2005; Bartkova et al., 2006; Di Micco et al., 2006; Vousden and Lane, 2007; Sherman et al., 2011; Roos and Kaina, 2013).”
BackgroundOncogene-induced senescence is part of the tumorigenesis barrier imposed by DNA damage checkpoints
Bartkova, J., Rezaei, N., Liontos, M., Karakaidos, P., Kletsas, D., Issaeva, N., Vassiliou, L.-V. F., Kolettas, E., Niforou, K., Zoumpourlis, V. C., et al. (2006) · Nature · doi:10.1038/nature05268 · Cited by 1,986 · cited 2× · see citing works
“…anti-cancer barriers to limit proliferation in response to, and in the presence of, DNA damage (Norbury and Zhivotovsky, 2004; Bartkova et al., 2005; Gorgoulis et al., 2005; Bartkova et al., 2006; Di Micco et al., 2006; Vousden and Lane, 2007; Sherman et al., 2011; Roos and Kaina, 2013).”
BackgroundCrosstalk in NF-κB Signaling Pathways
Oeckinghaus, A., Hayden, M. S., & Ghosh, S. (2011) · Nature Immunology · doi:10.1038/ni.2065 · Cited by 1,942 · cited 1× · see citing works
“NF-κB signaling regulates inflammation and is involved in cancer where it has been associated, like p53, with both anti and pro-tumorigenic processes (Ben-Neriah and Karin, 2011; Oeckinghaus et al., 2011).”
BackgroundCancer Invasion and the Microenvironment: Plasticity and Reciprocity
Friedl, P., & Alexander, S. (2011) · Cell · doi:10.1016/j.cell.2011.11.016 · Cited by 1,940 · cited 1× · see citing works
“(Friedl and Alexander, 2011; Hanahan and Weinberg, 2011; Valastyan and Weinberg, 2011).”
Transcriptional control of human p53-regulated genes
Riley, T., Sontag, E., Chen, P., & Levine, A. (2008) · Nature Reviews Molecular Cell Biology · doi:10.1038/nrm2395 · Cited by 1,921 · cited 1× · see citing works
“Given the role of mutant p53 in transcriptional regulation, we hypothesized that ATM could similarly regulate the expression of genes involved in cell migration (Riley et al., 2008; Shiloh and Ziv, 2013).”
BackgroundMetastasis: a question of life or death
Mehlen, P., & Puisieux, A. (2006) · Nature reviews. Cancer · doi:10.1038/nrc1886 · Cited by 1,854 · cited 1× · see citing works
“Several pathways suppress this dangerous process as part of tumor suppressive mechanisms (Mehlen and Puisieux, 2006).”
BackgroundAn Oncogene-Induced DNA Damage Model for Cancer Development
Halazonetis, T. D., Gorgoulis, V. G., & Bartek, J. (2008) · Science · doi:10.1126/science.1140735 · Cited by 1,851 · cited 2× · see citing works
“Although the role of DNA damage and the DDR in this process has not been extensively explored experimentally, increased genomic instability due to the acquisition of DDR defects has been proposed to play a role in the acquisition of these traits based on human patient data (Halazonetis et al., 2008).”
BackgroundThe DNA damage response and cancer therapy
Lord, C. J., & Ashworth, A. (2012) · Nature · doi:10.1038/nature10760 · Cited by 1,843 · cited 1× · see citing works
“Cancer treatments rely heavily on DNA damaging agents, including radiation and chemotherapeutics, to eliminate cancer cells and decrease tumor burden (Begg et al., 2011; Lord and Ashworth, 2012; Cheung-Ong et al., 2013).”
BackgroundOncogene-induced senescence is a DNA damage response triggered by DNA hyper-replication
Di Micco, R., Fumagalli, M., Cicalese, A., Piccinin, S., Gasparini, P., Luise, C., Schurra, C., Garre’, M., Giovanni Nuciforo, P., Bensimon, A., et al. (2006) · Nature · doi:10.1038/nature05327 · Cited by 1,821 · cited 1× · see citing works
“…anti-cancer barriers to limit proliferation in response to, and in the presence of, DNA damage (Norbury and Zhivotovsky, 2004; Bartkova et al., 2005; Gorgoulis et al., 2005; Bartkova et al., 2006; Di Micco et al., 2006; Vousden and Lane, 2007; Sherman et al., 2011; Roos and Kaina, 2013).”
BackgroundNF-κB, the first quarter-century: remarkable progress and outstanding questions
Hayden, M. S., & Ghosh, S. (2012) · Genes & Development · doi:10.1101/gad.183434.111 · Cited by 1,693 · cited 1× · see citing works
“Nuclear localization of the p50/p65 NF-κB dimer enables transcriptional activation of this complex so we analyzed p65 nuclear accumulation as a readout of NF-κB localization (Hayden and Ghosh, 2012).”
MethodThe ATM protein kinase: regulating the cellular response to genotoxic stress, and more
Shiloh, Y., & Ziv, Y. (2013) · Nature Reviews Molecular Cell Biology · doi:10.1038/nrm3546 · Cited by 1,649 · cited 7× · see citing works
“…as its deletion in mice results in tumors, patients with mutations in ATM in the human disorder Ataxia telangiectasia have increased cancer risks, and several hematological cancers have been reported to express defective ATM (Cremona and Behrens, 2013; Shiloh and Ziv, 2013; Stracker et al., 2013).”
BackgroundInfluentialMuller, P. A. J., & Vousden, K. H. (2013) · Nature Cell Biology · doi:10.1038/ncb2641 · Cited by 1,647 · see citing works
NCBI GEO: mining tens of millions of expression profiles--database and tools update
Barrett, T., Troup, D. B., Wilhite, S. E., Ledoux, P., Rudnev, D., Evangelista, C., Kim, I. F., Soboleva, A., Tomashevsky, M., & Edgar, R. (2006) · Nucleic Acids Research · doi:10.1093/nar/gkl887 · Cited by 1,524 · cited 2× · see citing works
“Analysis of breast cancer patient gene expression data Publically available breast cancer patient gene expression data from GEO was pooled (GSE2603, GSE2034, GSE5327, and GSE12276) as previously described (Minn et al., 2005; Barrett et al., 2007; Morales et al., 2014).”
MethodATM Activation by DNA Double-Strand Breaks Through the Mre11-Rad50-Nbs1 Complex
Lee, J.-H., & Paull, T. T. (2005) · Science · doi:10.1126/science.1108297 · Cited by 1,424 · cited 1× · see citing works
“DOI: 10.7554/eLife.07270.001”
InfluentialUnravelling mechanisms of p53-mediated tumour suppression
Bieging-Rolett, K. T., Mello, S. S., & Attardi, L. D. (2014) · Nature reviews. Cancer · doi:10.1038/nrc3711 · Cited by 1,389 · cited 2× · see citing works
“DOI: 10.7554/eLife.07270 1 of 21 signals and promotes tumor suppressor pathways (Bieging et al., 2014).”
BackgroundInfluentialInflammation meets cancer, with NF-κB as the matchmaker
Ben‐Neriah, Y., & Karin, M. (2011) · Nature Immunology · doi:10.1038/ni.2060 · Cited by 1,378 · cited 1× · see citing works
“NF-κB signaling regulates inflammation and is involved in cancer where it has been associated, like p53, with both anti and pro-tumorigenic processes (Ben-Neriah and Karin, 2011; Oeckinghaus et al., 2011).”
BackgroundRegulation of oxidative stress by ATM is required for self-renewal of haematopoietic stem cells
Ito, K., Hirao, A., Arai, F., Matsuoka, S., Takubo, K., Hamaguchi, I., Nomiyama, K., Hosokawa, K., Sakurada, K., Nakagata, N., et al. (2004) · Nature · doi:10.1038/nature02989 · Cited by 1,175 · cited 2× · see citing works
“…to ROS and many of these pathologies can be reversed by the addition of antioxidants, highlighting the important role of ATM in regulating redoxhomeostasis (Ito et al., 2004; Reliene and Schiestl, 2006, 2007; Reliene et al., 2008; Freund et al., 2011; Okuno et al., 2012; D’Souza et al., 2013).”
BackgroundStrategies to improve radiotherapy with targeted drugs
Begg, A. C., Stewart, F. A., & Vens, C. (2011) · Nature reviews. Cancer · doi:10.1038/nrc3007 · Cited by 1,115 · cited 1× · see citing works
“Cancer treatments rely heavily on DNA damaging agents, including radiation and chemotherapeutics, to eliminate cancer cells and decrease tumor burden (Begg et al., 2011; Lord and Ashworth, 2012; Cheung-Ong et al., 2013).”
BackgroundATM Activation by Oxidative Stress
Guo, Z., Kozlov, S., Lavin, M. F., Person, M. D., & Paull, T. T. (2010) · Science · doi:10.1126/science.1192912 · Cited by 1,079 · cited 10× · see citing works
“The SASP can be mediated by DNA damage induced ATM signaling through MRN and CHK2, but not p53.”
BackgroundInfluentialFreund, A., Patil, C. K., & Campisi, J. (2011) · The EMBO Journal · doi:10.1038/emboj.2011.69 · Cited by 1,039 · cited 4× · see citing works
“In addition, a role for p38 MAPK in the SASP has been defined that is independent of the initial ATM-dependent damage response (Freund et al., 2011).”
BackgroundInfluentialOxidative Stress and Oxidative Damage in Carcinogenesis
Klaunig, J. E., Kamendulis, L. M., & Hocevar, B. A. (2009) · Toxicologic Pathology · doi:10.1177/0192623309356453 · Cited by 960 · cited 1× · see citing works
“However, cancer cells exhibit genome instability (Hanahan and Weinberg, 2011) and often contain endogenous oxidative and replicative damage that can promote genetic alterations to drive malignant transformation (Klaunig et al., 2010; Hills and Diffley, 2014).”
BackgroundDNA damage-induced cell death: From specific DNA lesions to the DNA damage response and apoptosis
Roos, W. P., & Kaina, B. (2013) · Cancer Letters · doi:10.1016/j.canlet.2012.01.007 · Cited by 879 · cited 2× · see citing works
“…anti-cancer barriers to limit proliferation in response to, and in the presence of, DNA damage (Norbury and Zhivotovsky, 2004; Bartkova et al., 2005; Gorgoulis et al., 2005; Bartkova et al., 2006; Di Micco et al., 2006; Vousden and Lane, 2007; Sherman et al., 2011; Roos and Kaina, 2013).”
BackgroundA Mutant-p53/Smad Complex Opposes p63 to Empower TGFβ-Induced Metastasis
Adorno, M., Cordenonsi, M., Montagner, M., Dupont, S., Wong, C., Hann, B. C., Solari, A., Bobisse, S., Rondina, M. B., Guzzardo, V., et al. (2009) · Cell · doi:10.1016/j.cell.2009.01.039 · Cited by 783 · cited 1× · see citing works
“However, p53 is phosphorylated by ATM after oxidative stress and mutant p53 is involved in TGFβ-dependent cell migration in MDA-MB-231 cells (Adorno et al., 2009; Guo et al., 2010).”
BackgroundATM signals to TSC2 in the cytoplasm to regulate mTORC1 in response to ROS
Alexander, A., Cai, S.-L., Kim, J., Nanez, A., Sahin, M., MacLean, K. H., Inoki, K., Guan, K.-L., Shen, J., Person, M. D., et al. (2010) · Proceedings of the National Academy of Sciences · doi:10.1073/pnas.0913860107 · Cited by 717 · cited 1× · see citing works
“Aside from increased tumorigenesis, ATM-deficiency results in altered metabolism, aberrant immune and inflammatory responses and increased levels of reactive oxygen species (ROS, Schneider et al., 2006; Alexander et al., 2010; Freund et al., 2011; Kulinski et al., 2012; Valentin-Vega et al., 2012).”
BackgroundNorbury, C. J., & Zhivotovsky, B. (2004) · Oncogene · doi:10.1038/sj.onc.1207532 · Cited by 701 · cited 2× · see citing works
“…on ATM and/or p53 to enforce tumor suppressive anti-cancer barriers to limit proliferation in response to, and in the presence of, DNA damage (Norbury and Zhivotovsky, 2004; Bartkova et al., 2005; Gorgoulis et al., 2005; Bartkova et al., 2006; Di Micco et al., 2006; Vousden and Lane, 2007;…”
BackgroundMukaida, N., Mahé, Y. F., & Matsushima, K. (1990) · Journal of Biological Chemistry · doi:10.1016/s0021-9258(17)45336-1 · Cited by 639 · cited 8× · see citing works
“The IL-8 promoter contains many transcription factor binding sites, including NF-κB, which regulates IL-8 expression and is linked to the DDR through ATM activation by DSBs (Mukaida et al., 1990; Biton and Ashkenazi, 2011; McCool and Miyamoto, 2012).”
BackgroundInfluentialTScratch: a novel and simple software tool for automated analysis of monolayer wound healing assays
Gebäck, T., Schulz, M. M. P., Koumoutsakos, P., & Detmar, M. J. (2009) · BioTechniques · doi:10.2144/000113083 · Cited by 624 · cited 1× · see citing works
“Representative pictures were from three independent experiments and quantified by using TScratch software (Geback et al., 2009).”
MethodThe effects of deregulated DNA damage signalling on cancer chemotherapy response and resistance
Bouwman, P., & Jonkers, J. (2012) · Nature Reviews Cancer · doi:10.1038/nrc3342 · Cited by 615 · cited 2× · see citing works
“Defects in DDR genes and DNA damage signaling affect cellular responses to chemotherapeutic drugs in some cancer cells (Bouwman and Jonkers, 2012).”
BackgroundDNA-Damaging Agents in Cancer Chemotherapy: Serendipity and Chemical Biology
Cheung-Ong, K., Giaever, G. N., & Nislow, C. (2013) · Chemistry & Biology · doi:10.1016/j.chembiol.2013.04.007 · Cited by 585 · cited 1× · see citing works
“Cancer treatments rely heavily on DNA damaging agents, including radiation and chemotherapeutics, to eliminate cancer cells and decrease tumor burden (Begg et al., 2011; Lord and Ashworth, 2012; Cheung-Ong et al., 2013).”
BackgroundMolecular Linkage Between the Kinase ATM and NF-κB Signaling in Response to Genotoxic Stimuli
Wu, Z., Shi, Y., Tibbetts, R. S., & Miyamoto, S. (2006) · Science · doi:10.1126/science.1121513 · Cited by 515 · cited 1× · see citing works
“NF-κB signaling can be regulated by ATM through the phosphorylation of NEMO, which aids in transmitting nuclear ATM signaling to activate NF-κB in the cytoplasm (Wu et al., 2006).”
BackgroundDNA Replication and Oncogene-Induced Replicative Stress
Hills, S. A., & Diffley, J. F. X. (2014) · Current Biology · doi:10.1016/j.cub.2014.04.012 · Cited by 381 · see citing works
Mitochondrial dysfunction in ataxia-telangiectasia
Valentin-Vega, Y. A., MacLean, K. H., Tait-Mulder, J., Milasta, S., Steeves, M., Dorsey, F. C., Cleveland, J. L., Green, D. R., & Kastan, M. B. (2012) · Blood · doi:10.1182/blood-2011-08-373639 · Cited by 365 · cited 2× · see citing works
“In addition, ATM can be directly activated by ROS, independently from DSB signaling, and has been implicated in mitochondrial quality control, potentially through an ability to localize to mitochondria (Guo et al., 2010; Valentin-Vega et al., 2012).”
BackgroundCoppé, J.-P., Patil, C. K., Rodier, F., Sun, Y., Muñoz, D. P., Goldstein, J., Nelson, P. S., Desprez, P.-Y., & Campisi, J. (2008) · PLoS Biology · doi:10.1371/journal.pbio.0060301 · Cited by 302 · cited 1× · see citing works
“Senescent cells are thought to promote tumor progression in the microenvironment through paracrine signaling by secreted pro-inflammatory factors including cytokines (Coppe et al., 2008, 2010).”
BackgroundLee, Y. S., Choi, I., Ning, Y., Kim, N., Khatchadourian, V., Yang, D., Chung, H. K., Choi, D., LaBonte, M. J., Ladner, R. D., et al. (2012) · British Journal of Cancer · doi:10.1038/bjc.2012.177 · Cited by 292 · cited 2× · see citing works
“However, our identification for a requirement of ATM to promote IL-8 expression, cell migration and invasion in vitro, as well as the association of increased levels of IL-8 with the metastatic potential of several cancer types, including colon cancer and melanoma (Lee et al., 2012; Wu et al., 2012), prompted us to ev…”
BackgroundWilliams, T. M., Medina, F. A., Badano, I., Hazan, R. B., Hutchinson, J. N., Muller, W. J., Chopra, N. G., Scherer, P. E., Pestell, R. G., & Lisanti, M. P. (2004) · Journal of Biological Chemistry · doi:10.1074/jbc.m409214200 · Cited by 280 · cited 1× · see citing works
“Mouse lungs were perfused with India ink to quantify metastatic lesions as previously reported (Williams et al., 2004).”
MethodHinz, M., Stilmann, M., Arslan, S. Ç., Khanna, K. K., Dittmar, G., & Scheidereit, C. (2010) · Molecular Cell · doi:10.1016/j.molcel.2010.09.008 · Cited by 280 · cited 1× · see citing works
“The sequence for siNEMO is GGAAGAGCCAACUGUGUGAUU (Hinz et al., 2010).”
Osorio, F. G., Bárcena, C., Soria-Valles, C., Ramsay, A. J., de Carlos, F., Cobo, J., Fueyo, A., Freije, J. M. P., & López-Otín, C. (2012) · Genes & Development · doi:10.1101/gad.197954.112 · Cited by 276 · cited 1× · see citing works
“In addition, based on our study and those of others, ATM inhibition could also be efficacious in the setting of other diseases involving oxidative stress and proinflammatory cytokines including inflammation, angiogenesis and aging (Osorio et al., 2012; Okuno et al., 2012).”
BackgroundATM-Dependent and -Independent Dynamics of the Nuclear Phosphoproteome After DNA Damage
Bensimon, A., Schmidt, A., Ziv, Y., Elkon, R., Wang, S., Chen, D. J., Aebersold, R. H., & Shiloh, Y. (2010) · Science Signaling · doi:10.1126/scisignal.2001034 · Cited by 275 · cited 2× · see citing works
“While DSBs trigger ATM-dependent phosphorylation of more than 1000 proteins (Matsuoka et al., 2007; Bennetzen et al., 2010; Bensimon et al., 2010), very few targets of ATM in response to other types of damage, including oxidative stress, are known (Guo et al.”
BackgroundInfluentialNEMO and RIP1 Control Cell Fate in Response to Extensive DNA Damage via TNF-α Feedforward Signaling
Biton, S., & Ashkenazi, A. (2011) · Cell · doi:10.1016/j.cell.2011.02.023 · Cited by 262 · cited 1× · see citing works
“The IL-8 promoter contains many transcription factor binding sites, including NF-κB, which regulates IL-8 expression and is linked to the DDR through ATM activation by DSBs (Mukaida et al., 1990; Biton and Ashkenazi, 2011; McCool and Miyamoto, 2012).”
BackgroundDNA damage‐dependent NF‐κB activation: NEMO turns nuclear signaling inside out
McCool, K. W., & Miyamoto, S. (2012) · Immunological Reviews · doi:10.1111/j.1600-065x.2012.01101.x · Cited by 251 · cited 1× · see citing works
“The IL-8 promoter contains many transcription factor binding sites, including NF-κB, which regulates IL-8 expression and is linked to the DDR through ATM activation by DSBs (Mukaida et al., 1990; Biton and Ashkenazi, 2011; McCool and Miyamoto, 2012).”
BackgroundRecent advances reveal IL-8 signaling as a potential key to targeting breast cancer stem cells
Singh, J. K., Simões, B. M., Howell, S. J., Farnie, G., & Clarke, R. B. (2013) · Breast Cancer Research · doi:10.1186/bcr3436 · Cited by 250 · cited 2× · see citing works
“Inhibitors of the IL-8 pathway are actively being developed and evaluated in pre-clinical studies and clinical trials for cancer and inflammatory diseases (Waugh and Wilson, 2008; Singh et al., 2013).”
BackgroundDai, Y., Rahmani, M., Dent, P., & Grant, S. (2005) · Molecular and Cellular Biology · doi:10.1128/mcb.25.13.5429-5444.2005 · Cited by 245 · cited 1× · see citing works
“The sequence for sip65 is GAUCAAUGGCUACACAGGAUU (Dai et al., 2005).”
ATM-dependent suppression of stress signaling reduces vascular disease in metabolic syndrome
Schneider, J. G., Finck, B. N., Ren, J., Standley, K. N., Takagi, M., Maclean, K. H., Bernal‐Mizrachi, C., Muslin, A. J., Kastan, M. B., & Semenkovich, C. F. (2006) · Cell Metabolism · doi:10.1016/j.cmet.2006.10.002 · Cited by 234 · cited 1× · see citing works
“Aside from increased tumorigenesis, ATM-deficiency results in altered metabolism, aberrant immune and inflammatory responses and increased levels of reactive oxygen species (ROS, Schneider et al., 2006; Alexander et al., 2010; Freund et al., 2011; Kulinski et al., 2012; Valentin-Vega et al., 2012).”
BackgroundSite-specific Phosphorylation Dynamics of the Nuclear Proteome during the DNA Damage Response
Bennetzen, M. V., Larsen, D. H., Bunkenborg, J., Bártek, J., Lukas, J., & Andersen, J. (2010) · Molecular & Cellular Proteomics · doi:10.1074/mcp.m900616-mcp200 · Cited by 233 · cited 2× · see citing works
“While DSBs trigger ATM-dependent phosphorylation of more than 1000 proteins (Matsuoka et al., 2007; Bennetzen et al., 2010; Bensimon et al., 2010), very few targets of ATM in response to other types of damage, including oxidative stress, are known (Guo et al.”
BackgroundInfluentialReactive Oxygen Species, Inflammation, and Lung Diseases
Rosanna, D. P., & Cuzzocrea, S. (2012) · Current Pharmaceutical Design · doi:10.2174/138161212802083716 · Cited by 209 · cited 1× · see citing works
“It is intriguing that high IL-8 expression levels in breast cancers were specifically correlated with lung metastasis, a tissue location with high oxygen burden (Rosanna and Salvatore, 2012).”
BackgroundCremona, C. A., & Behrens, A. (2013) · Oncogene · doi:10.1038/onc.2013.275 · Cited by 206 · cited 2× · see citing works
“ATM is considered a tumor suppressor as its deletion in mice results in tumors, patients with mutations in ATM in the human disorder Ataxia telangiectasia have increased cancer risks, and several hematological cancers have been reported to express defective ATM (Cremona and Behrens, 2013; Shiloh and Ziv, 2013; Stracke…”
BackgroundDNA-damage-induced differentiation of leukaemic cells as an anti-cancer barrier
Santos, M. A., Faryabi, R. B., Ergen, A. V., Day, A., Malhowski, A. J., Canela, A., Onozawa, M., Lee, J., Callén, E., Gutierrez‐Martinez, P., et al. (2014) · Nature · doi:10.1038/nature13483 · Cited by 195 · cited 1× · see citing works
“Interestingly, a recent study identified a fundamentally different type of anti-cancer pathway mediated by ATM in a MLL-AF9 driven acute myeloid leukemia model (Santos et al., 2014).”
BackgroundThe ATM signaling network in development and disease
Stracker, T. H., Roig, I., Knobel, P. A., & Marjanović, M. (2013) · Frontiers in Genetics · doi:10.3389/fgene.2013.00037 · Cited by 173 · cited 4× · see citing works
“ATM is considered a tumor suppressor as its deletion in mice results in tumors, patients with mutations in ATM in the human disorder Ataxia telangiectasia have increased cancer risks, and several hematological cancers have been reported to express defective ATM (Cremona and Behrens, 2013; Shiloh and Ziv, 2013; Stracke…”
BackgroundInfluentialSelf-citationGupta, J. R. P., Barrantes, I. D. B., Igea, A., Sakellariou, S., Pateras, I. S., Gorgoulis, V. G., & Nebreda, Á. R. (2014) · Cancer Cell · doi:10.1016/j.ccr.2014.02.019 · Cited by 166 · cited 1× · see citing works
“…p38 MAPK plays both pro and anti-tumorigenic roles and its downregulation has been demonstrated to reduce tumor growth and survival but also to promote the metastasis of colorectal cancer to the lung through the modulation of inflammatory responses (Gupta et al., 2014; Urosevic et al., 2014).”
BackgroundHuman RNA Methyltransferase BCDIN3D Regulates MicroRNA Processing
Xhemalçe, B., Robson, S. C., & Kouzarides, T. (2012) · Cell · doi:10.1016/j.cell.2012.08.041 · Cited by 153 · cited 1× · see citing works
“Soft agar assays were performed on shNC and shATM MDA-MB-231 cells essentially as described (Xhemalce et al., 2012).”
MethodSelf-citationPathological neoangiogenesis depends on oxidative stress regulation by ATM
Okuno, Y., Nakamura-Ishizu, A., Otsu, K., Suda, T., & Kubota, Y. (2012) · Nature Medicine · doi:10.1038/nm.2846 · Cited by 152 · cited 4× · see citing works
“Our results provide additional insights into other disease pathways involving ATM including angiogenesis, a pathway triggered by oxidative stress and dependent on IL-8 (Koch et al., 1992; Okuno et al., 2012).”
BackgroundResultInfluentialUrosevic, J., García‐Albéniz, X., Planet, E., Real, S., Céspedes, M. V., Guiu, M., Fernández, E., Bellmunt, A., Gawrzak, S., Pavlović, M., et al. (2014) · Nature Cell Biology · doi:10.1038/ncb2977 · Cited by 143 · cited 2× · see citing works
“p38 MAPK plays both pro and anti-tumorigenic roles and its downregulation has been demonstrated to reduce tumor growth and survival but also to promote the metastasis of colorectal cancer to the lung through the modulation of inflammatory responses (Gupta et al., 2014; Urosevic et al., 2014).”
BackgroundRationale and Means to Target Pro-Inflammatory Interleukin-8 (CXCL8) Signaling in Cancer
Campbell, L. M., Maxwell, P. J., & Waugh, D. J. J. (2013) · Pharmaceuticals · doi:10.3390/ph6080929 · Cited by 142 · cited 1× · see citing works
“IL-8 is upregulated in several cancers, including breast cancer, where it mediates several cancer promoting pathways including cell migration (Campbell et al., 2013; Singh et al., 2013).”
BackgroundRegulation of cell differentiation by the DNA damage response
Sherman, M. H., Bassing, C. H., & Teitell, M. A. (2011) · Trends in Cell Biology · doi:10.1016/j.tcb.2011.01.004 · Cited by 112 · cited 2× · see citing works
“…anti-cancer barriers to limit proliferation in response to, and in the presence of, DNA damage (Norbury and Zhivotovsky, 2004; Bartkova et al., 2005; Gorgoulis et al., 2005; Bartkova et al., 2006; Di Micco et al., 2006; Vousden and Lane, 2007; Sherman et al., 2011; Roos and Kaina, 2013).”
BackgroundMechanisms underlying differential expression of interleukin-8 in breast cancer cells
Freund, A., Jolivel, V., Durand, S., Kersual, N., Chalbos, D., Carine Chavey, A., Vignon, F., & Lazennec, G. (2004) · Oncogene · doi:10.1038/sj.onc.1207815 · Cited by 104 · cited 1× · see citing works
“As expected, we observed that depletion of NF-κB p65, a subunit of NF-κB dimer, or NEMO abrogated IL-8 expression in MDA-MB-231 (Figure 4E, Freund et al., 2004).”
Antioxidant N-acetyl cysteine reduces incidence and multiplicity of lymphoma in Atm deficient mice
Reliene, R., & Schiestl, R. H. (2006) · DNA repair · doi:10.1016/j.dnarep.2006.05.003 · Cited by 97 · see citing works
Wuerzberger‐Davis, S. M., Nakamura, Y., Seufzer, B. J., & Miyamoto, S. (2006) · Oncogene · doi:10.1038/sj.onc.1209815 · Cited by 82 · cited 1× · see citing works
“Both ATM and p53 are known to be required for NF-κB localization and activation in the nucleus upon various stimuli including cellular stress (Wuerzberger-Davis et al., 2007; Hoesel and Schmid, 2013).”
BackgroundRARRES3 suppresses breast cancer lung metastasis by regulating adhesion and differentiation
Morales, M. L. G., Arenas, E. J., Urosevic, J., Guiu, M., Fernández, E., Planet, E., Fenwick, R. B., Fernández‐Ruiz, S., Salvatella, X., Reverter, D., et al. (2014) · EMBO Molecular Medicine · doi:10.15252/emmm.201303675 · Cited by 72 · cited 3× · see citing works
“Analysis of breast cancer patient gene expression data Publically available breast cancer patient gene expression data from GEO was pooled (GSE2603, GSE2034, GSE5327, and GSE12276) as previously described (Minn et al., 2005; Barrett et al., 2007; Morales et al., 2014).”
BackgroundMethodD’Souza, A. D., Parish, I. A., Krause, D. S., Kaech, S. M., & Shadel, G. S. (2012) · Molecular Therapy · doi:10.1038/mt.2012.203 · Cited by 71 · see citing works
Wu, S., Singh, S., Varney, M. L., Kindle, S. A., & Singh, R. K. (2012) · Cancer Medicine · doi:10.1002/cam4.28 · Cited by 56 · cited 2× · see citing works
“However, our identification for a requirement of ATM to promote IL-8 expression, cell migration and invasion in vitro, as well as the association of increased levels of IL-8 with the metastatic potential of several cancer types, including colon cancer and melanoma (Lee et al., 2012; Wu et al., 2012), prompted us to ev…”
BackgroundAntioxidants Suppress Lymphoma and Increase Longevity in Atm-Deficient Mice ,3
Reliene, R., & Schiestl, R. H. (2007) · Journal of Nutrition · doi:10.1093/jn/137.1.229s · Cited by 53 · see citing works
Ataxia Telangiectasia Mutated Kinase Controls Chronic Gammaherpesvirus Infection
Kulinski, J. M., Leonardo, S. M., Mounce, B. C., Malherbe, L. P., Gauld, S. B., & Tarakanova, V. L. (2012) · Journal of Virology · doi:10.1128/jvi.00917-12 · Cited by 43 · cited 1× · see citing works
“Aside from increased tumorigenesis, ATM-deficiency results in altered metabolism, aberrant immune and inflammatory responses and increased levels of reactive oxygen species (ROS, Schneider et al., 2006; Alexander et al., 2010; Freund et al., 2011; Kulinski et al., 2012; Valentin-Vega et al., 2012).”
BackgroundEffects of antioxidants on cancer prevention and neuromotor performance in Atm deficient mice
Reliene, R., Fleming, S. M., Chesselet, M., & Schiestl, R. H. (2007) · Food and Chemical Toxicology · doi:10.1016/j.fct.2007.08.028 · Cited by 31 · cited 2× · see citing works
“…to ROS and many of these pathologies can be reversed by the addition of antioxidants, highlighting the important role of ATM in regulating redoxhomeostasis (Ito et al., 2004; Reliene and Schiestl, 2006, 2007; Reliene et al., 2008; Freund et al., 2011; Okuno et al., 2012; D’Souza et al., 2013).”
Background
Flagged first, then by citations
Cited by
Sorted by citations
Kinome screen of ferroptosis reveals a novel role of ATM in regulating iron metabolism
Chen, P., Wu, J., Ding, C. C., Lin, C., Pan, S. M., Bossa, N., Xu, Y., Yang, W., Mathey-Prévôt, B., & Chi, J. (2019) · Cell Death and Differentiation · doi:10.1038/s41418-019-0393-7 · Cited by 288 · see citing works
Irianto, J., Xia, Y., Pfeifer, C. R., Athirasala, A., Ji, J., Alvey, C. M., Tewari, M., Bennett, R. R., Harding, S. M., Liu, A. J., et al. (2016) · Current Biology · doi:10.1016/j.cub.2016.11.049 · Cited by 280 · see citing works
ATM and ATR signaling at a glance
Awasthi, P., Foiani, M., & Kumar, A. (2015) · Journal of Cell Science · doi:10.1242/jcs.169730 · Cited by 277 · see citing works
“Interestingly, ROS-induced ATM activation has been reported to assist in cell migration and invasion through interleukin 8 (IL-8), suggesting that ATM might also function to promote tumor progression (Chen et al., 2015a).”
BackgroundJin, M. H., & Oh, D. (2019) · Pharmacology & Therapeutics · doi:10.1016/j.pharmthera.2019.07.002 · Cited by 249 · see citing works
Tang, J., Ou‐Yang, F., Hou, M., Huang, H., Wang, H., Li, K.-T., Fayyaz, S., Shu, C., & Chang, H. (2018) · Seminars in Cancer Biology · doi:10.1016/j.semcancer.2018.08.010 · Cited by 221 · see citing works
Immunomodulation by targeted anticancer agents
Petroni, G., Buqué, A., Zitvogel, L., Kroemer, G., & Galluzzi, L. (2021) · Cancer Cell · doi:10.1016/j.ccell.2020.11.009 · Cited by 212 · see citing works
Targeting oncogene and non-oncogene addiction to inflame the tumour microenvironment
Petroni, G., Buqué, A., Coussens, L. M., & Galluzzi, L. (2022) · Nature Reviews Drug Discovery · doi:10.1038/s41573-022-00415-5 · Cited by 162 · see citing works
Roles of the CXCL8-CXCR1/2 Axis in the Tumor Microenvironment and Immunotherapy
Han, Z., Li, Y.-B., Yang, L., Cheng, H., Liu, X., & Chen, H. (2021) · Molecules · doi:10.3390/molecules27010137 · Cited by 138 · see citing works
Xi, L., Peng, M., Liu, S., Liu, Y., Wan, X., Hou, Y., Qin, Y., Yang, L., Chen, S.-C., Zeng, H., et al. (2021) · Journal of Extracellular Vesicles · doi:10.1002/jev2.12146 · Cited by 132 · see citing works
“The primary antibodies used are listed as follows: ATM (s1981) (1:1000, Abcam), ATM (1:1000, Abcam), KAP (s824) (1:2000, Abcam), FLOT1 (1:2000, Abcam), FOXO3 (1:1000, Abcam), p300 (1:2000, Abcam), γH2AX (1:1000, Cell Signaling Technology, CST), LC3B (1:1000, CST), p62 (1:1000, CST), BNIP3 (1:1000, CST), phospho-(Ser/T…”
BackgroundInfluentialThe complementarity of DDR, nucleic acids and anti-tumour immunity
Kornepati, A. V. R., Rogers, C. M., Sung, P., & Curiel, T. J. (2023) · Nature · doi:10.1038/s41586-023-06069-6 · Cited by 115 · see citing works
Yin, Y., Xu, L., Chang, Y., Zeng, T., Chen, X., Wang, A., Groth, J., Foo, W., Liang, C. Y., Hu, H., et al. (2019) · Molecular Cancer · doi:10.1186/s12943-019-0941-2 · Cited by 113 · see citing works
Wang, M., Cheng, B., Yang, Y., Liu, H., Huang, G., Han, L., Li, F., & Xu, F. (2019) · Nano Letters · doi:10.1021/acs.nanolett.9b01597 · Cited by 104 · see citing works
Peng, M., Yang, D., Hou, Y., Liu, S., Zhao, M., Qin, Y., Chen, R., Teng, Y., & Liu, M. (2019) · Cell Death and Disease · doi:10.1038/s41419-019-1475-7 · Cited by 96 · see citing works
RetractedThe role of DNA damage repair (DDR) system in response to immune checkpoint inhibitor (ICI) therapy
Shi, C., Qin, K., Lin, A., Jiang, A., Cheng, Q., Liu, Z., Zhang, J., & Luo, P. (2022) · Journal of Experimental & Clinical Cancer Research · doi:10.1186/s13046-022-02469-0 · Cited by 85 · see citing works
“Furthermore, ATM can promote cancer cell migration by regulating the expression of IL-8 independent of its role in the repair of DNA double-strand breaks [229].”
BackgroundATM and ATR signaling at a glance
Awasthi, P., Foiani, M., & Kumar, A. (2016) · Journal of Cell Science · doi:10.1242/jcs.188631 · Cited by 76 · see citing works
Cold Physical Plasma Modulates p53 and Mitogen-Activated Protein Kinase Signaling in Keratinocytes
Schmidt, A., Bekeschus, S., Jarick, K. J., Hasse, S., von Woedtke, T., & Wende, K. (2019) · Oxidative Medicine and Cellular Longevity · doi:10.1155/2019/7017363 · Cited by 71 · see citing works
“Reports also demonstrate that p53 serine 15/37 sites are phosphorylated by stress-related c-Jun N-terminal kinase (Jnk) and mitogen-activated protein kinase p38 (p38) as well as several upstream kinases, especially ataxia telangiectasia mutated (ATM), ataxia telangiectasia and Rad3-related (ATR), and check-point kinas…”
InfluentialFu, H., Ma, Y., Yang, M., Zhang, C., Huang, H., Xia, Y., Lu, L., Jin, W., & Cui, D. (2016) · Scientific Reports · doi:10.1038/srep29762 · Cited by 53 · see citing works
The Intersection of DNA Damage Response and Ferroptosis—A Rationale for Combination Therapeutics
Chen, P., Tseng, W. H.-S., & Chi, J. (2020) · Biology · doi:10.3390/biology9080187 · Cited by 49 · see citing works
“The oxidative stress-induced ATM is critical for the chemokine induction and survival of oxidative stresses [69,70].”
BackgroundInflammation, a significant player of Ataxia–Telangiectasia pathogenesis?
Zaki‐Dizaji, M., Akrami, S. M., Azizi, G., Abolhassani, H., & Aghamohammadi, A. (2018) · Inflammation Research · doi:10.1007/s00011-018-1142-y · Cited by 47 · see citing works
Nassour, H., Wang, Z., Saad, A., Papaluca, A., Brosseau, N., Affar, E. B., Alaoui‐Jamali, M. A., & Ramotar, D. (2016) · Scientific Reports · doi:10.1038/srep29389 · Cited by 46 · see citing works
Therapeutic Co-targeting of WEE1 and ATM Downregulates PD-L1 Expression in Pancreatic Cancer
Jin, M. H., Nam, A., Park, J. E., Bang, J., Bang, Y., & Oh, D. (2019) · Cancer Research and Treatment · doi:10.4143/crt.2019.183 · Cited by 45 · see citing works
Alkaraki, A., Alshaer, W., Wehaibi, S., Gharaibeh, L. F., Abuarqoub, D. A., Alqudah, D. A., Al-Azzawi, H., Zureigat, H., SOULEIMAN, M. M., & Awidi, A. (2020) · Breast Cancer · doi:10.1007/s12282-020-01098-9 · Cited by 44 · see citing works
Bastianello, G., Porcella, G., Beznoussenko, G. V., Kidiyoor, G. R., Ascione, F., Li, Q., Cattaneo, A., Matafora, V., Disanza, A., Quarto, M., et al. (2023) · Cell Reports · doi:10.1016/j.celrep.2023.113555 · Cited by 45 · see citing works
Ataxia telangiectasia syndrome: moonlighting ATM
Zaki‐Dizaji, M., Akrami, S. M., Abolhassani, H., Rezaei, N., & Aghamohammadi, A. (2017) · Expert Review of Clinical Immunology · doi:10.1080/1744666x.2017.1392856 · Cited by 41 · see citing works
“ATM may directly promote tumor invasion and metastasis by stabilization of a transcriptional repressor SNAIL via phosphorylation at serine 100 [181] and by regulation of interleukin (IL)8 expression [182].”
BackgroundHo, M., Guo, Z., Chunga, J., Goodwin, J. S., & Xie, H. (2016) · Frontiers in Cellular and Infection Microbiology · doi:10.3389/fcimb.2016.00139 · Cited by 40 · see citing works
Hall, A. E., Lu, W.-T., Godfrey, J. D., Antonov, A. V., Paicu, C., Moxon, S., Dalmay, T., Wilczynska, A., Muller, P. A. J., & Bushell, M. (2016) · Cell Death and Disease · doi:10.1038/cddis.2016.91 · Cited by 37 · see citing works
“The physiological reason for the apparent facilitation of cell migration as a result of ANK1 upregulation following DNA damage is currently unclear; however, it is in line with other previously documented observations.(40) In summary, we have shown how p53 can regulate a single transcript that produces two distinct mo…”
BackgroundResultHistone H2AX deficiency causes neurobehavioral deficits and impaired redox homeostasis
Weyemi, U., Paul, B. D., Snowman, A. M., Jailwala, P., Nussenzweig, A., Bonner, W. M., & Snyder, S. H. (2018) · Nature Communications · doi:10.1038/s41467-018-03948-9 · Cited by 37 · see citing works
Jiang, Y., Yan, H. Q., Huang, X. B., Wang, Y. N., Li, Q., & GAO, F. G. (2015) · Oncotarget · doi:10.18632/oncotarget.5825 · Cited by 34 · see citing works
MLK4 regulates DNA damage response and promotes triple-negative breast cancer chemoresistance
Mehlich, D., Łomiak, M., Sobiborowicz, A., Mazan, A., Dymerska, D., Szewczyk, Ł. M., Mehlich, A., Borowiec, A., Prełowska, M. K., Gorczyński, A., et al. (2021) · Cell Death and Disease · doi:10.1038/s41419-021-04405-0 · Cited by 25 · see citing works
“Thus, we curated a signature of ATM-dependent transcriptional alterations based on the previously published expression data from ATM-depleted TNBC cells [37].”
MethodCao, Y., Xiong, J., Li, Z., Zhang, G., Tu, Y., Wang, L., & Jie, Z. (2019) · Molecular Medicine Reports · doi:10.3892/mmr.2019.10624 · Cited by 21 · see citing works
Umebashi, K., Tokito, A., Yamamoto, M., & Jougasaki, M. (2018) · PLoS ONE · doi:10.1371/journal.pone.0191659 · Cited by 22 · see citing works
Lang, L., Hou, Y., Chen, Y., Tu, G., Tao, J., Yang, D., Xi, L., Fu, L., Sun, K., Yin, J., et al. (2018) · Cellular Physiology and Biochemistry · doi:10.1159/000496048 · Cited by 22 · see citing works
Inhibition of ATR Increases the Sensitivity to WEE1 Inhibitor in Biliary Tract Cancer
Nam, A., Jin, M., Bang, J., Oh, K.-S., Seo, H.-R., Oh, D., & Bang, Y. (2020) · Cancer Research and Treatment · doi:10.4143/crt.2020.080 · Cited by 22 · see citing works
Liu, R., Tang, J., Ding, C., Liang, W., Zhang, L., Chen, T., Xiong, Y., Dai, X., Li, W., Xu, Y., et al. (2017) · Cancer Letters · doi:10.1016/j.canlet.2016.12.040 · Cited by 21 · see citing works
Li, H., Liu, Y., Xiao, Y., Wilson, C. N., Bai, H. J., Jones, M., Wang, S., DeVore, J. E., Maier, E. Y., Durant, S. T., et al. (2023) · Proceedings of the National Academy of Sciences · doi:10.1073/pnas.2212072120 · Cited by 19 · see citing works
“Although very moderate, the effect of ATM inhibitor when used as a single agent, partially recapitulates previous findings that ATM silencing is sufficient to reduce triple-negative breast cancer tumors progression in the lung (32).”
JNK2 Is Required for the Tumorigenic Properties of Melanoma Cells
Du, L., Anderson, A., Nguyen, K. T., Ojeda, S. S., Ortiz-Rivera, I., Nguyen, T., Zhang, T., Kaoud, T. S., Gray, N. S., Dalby, K. N., et al. (2019) · ACS Chemical Biology · doi:10.1021/acschembio.9b00083 · Cited by 19 · see citing works
Unraveling the nexus: Genomic instability and metabolism in cancer
Gujar, V. V., Li, H., Paull, T. T., Neumann, C. A., & Weyemi, U. (2025) · Cell Reports · doi:10.1016/j.celrep.2025.115540 · Cited by 18 · see citing works
Essers, P., van der Heijden, M., Verhagen, C. V. M., Ploeg, E. M., de Roest, R. H., Leemans, C. R., Brakenhoff, R. H., van den Brekel, M. W. M., Bartelink, H. G. M. M., Verheij, M., et al. (2019) · Cancer Research · doi:10.1158/0008-5472.can-18-3388 · Cited by 17 · see citing works
Wang, H., Zhao, L., Wu, J., Hong, J., & Wang, S. (2020) · Oncology Letters · doi:10.3892/ol.2020.11608 · Cited by 18 · see citing works
Shu, J., Wang, X., Yang, X., & Zhao, G. (2023) · Scientific Reports · doi:10.1038/s41598-023-28185-z · Cited by 17 · see citing works
“Similarly, in cancer cells, cell migration and invasion are sustained by oxidative stress activation of ATM 44 .”
BackgroundWhole Genome Sequencing Identifies Key Genes in Spinal Schwannoma
Gao, X., Zhang, L., Jia, Q., Tang, L., Guo, W., Wang, T., Wu, Z., Zhou, W., Li, Z., & Xiao, J. (2020) · Frontiers in Genetics · doi:10.3389/fgene.2020.507816 · Cited by 17 · see citing works
“Based on the RefSeq gene annotation, we identified TTN, MUC4, FLG2, MUC17, OR2T4, ZNF850, FAM186A, ALMS1, FAM47C, and ATM as the top ten mutated genes (Figure 1D), however, only ATM was previously reported to be implicated in cancer (Kim et al., 2014; Chen et al., 2015; Feng et al., 2015).”
MethodDDX24 promotes metastasis by regulating RPL5 in non‐small cell lung cancer
Hu, X., Li, F., Zhou, Y., Gan, H., Wang, T.-C., Li, L., Long, H., Li, B., & Pang, P. (2022) · Cancer Medicine · doi:10.1002/cam4.4835 · Cited by 16 · see citing works
Choi, J. E., & Chung, W. (2019) · The Journal of Microbiology · doi:10.1007/s12275-020-9520-x · Cited by 16 · see citing works
Petukhov, D., Richter-Dayan, M., Fridlender, Z. G., Breuer, R., & Wallach‐Dayan, S. B. (2019) · Cells · doi:10.3390/cells8101211 · Cited by 15 · see citing works
Somatic and germline ATM variants in non-small-cell lung cancer: Therapeutic implications
Hernandez‐Martinez, J., Rosell, R., & Arrieta, O. G. (2023) · Critical Reviews in Oncology/Hematology · doi:10.1016/j.critrevonc.2023.104058 · Cited by 14 · see citing works
Expression and clinical significance of ATM and PUMA gene in patients with colorectal cancer
Xiong, H. F., & Zhang, J. (2017) · Oncology Letters · doi:10.3892/ol.2017.7181 · Cited by 14 · see citing works
Jiang, Y., NI, X. Y., Yan, H. Q., Shi, L., Lü, N., Wang, Y. N., Li, Q., & GAO, F. G. (2019) · Experimental Cell Research · doi:10.1016/j.yexcr.2019.05.011 · Cited by 12 · see citing works
Lin, S., Tian, J., He, Q., Yang, M., Chen, Z., Belogurov, A. A., Li, X., Zhang, F., Liu, Y., & Chen, G. (2022) · Disease Markers · doi:10.1155/2022/7243146 · Cited by 11 · see citing works
“And these pathways that determine cell fate are not independent of each other [4].”
BackgroundNaive primary neutrophils play a dual role in the tumor microenvironment
Babatunde, K. A., Datta, R., Hendrikse, N. W., Ayuso, J. M., Anna Huttenlocher, A., Skala, M. C., Beebe, D. J., & Kerr, S. C. (2024) · iScience · doi:10.1016/j.isci.2024.110632 · Cited by 11 · see citing works
Metabolic dependency mapping identifies Peroxiredoxin 1 as a driver of resistance to ATM inhibition
Li, H., Furusawa, T., Cavero, R., Xiao, Y., Chari, R., Wu, X., Sun, D., Hartmann, O., Dhall, A., Holewinski, R. J., et al. (2025) · Redox Biology · doi:10.1016/j.redox.2025.103503 · Cited by 10 · see citing works
Self-citationArafa, A. T., Yadav, S., Marshall, C. H., Mauer, E. A., Huang, M., Yilma, B., van der Pol, Y., Fragkogianni, S., Teslow, E. A., Kellen, S., et al. (2025) · Clinical Cancer Research · doi:10.1158/1078-0432.ccr-24-2058 · Cited by 8 · see citing works
Elucidating DNA Damage-Dependent Immune System Activation
Deligianni, E., Papanikolaou, C., Terpos, E., & Souliotis, V. L. (2025) · International Journal of Molecular Sciences · doi:10.3390/ijms26125849 · Cited by 9 · see citing works
Omidvar, S., Vahedian, V., Sourani, Z., Yari, D., Asadi, M., Jafari, N., Khodavirdilou, L., Bagherieh, M., Shirzad, M., & Hosseini, V. (2024) · Pathology - Research and Practice · doi:10.1016/j.prp.2024.155405 · Cited by 8 · see citing works
RYBP Sensitizes Cancer Cells to PARP Inhibitors by Regulating ATM Activity
Maybee, D. V., Psaras, A. M., Brooks, T. A., & Ali, M. A. (2022) · International Journal of Molecular Sciences · doi:10.3390/ijms231911764 · Cited by 9 · see citing works
“(2015) discovered that when ATM is inhibited, cell migration and invasion is dramatically reduced [28].”
BackgroundInfluentialSaunders, R. A., Michniacki, T. F., Hames, C., Moale, H., Wilke, C. A., Kuo, M. E., Nguyen, J., Hartlerode, A. J., Moore, B. B., & Sekiguchi, J. (2021) · Scientific Reports · doi:10.1038/s41598-021-83531-3 · Cited by 7 · see citing works
Peroxiredoxins in erythrocytes: far beyond the antioxidant role
de Paula, C. P., da Silva, J. P. M. D. O., Romanello, K. S., Bernardo, V. S., Torres, F. F., da Silva, D. G. H., & da Cunha, A. F. (2023) · Journal of Molecular Medicine · doi:10.1007/s00109-023-02368-7 · Cited by 7 · see citing works
“As postulated by Nassour et al. [79], the interaction of Prx1/APEX1 keeps APEX1 in the cytoplasm of the cell instead of in the nucleus, preventing the activation of inflammatory markers such as NF-kB and IL-8 (a pro-inflammatory chemokine involved in the invasion and metastasis of tumors) [85, 86].”
BackgroundGuo, T., Qin, S., Tian, Y., Tang, M., Yuan, Y., Sun, R., Chen, L., Cen, X., & Yang, T. (2025) · Journal of Medicinal Chemistry · doi:10.1021/acs.jmedchem.5c00927 · Cited by 6 · see citing works
DNA Damage Response and Cancer Metastasis: Clinical Implications and Therapeutic Opportunities
Yin, M., Hong, F., & Wang, Q.-E. (2022) · Exon Publications eBooks · doi:10.36255/exon-publications.metastasis.dna-damage-response · Cited by 6 · see citing works
Qin, C., Zan, Y., Xie, L., & Liu, H. (2022) · Frontiers in Cardiovascular Medicine · doi:10.3389/fcvm.2022.942251 · Cited by 5 · see citing works
Li, S., Xie, M., Du, Y., & Tan, Z. (2025) · Cell Communication and Signaling · doi:10.1186/s12964-025-02235-7 · Cited by 5 · see citing works
“One study suggested that ATM, a key component of DNA damage response, may potentiate IL-8 expression in p53 mutated cancer cells [152], but, the association between ATM, IL-8 and chemo-resistance in colorectal cancer cells has not yet been studied.”
Therapeutic targets and investigated treatments for Ataxia-Telangiectasia
Lavin, M. F., Yeo, A. J., Kijas, A. W., Wolvetang, E. J., Sly, P. D., Wainwright, C. E., & Sinclair, K. (2016) · Expert Opinion on Orphan Drugs · doi:10.1080/21678707.2016.1254618 · Cited by 5 · see citing works
Ramotar, D., & Nepveu, A. (2018) · Journal of Radiation and Cancer Research · doi:10.4103/jrcr.jrcr_8_18 · Cited by 4 · see citing works
Jost, T., Wachter, M., Meidenbauer, J., Fietkau, R., & Gaipl, U. (2025) · Scientific Reports · doi:10.1038/s41598-025-17858-6 · Cited by 4 · see citing works
“Chen et al. found that IL-8 is regulated by ATM 27 .”
Qian, C., Li, X., Zhang, J., & Wang, Y. (2024) · Journal of Medicinal Chemistry · doi:10.1021/acs.jmedchem.4c01064 · Cited by 3 · see citing works
Nature’s Elixir for Cancer Treatment: Targeting Tumor-induced Neovascularization
Kumari, R., Syeda, S., & Shrivastava, A. (2024) · Current Medicinal Chemistry · doi:10.2174/0109298673282525240222050051 · Cited by 3 · see citing works
Ponomaroyva, A. A., Schegoleva, A. A., Анатольевна, Г. П., Gerashchenko, T. S., Pankova, O. V., Ershov, N. I., Михайлович, П. В., Чердынцева, Н. В., & Denisov, E. V. (2024) · Bulletin of Experimental Biology and Medicine · doi:10.1007/s10517-024-06138-4 · Cited by 1 · see citing works
“IL-8 IL-8) that promote migration of tumor cells and their invasion in the lung tissues [15].”
Li, H., Liang, X., Ma, J., Liu, Q., Lin, Y., Tang, J., Ren, Z., & Liang, Z. (2025) · Journal of Inflammation Research · doi:10.2147/jir.s496099 · Cited by 1 · see citing works
Radiosensitizing Glioma by Targeting ATM with Small Molecule Inhibitors
Sule, A. D., & Valerie, K. C. (2016) · Springer eBooks · doi:10.1007/978-3-319-45594-5_12
A Narrative Review of ATM Diagnosis Methods: Comparative Analyzing
(2020) · International Journal of Clinical Chemistry and Laboratory Medicine · doi:10.20431/2455-7153.0602002
“ANALYZING ATM DNA DAMAGE RESPONSE BY FLOW CYTOMETRY Flow-and image-assisted cytometric approaches is used to assess the mechanisms and measure the extent of DNA damage response in individual cells, as cell cycle phase position, levels of reactive oxygen species (ROS) and induction of apoptosis.”
MethodInfluentialImpact of human CD8+ T cell senescence on 89 Zr radiolabelling and homing propertiesPreprint
Byström, J., Carrascal-Miniño, A., Keeling, G. P., Pham, T., Garrod-Ketchley, C., Schroth, J., de Rosales, R. T. M., Terry, S. Y. A., & Henson, S. M. (2023) · medRxiv · doi:10.1101/2023.02.04.23285413
“Indeed, ATM activation has been shown to regulate IL-8 to sustain cell migration (24).”
BackgroundImpact of human CD8+ T cell senescence on 89Zr radiolabelling and homing propertiesPreprint
Byström, J., Carrascal-Miniño, A., Keeling, G. P., Pham, T., Garrod-Ketchley, C., Schroth, J., de Rosales, R. T. M., Terry, S. Y. A., & Henson, S. M. (2023) · Research Square · doi:10.21203/rs.3.rs-3481416/v1
- Authors
- Chen, W.-T., Ebelt, N. D., Stracker, T. H., Xhemalce, B., Van Den Berg, C. L., & Miller, K. M.
- Affiliations
- The University of Texas at Austin (US)
- Institute for Research in Biomedicine (ES)
- Department of Molecular Biosciences, Institute for Cellular and Molecular Biology, University of Texas at Austin, Austin, United States
- Corresponding author
- Miller, Kyle M
- Venue
- eLife
- Publisher
- eLife Sciences Publications, Ltd
- Published
- 2015-06-01
- Volume
- 4
- ISSN
- 2050-084X (ISSN-L)
- PMC
- PMC4463759
- OpenAlex
- W2099968101
- Cited by
- 73
- References
- 78
- Citations by year
- 2025: 9 · 2024: 5 · 2023: 8 · 2022: 7 · 2021: 4 · 2020: 7 · 2019: 13 · 2018: 6 · 2017: 3 · 2016: 8 · 2015: 3
- FWCI
- 2.91
- Type
- journal article
- Language
- en
- Open access
- gold
- doi.org
- Licence
- Locations
- eLife (publishedVersion, cc-by)
- Europe PMC (PubMed Central) (publishedVersion, cc-by)
- PubMed Central (publishedVersion, cc-by)
- PubMed (publishedVersion)
- DOAJ (DOAJ: Directory of Open Access Journals) (submittedVersion, cc-by-sa)
- Funders
- Ministerio de Economía y Competitividad (BFU2012-39521)
- Cancer Prevention and Research Institute of Texas (CPRIT) (R116)
- Topics
- Health Sciences › Medicine › Oncology › Chemokine receptors and signaling
- Life Sciences › Biochemistry, Genetics and Molecular Biology › Molecular Biology › DNA Repair Mechanisms
- Life Sciences › Biochemistry, Genetics and Molecular Biology › Molecular Biology › Mechanisms of cancer metastasis
- Keywords
- ATM kinase, interleukin-8, oxidative stress, tumor cell migration, tumor invasion, metastasis, lung metastasis, breast cancer, tumor progression, DNA damage response
- MeSH terms
- Animals, Breast Neoplasms, Cell Fractionation, Cell Movement, Electrophoresis, Polyacrylamide Gel, Female, Flow Cytometry, Humans, Luciferases, Lung Neoplasms, Neoplasm Invasiveness, Blotting, Western, Gene Expression Regulation, Neoplastic, Interleukin-8, DNA Primers, Oxidative Stress, Microarray Analysis, Chromatin Immunoprecipitation, Mice, Gene Regulatory Networks, Real-Time Polymerase Chain Reaction, Ataxia Telangiectasia Mutated Proteins
About these checks
Registry, retraction, Cites and statistics results are computed, not judged, with one exception: a printed reference that no index lists is read once by a model before it counts as a citation error. Claims are extracted by a model and kept only when their quote appears verbatim in the text; each cited source is then checked, with a model’s help, for whether it says what the claim relies on. Those verdicts can be wrong — read the claim’s quote and the cited source before relying on one.
Statistics and arithmetic are recomputed, not judged.
Confidence bands are shown only for fields calibrated on our annotated test set. None is calibrated yet, so no band is shown.
What counts as a claim ›How we measure confidence ›How we check this ›
Are you an author, or do you see a problem with this page? Request a review
