Cited by 6,491Immune Response and InflammationImmunotherapy and Immune ResponsesT-cell and B-cell Immunology

The DOI matches its Crossref record; 33 of the 33 references it cites were found in a registry or an index.

A Toll-like receptor recognizes bacterial DNA

Hemmi, Hiroaki, Takeuchi, Osamu, Kawai, Taro, Kaisho, Tsuneyasu, Sato, Shintaro, Sanjo, Hideki, Matsumoto, Makoto, Hoshino, Katsuaki, Wagner, Hermann, Takeda, Kiyoshi, Akira, Shizuo·2000·Nature

DOI 10.1038/35047123

Open this paper in CoChat — free account

Abstract

DNA from bacteria has stimulatory effects on mammalian immune cells, which depend on the presence of unmethylated CpG dinucleotides in the bacterial DNA. In contrast, mammalian DNA has a low frequency of CpG dinucleotides, and these are mostly methylated; therefore, mammalian DNA does not have immuno-stimulatory activity. CpG DNA induces a strong T-helper-1-like inflammatory response. Accumulating evidence has revealed the therapeutic potential of CpG DNA as adjuvants for vaccination strategies for cancer, allergy and infectious diseases. Despite its promising clinical use, the molecular mechanism by which CpG DNA activates immune cells remains unclear. Here we show that cellular response to CpG DNA is mediated by a Toll-like receptor, TLR9. TLR9-deficient (TLR9-/-) mice did not show any response to CpG DNA, including proliferation of splenocytes, inflammatory cytokine production from macrophages and maturation of dendritic cells. TLR9-/- mice showed resistance to the lethal effect of CpG DNA without any elevation of serum pro-inflammatory cytokine levels. The in vivo CpG-DNA-mediated T-helper type-1 response was also abolished in TLR9-/- mice. Thus, vertebrate immune systems appear to have evolved a specific Toll-like receptor that distinguishes bacterial DNA from self-DNA.

Integrity signals

Registry

Crossref · 10.1038/35047123

Cites

33 of 33 references verified0 citation errors · 0 not checkable

Statistics

Recomputing p-values needs the paper’s full text.

Claims the paper makes

This paper’s full text isn’t openly available, so its claims and self-check weren’t run. The registry and citation checks still apply.

Claims other papers make about this one

Each is checked against this paper’s own text: does it say what the citing paper says it does?

Defective LPS Signaling in C3H/HeJ and C57BL/10ScCr Mice: Mutations in Tlr4 Gene
Poltorak, A., He, X., Smirnova, I., Liu, M.-Y., Huffel, C. V., Du, X., Birdwell, D., Alejos, E., Silva, M., Galanos, C., et al. (1998) · Science · doi:10.1126/science.282.5396.2085 · Cited by 7,631
A human homologue of the Drosophila Toll protein signals activation of adaptive immunity
Medzhitov, R., Preston-Hurlburt, P., & Janeway, C. A. J. (1997) · Nature · doi:10.1038/41131 · Cited by 6,137
Differential roles of TLR2 and TLR4 in recognition of gram-negative and gram-positive bacterial cell wall components.
Takeuchi, O., Hoshino, K., Kawai, T., Sanjo, H., Takada, H., Ogawa, T., Takeda, K., & Akira, S. (1999) · Immunity · doi:10.1016/s1074-7613(00)80119-3 · Cited by 3,680
Self-citation
CpG motifs in bacterial DNA trigger direct B-cell activation
Krieg, A. M., Yi, A.-K., Matson, S., Waldschmidt, T. J., Bishop, G. A., Teasdale, R., Koretzky, G. A., & Klinman, D. M. (1995) · Nature · doi:10.1038/374546a0 · Cited by 3,508
Cutting Edge: Toll-Like Receptor 4 (TLR4)-Deficient Mice Are Hyporesponsive to Lipopolysaccharide: Evidence for TLR4 as the Lps Gene Product
Hoshino, K., Takeuchi, O., Kawai, T., Sanjo, H., Ogawa, T., Takeda, Y., Takeda, K., & Akira, S. (1999) · The Journal of Immunology · doi:10.4049/jimmunol.162.7.3749 · Cited by 3,374
Self-citation
Innate Immunity: The Virtues of a Nonclonal System of Recognition
Medzhitov, R., & Janeway, C. A. (1997) · Cell · doi:10.1016/s0092-8674(00)80412-2 · Cited by 2,434
Unresponsiveness of MyD88-deficient mice to endotoxin.
Kawai, T., Adachi, O., Ogawa, T., Takeda, K., & Akira, S. (1999) · Immunity · doi:10.1016/s1074-7613(00)80086-2 · Cited by 2,367
Self-citation
A family of human receptors structurally related to Drosophila Toll.
Rock, F., Hardiman, G., Timans, J., Kastelein, R., & Bazan, J. (1998) · Proceedings of the National Academy of Sciences of the United States of America · doi:10.1073/pnas.95.2.588 · Cited by 2,009
Host Defense Mechanisms Triggered by Microbial Lipoproteins Through Toll-Like Receptors
Brightbill, H. D., Libraty, D. H., Krutzik, S. R., Yang, R., Belisle, J. T., Bleharski, J. R., Maitland, M. L., Norgard, M. V., Plevy, S. E., Smale, S. T., et al. (1999) · Science · doi:10.1126/science.285.5428.732 · Cited by 1,659
Cell Activation and Apoptosis by Bacterial Lipoproteins Through Toll-like Receptor-2
Aliprantis, A. O., Yang, R., Mark, M. R., Suggett, S., Devaux, B., Radolf, J. D., Klimpel, G. R., Godowski, P. J., & Zychlinsky, A. (1999) · Science · doi:10.1126/science.285.5428.736 · Cited by 1,463

Flagged first, then by citations

Show all 33 references

Sorted by citations

Items 701–800 of 1,045

Tolerance to microbial TLR ligands: molecular mechanisms and relevance to disease
Medvedev, A. E., Sabroe, I., Hasday, J. D., & Vogel, S. N. (2006) · Journal of Endotoxin Research · doi:10.1179/096805106x102255 · Cited by 203
T granules in human platelets function in TLR9 organization and signaling
Thon, J. N., Peters, C. G., Machlus, K. R., Aslam, R., Rowley, J. W., MacLeod, H. J., Devine, M. T., Fuchs, T. A., Weyrich, A. S., Semple, J. W., et al. (2012) · The Journal of Cell Biology · doi:10.1083/jcb.201111136 · Cited by 201
“TLR9 has been identified as the receptor involved in the recognition of immunostimulatory CpG motifs (Hemmi et al., 2000; Bauer et al., 2001) and is uniquely expressed in peripheral granules in resting PLTs and on the human PLT surface after activation.”
Background
Extracellular DNA (eDNA). A Major Ubiquitous Element of the Bacterial Biofilm Architecture
Campoccia, D., Montanaro, L., & Arciola, C. R. (2021) · International Journal of Molecular Sciences · doi:10.3390/ijms22169100 · Cited by 222
“TRL9 is a pattern recognition receptor, which is predominantly located intracellularly in immune cells and recognizes unmethylated CpG motifs characteristic of bacterial DNA [44,45].”
Background
Splenic Macrophage Subsets and Their Function during Blood-Borne Infections
da Silva, H. B., Fonseca, R., Pereira, R. M., Cassado, A. D. A., Álvarez, J. M., & Lima, M. R. D. (2015) · Frontiers in Immunology · doi:10.3389/fimmu.2015.00480 · Cited by 201
“This also holds true for several other interactions such as TLR2 and/or TLR4 with glycosylphosphatidylinositol (GPI) anchors from Trypanosoma and Plasmodium parasites (7, 8) and TLR9 engagement by CpG motifs found in bacterial (9) and plasmodial DNA (10).”
Background
Toll-like receptors and their role in experimental models of microbial infection
Qureshi, S., & Medzhitov, R. (2003) · Genes and Immunity · doi:10.1038/sj.gene.6363937 · Cited by 159
Mast cells in innate immunity
Marshall, J. S., & Jawdat, D. M. (2004) · Journal of Allergy and Clinical Immunology · doi:10.1016/j.jaci.2004.04.045 · Cited by 206
Polyvalent Immunostimulatory Nanoagents with Self‐Assembled CpG Oligonucleotide‐Conjugated Gold Nanoparticles
Wei, M., Chen, N., Li, J., Yin, M., Liang, L., He, Y., Song, H., Fan, C., & Huang, Q. (2011) · Angewandte Chemie International Edition · doi:10.1002/anie.201105187 · Cited by 202
The sound of silence: Transgene silencing in mammalian cell engineering
Cabrera, A., Edelstein, H. I., Glykofrydis, F., Love, K. S., Palacios, S., Tycko, J., Zhang, M., Lensch, S., Shields, C. E., Livingston, M., et al. (2022) · Cell Systems · doi:10.1016/j.cels.2022.11.005 · Cited by 217
“122,123 An shRNA screen of baculovirus-infected A549 cells identiﬁed genes of the TLR, interferon, and interleukin families that silence trans-gene expression.”
Background
Critical role of AIM2 in Mycobacterium tuberculosis infection
Saiga, H., Kitada, S., Shimada, Y., Kamiyama, N., Okuyama, M., Makino, M., Yamamoto, M., & Takeda, K. (2012) · International Immunology · doi:10.1093/intimm/dxs062 · Cited by 202
Self-citation
Exploration of the nanomedicine-design space with high-throughput screening and machine learning
Yamankurt, G., Berns, E. J., Xue, A., Lee, A., Bagheri, N., Mrksich, M., & Mirkin, C. A. (2019) · Nature Biomedical Engineering · doi:10.1038/s41551-019-0351-1 · Cited by 203
Gut microbiota and colorectal cancer
Gao, R., Gao, Z., Huang, L., & Qin, H. (2017) · European Journal of Clinical Microbiology & Infectious Diseases · doi:10.1007/s10096-016-2881-8 · Cited by 205
“TLR-9 has been proved to help the cellular response to CpG DNA of infectious pathogens [51].”
Background
Advances in transcutaneous vaccine delivery: Do all ways lead to Rome?
Bal, S. M., Ding, Z., van Riet, E., Jiskoot, W., & Bouwstra, J. A. (2010) · Journal of Controlled Release · doi:10.1016/j.jconrel.2010.09.018 · Cited by 201
Muramyldipeptide and diaminopimelic acid-containing desmuramylpeptides in combination with chemically synthesized Toll-like receptor agonists synergistically induced production of interleukin-8 in a NOD2- and NOD1-dependent manner, respectively, in human
Uehara, A., Yang, S., Fujimoto, Y., Fukase, K., Kusumoto, S., Shibata, K., Sugawara, S., & Takada, H. (2004) · Cellular Microbiology · doi:10.1111/j.1462-5822.2004.00433.x · Cited by 197
“Phosphorothioate-stabilized CpG DNA 1826, as a strong human cell stimulant (TCCATGACGTTCCTGATGCT) (Hemmi et al., 2000), was obtained from Proligo.”
Background
Cutting Edge: TLR2 Directly Triggers Th1 Effector Functions
Imanishi, T., Hara, H., Suzuki, S., Suzuki, N., Akira, S., & Saito, T. (2007) · The Journal of Immunology · doi:10.4049/jimmunol.178.11.6715 · Cited by 200
“The CpG oligodeoxynucleotide (TCCATGACGTTCCTGATGCT) (15), a TLR9 ligand, was purchased from Rikaken.”
BackgroundSelf-citation
Toll-like receptors and T-helper-1/T-helper-2 responses
Dabbagh, K., & Lewis, D. B. (2003) · Current Opinion in Infectious Diseases · doi:10.1097/00001432-200306000-00003 · Cited by 199
Toll‐like receptor‐dependent activation of several human blood cell types by protamine‐condensed mRNA
Scheel, B., Teufel, R., Probst, J., Carralot, J., Geginat, J., Radsak, M. P., Jarrossay, D., Wagner, H., Jung, G., Rammensee, H., et al. (2005) · European Journal of Immunology · doi:10.1002/eji.200425656 · Cited by 198
Self-citation
Vaccination with Plasmid DNA Activates Dendritic Cells via Toll-Like Receptor 9 (TLR9) but Functions in TLR9-Deficient Mice
Spies, B., Hochrein, H., Vabulas, M., Huster, K. M., Busch, D. H., Schmitz, F., Heit, A., & Wagner, H. (2003) · The Journal of Immunology · doi:10.4049/jimmunol.171.11.5908 · Cited by 196
“Recently, it has been demonstrated that Toll-like receptor 9 (TLR9) is essential for CpG-ODN-induced innate immune cell activation, because TLR9-deficient mice are refractory (9).”
BackgroundSelf-citation
Toll-Like Receptor 9 Inhibition Confers Protection From Liver Ischemia–Reperfusion Injury
Bamboat, Z. M., Balachandran, V. P., Ocuin, L. M., Obaid, H., Plitas, G., & DeMatteo, R. P. (2009) · Hepatology · doi:10.1002/hep.23365 · Cited by 199
Innate Immunity and Neuroinflammation
Shastri, A., Bonifati, D. M., & Kishore, U. (2013) · Mediators of Inflammation · doi:10.1155/2013/342931 · Cited by 207
“Unmethylated CpG DNA TLR9 Recognition of bacteria and virus [127, 128]”
Background
CpG Oligodeoxynucleotides as Vaccine Adjuvants in Primates
Verthelyi, D. I., Kenney, R. T., Seder, R. A., Gam, A. A., Friedag, B., & Klinman, D. M. (2002) · The Journal of Immunology · doi:10.4049/jimmunol.168.4.1659 · Cited by 199
“It was recently established that Toll-like receptor 9 plays a critical role in CpG ODN-mediated activation of human and murine immune cells (35, 36).”
Background
Recent advances in the understanding of egg allergens: basic, industrial, and clinical perspectives
Mine, Y., & Yang, M. (2008) · Journal of Agricultural and Food Chemistry · doi:10.1021/jf8001153 · Cited by 196
IFN Regulatory Factor 3-Dependent Induction of Type I IFNs by Intracellular Bacteria Is Mediated by a TLR- and Nod2-Independent Mechanism
Stockinger, S., Reutterer, B., Schaljo, B., Schellack, C., Brunner, S., Materna, T., Yamamoto, M., Akira, S., Taniguchi, T., Murray, P. J., et al. (2004) · The Journal of Immunology · doi:10.4049/jimmunol.173.12.7416 · Cited by 198
“The general adaptor MyD88 is involved in stimulating IFN- synthesis in the context of TLR9 signaling (50–52).”
InfluentialSelf-citation
How has neutrophil research improved our understanding of periodontal pathogenesis?
Nussbaum, G., & Shapira, L. (2011) · Journal Of Clinical Periodontology · doi:10.1111/j.1600-051x.2010.01678.x · Cited by 203
Structure-dependent immunostimulatory effect of CpG oligodeoxynucleotides and their delivery system
Hanagata, N. (2012) · International Journal of Nanomedicine · doi:10.2147/ijn.s30197 · Cited by 199
“It was then discovered that TLR9 is the receptor of DNA containing unmethylated CpG. 3 In human beings, TLR9 is mainly expressed by B cells and plasmacytoid dendritic cells (pDCs).”
Background
Reactive Oxygen and Nitrogen Species Differentially Regulate Toll-Like Receptor 4-Mediated Activation of NF-κB and Interleukin-8 Expression
Ryan, K. A., Smith, M. F., Sanders, M. K., & Ernst, P. B. (2004) · Infection and Immunity · doi:10.1128/iai.72.4.2123-2130.2004 · Cited by 198
“Currently the best understood are TLR2, which recognizes bacterial lipoteichoic acid and peptidoglycan (36); TLR4, which binds lipopolysaccharide (31); TLR5, which binds bacterial flagellin (16); and TLR9, which recognizes unmethylated bacterial CpG DNA (17).”
BackgroundInfluential
Human Clinical Trials of Plasmid DNA Vaccines
Liu, M. A., & Ulmer, J. B. (2005) · Advances in genetics · doi:10.1016/s0065-2660(05)55002-8 · Cited by 198
Activation of antigen-presenting cells by microbial products breaks self tolerance and induces autoimmune disease
Waldner, H., Collins, M. A., & Kuchroo, V. K. (2004) · Journal of Clinical Investigation · doi:10.1172/jci19388 · Cited by 198
Mice Lacking Myeloid Differentiation Factor 88 Display Profound Defects in Host Resistance and Immune Responses to Mycobacterium avium Infection Not Exhibited by Toll-Like Receptor 2 (TLR2)- and TLR4-Deficient Animals
Feng, C. G., Scanga, C. A., Collazo, C. M., Cheever, A. W., Hieny, S. E., Caspar, P., & Sher, A. (2003) · The Journal of Immunology · doi:10.4049/jimmunol.171.9.4758 · Cited by 199
Strategies for nonviral nanoparticle‐based delivery of CRISPR/Cas9 therapeutics
Chen, F., Alphonse, M., & Liu, Q. (2020) · WIREs Nanomedicine and Nanobiotechnology · doi:10.1002/wnan.1609 · Cited by 197
TLRs and chronic inflammation
Ospelt, C., & Gay, S. (2009) · The International Journal of Biochemistry & Cell Biology · doi:10.1016/j.biocel.2009.10.010 · Cited by 198
Antimicrobial peptides and self-DNA in autoimmune skin inflammation
Gilliet, M. F., & Lande, R. (2008) · Current Opinion in Immunology · doi:10.1016/j.coi.2008.06.008 · Cited by 207
Mitochondrial dysfunction in sepsis: mechanisms and therapeutic perspectives
Hu, D., Prabhakaran, H. S., Zhang, Y.-Y., Luo, G., He, W., & Liou, Y. (2024) · Critical Care · doi:10.1186/s13054-024-05069-w · Cited by 215
Endotoxin can induce MyD88-deficient dendritic cells to support Th2 cell differentiation
Kaisho, T. (2002) · International Immunology · doi:10.1093/intimm/dxf039 · Cited by 197
Self-citation
Toll-like receptors: a family of pattern-recognition receptors in mammals.
Armant, M. A., & Fenton, M. J. (2002) · Genome biology · doi:10.1186/gb-2002-3-8-reviews3011 · Cited by 196
Trafficking of endosomal Toll-like receptors
Lee, B. L., & Barton, G. M. (2014) · Trends in Cell Biology · doi:10.1016/j.tcb.2013.12.002 · Cited by 214
“Multiple TLRs recognize specific nucleic acid structures: TLR3 recognizes double stranded RNA (dsRNA) [18], TLR7 and TLR8 recognize single stranded RNA (ssRNA) [19–22] and TLR9 recognizes DNA [23].”
Background
TRIM30α Is a Negative-Feedback Regulator of the Intracellular DNA and DNA Virus-Triggered Response by Targeting STING
Wang, Y., Lian, Q., Yang, B., Yan, S., Zhou, H., He, L., Lin, G., Lian, Z., Jiang, Z., & Sun, B. (2015) · PLoS Pathogens · doi:10.1371/journal.ppat.1005012 · Cited by 197
“For example, TLR9 senses the CpG motifs-contained DNA [7].”
Background
Role of Mitogen-Activated Protein Kinases in CpG DNA-Mediated IL-10 and IL-12 Production: Central Role of Extracellular Signal-Regulated Kinase in the Negative Feedback Loop of the CpG DNA-Mediated Th1 Response
Yi, A., Yoon, J.-G., Yeo, S.-J., Hong, S., English, B. K., & Krieg, A. Μ. (2002) · The Journal of Immunology · doi:10.4049/jimmunol.168.9.4711 · Cited by 195
Bacterial peptidoglycans but not CpG oligodeoxynucleotides activate synovial fibroblasts by toll‐like receptor signaling
Kyburz, D., Rethage, J., Seibl, R., Lauener, R. P., Gay, R. E., Carson, D. A., & Gay, S. (2003) · Arthritis & Rheumatism · doi:10.1002/art.10848 · Cited by 195
Basic aspects and pharmacology of probiotics: an overview of pharmacokinetics, mechanisms of action and side-effects
Marteau, P. R., & Shanahan, F. (2003) · Best Practice & Research Clinical Gastroenterology · doi:10.1016/s1521-6918(03)00055-6 · Cited by 201
Human Keratinocytes Express Functional CD14 and Toll-Like Receptor 4
Song, P. I., Neparidze, N., Armstrong, C. A., Ansel, J. C., Park, Y.-M., Abraham, T., Harten, B., & Zivony, A. S. (2002) · Journal of Investigative Dermatology · doi:10.1046/j.1523-1747.2002.01847.x · Cited by 196
Trial Watch
Galluzzi, L., Vacchelli, E., Eggermont, A. M. M., Fridman, W. H., Galon, J., Sautès‐Fridman, C., Tartour, É., Zitvogel, L., & Kroemer, G. (2012) · OncoImmunology · doi:10.4161/onci.20696 · Cited by 205
“The main ligand of TLR9 is bacterial/viral DNA, differing from its mammalian counterpart for the elevated frequency of unmethylated CpG dinucleotides.(178) Indeed, whereas mammalian DNA has no immunostimulatory activity, the administration of bacterial/viral DNA induces a potent Th1 immune response in vivo, which is e…”
iNOS-Producing Inflammatory Dendritic Cells Constitute the Major Infected Cell Type during the Chronic Leishmania major Infection Phase of C57BL/6 Resistant Mice
Trez, C. D., Magez, S., Akira, S., Ryffel, B., Carlier, Y., & Muraille, É. (2009) · PLoS Pathogens · doi:10.1371/journal.ppat.1000494 · Cited by 194
“Analysis of various genetically deficient mouse strains revealed the requirement of CCR2 expression for the recruitment of iNOS-DC in the draining lymph nodes, whereas their activation is strongly dependent on CD40, IL-12, IFN-c and MyD88 molecules with a partial contribution of TNF-a and TLR9.”
MethodInfluentialSelf-citation
Innate immune signals in atherosclerosis
Lundberg, A. M., & Hansson, G. K. (2009) · Clinical Immunology · doi:10.1016/j.clim.2009.07.016 · Cited by 200
The role of Toll-like receptors in renal diseases
Gluba-Brzózka, A., Banach, M., Hannam, S., Mikhailidis, D. P., Sakowicz, A., & Rysz, J. (2010) · Nature Reviews Nephrology · doi:10.1038/nrneph.2010.16 · Cited by 197
Cutting Edge: CIAS1/Cryopyrin/PYPAF1/NALP3/ CATERPILLER 1.1 Is an Inducible Inflammatory Mediator with NF-κB Suppressive Properties
O’Connor, W., Harton, J. A., Zhu, X., Linhoff, M. W., & Ting, J. P. ‐. (2003) · The Journal of Immunology · doi:10.4049/jimmunol.171.12.6329 · Cited by 195
Implications of pharmacokinetic behavior of lipoplex for its inflammatory toxicity
ZHANG, J., LIU, F., & Huang, L. (2005) · Advanced Drug Delivery Reviews · doi:10.1016/j.addr.2004.12.004 · Cited by 198
Antitumor Activity of IFN-λ in Murine Tumor Models
Sato, A., Ohtsuki, M., Hata, M., Kobayashi, E., & Murakami, T. (2006) · The Journal of Immunology · doi:10.4049/jimmunol.176.12.7686 · Cited by 195
“This liver-targeted strategy possesses the following advantages: 1) the liver is the largest organ of the reticuloendothelial system and appropriate immunological responses could be introduced; and 2) plasmid DNA can potentially activate the TLR 9 that mediates innate immune reactions (43, 44).”
Background
DNA Damage Response and Immune Defense: Links and Mechanisms
Nakad, R., & Schumacher, B. (2016) · Frontiers in Genetics · doi:10.3389/fgene.2016.00147 · Cited by 207
Respiratory microbiome and epithelial interactions shape immunity in the lungs
Invernizzi, R., Lloyd, C. M., & Molyneaux, P. L. (2020) · Immunology · doi:10.1111/imm.13195 · Cited by 204
Mechanisms of Broad Cross-Protection Provided by Influenza Virus Infection and Their Application to Vaccines
Tamura, S., Tanimoto, T., & Kurata, T. (2005) · Japanese Journal of Infectious Diseases · doi:10.7883/yoken.jjid.2005.195 · Cited by 195
“Therefore, new and effective adjuvants may arise from the screening of materials that stimulate the function of APCs, including ganglioside GM1 and ligands of several TLRs (16-19, 79-84 ).”
Background
Pulmonary delivery of chitosan-DNA nanoparticles enhances the immunogenicity of a DNA vaccine encoding HLA-A*0201-restricted T-cell epitopes of Mycobacterium tuberculosis
Bivas‐Benita, M., van Meijgaarden, K. E., Franken, K. L. M. C., Junginger, H. E., Borchard, G., Ottenhoff, T. H. M., & Geluk, A. (2004) · Vaccine · doi:10.1016/j.vaccine.2003.09.044 · Cited by 195
Mycobacterial Infection in TLR2 and TLR6 Knockout Mice
Sugawara, I., Yamada, H., Li, C., Mizuno, S., Takeuchi, O., & Akira, S. (2003) · Microbiology and Immunology · doi:10.1111/j.1348-0421.2003.tb03404.x · Cited by 191
Self-citation
Peritumoral CpG DNA Elicits a Coordinated Response of CD8 T Cells and Innate Effectors to Cure Established Tumors in a Murine Colon Carcinoma Model
Heckelsmiller, K., Rall, K., Beck, S., Schlamp, A., Seiderer, J., Jahrsdörfer, B., Krug, A., Rothenfußer, S., Endres, S., & Hartmann, G. (2002) · The Journal of Immunology · doi:10.4049/jimmunol.169.7.3892 · Cited by 194
Genetic analysis of resistance to viral infection
Beutler, B., Eidenschenk, C., Crozat, K., Imler, J., Takeuchi, O., Hoffmann, J. A., & Akira, S. (2007) · Nature reviews. Immunology · doi:10.1038/nri2174 · Cited by 190
Self-citation
Differential Response of Dendritic Cells to Human Metapneumovirus and Respiratory Syncytial Virus
Guerrero-Plata, A., Casola, A., Suárez, G., Yu, X., Spetch, L., Peeples, M. E., & Garofalo, R. P. (2005) · American Journal of Respiratory Cell and Molecular Biology · doi:10.1165/rcmb.2005-0287oc · Cited by 193
“As far as the CpG-mediated IFN pathway in pDCs, CpG-ODN binds to the TLR9 in the endosomal compartment (46) and, similarly to the TLR7/8 (also expressed in the cell endosomes), activates IFN production via a mechanism that requires the adaptor molecules MyD88, IRAK-1, TRAF6, and TRAF3 (47).”
Background
Toll-Like Receptor 2 Is Required for Optimal Control of Listeria monocytogenes Infection
Torres, D., Barrier, M., Bihl, F., Quesniaux, V. J. F., Maillet, I., Akira, S., Ryffel, B., & Erard, F. (2004) · Infection and Immunity · doi:10.1128/iai.72.4.2131-2139.2004 · Cited by 191
“sponses induced by bacterial, nonmethylated DNA (16), could”
BackgroundSelf-citation
Neuronal injury mediated via stimulation of microglial toll-like receptor-9 (TLR9)
Iliev, A. I., Stringaris, A. K., Nau, R., & Neumann, H. (2004) · The FASEB Journal · doi:10.1096/fj.03-0670fje · Cited by 192
“Recently, unmethylated bacterial DNA has been shown to possess the capacity of inducing sustained inflammation via stimulation of TLR9 (4, 5).”
Background
Nucleic Acid-Sensing Toll-like Receptors Are Essential for the Control of Endogenous Retrovirus Viremia and ERV-Induced Tumors
Yu, P., Lübben, W., Slomka, H., Gebler, J., Konert, M., Cai, C., Neubrandt, L., Prazeres da Costa, O., Paul, S., Dehnert, S., et al. (2012) · Immunity · doi:10.1016/j.immuni.2012.07.018 · Cited by 192
Current prospects for mRNA gene delivery
Yamamoto, A., Kormann, M., Rosenecker, J., & Rudolph, C. (2008) · European Journal of Pharmaceutics and Biopharmaceutics · doi:10.1016/j.ejpb.2008.09.016 · Cited by 200
Chloroquine and inhibition of Toll-like receptor 9 protect from sepsis-induced acute kidney injury
Yasuda, H., Leelahavanichkul, A., Tsunoda, S., Dear, J. W., Takahashi, Y., Ito, S., Hu, X., Zhou, H., Doi, K., Childs, R. W., et al. (2008) · American Journal of Physiology-Renal Physiology · doi:10.1152/ajprenal.00461.2007 · Cited by 191
“Akira (Osaka University, Osaka, Japan) (17).”
Toll-like receptor 9 mediates CpG-DNA signaling
Chuang, T., Lee, J., Kline, L., Mathison, J. C., & Ulevitch, R. J. (2002) · Journal of Leukocyte Biology · doi:10.1189/jlb.71.3.538 · Cited by 192
“Using the gene-deletion approach, TLR9 has been shown as an essential element of responses to CpG-DNA in mouse [47].”
Silencing or Stimulation? siRNA Delivery and the Immune System
Whitehead, K. A., Dahlman, J. E., Langer, R., & Anderson, D. G. (2011) · Annual Review of Chemical and Biomolecular Engineering · doi:10.1146/annurev-chembioeng-061010-114133 · Cited by 200
Pivotal Advance: Inhibition of MyD88 dimerization and recruitment of IRAK1 and IRAK4 by a novel peptidomimetic compound
Loiarro, M., Capolunghi, F., Fantò, N., Gallo, G., Campo, S., Arseni, B., Carsetti, R., Carminati, P., Santis, R. D., Ruggiero, V., et al. (2007) · Journal of Leukocyte Biology · doi:10.1189/jlb.1206746 · Cited by 193
“In addition to IL-1RI and IL-1RAcP, mammals express at least 11 members (TLR1–11) of this family [5, 6], which are specialized in the recognition of microbial products, such as the lipid A moiety of Gram-negative bacterial LPS, a ligand of TLR4 [7], or nonmethylated CpG oligodeoxyribonucleotides, deriving from the bac…”
Background
New generation of mucosal adjuvants for the induction of protective immunity
Yuki, Y., & Kiyono, H. (2003) · Reviews in Medical Virology · doi:10.1002/rmv.398 · Cited by 194
“Because TLR9-knockout mice are completely defective in their responses to CpG, failing to exhibit cytokine production by macrophages, B cell proliferation and the maturation of DCs, it can be surmised that TLR9 plays an essential role in immunological responses to CpG [40].”
Toll-like receptors: function and roles in lung disease
Basu, S., & Fenton, M. J. (2004) · American Journal of Physiology-Lung Cellular and Molecular Physiology · doi:10.1152/ajplung.00323.2003 · Cited by 189
“Unmethylated CpG DNA is a TLR9 agonist that seems to have therapeutic potential in modulating eosinophilia and asthma (10, 41, 66, 71).”
BackgroundInfluential
The effect of probiotics on immune regulation, acne, and photoaging
Kober, M.-M., & Bowe, W. P. (2015) · International Journal of Women’s Dermatology · doi:10.1016/j.ijwd.2015.02.001 · Cited by 190
“The immune system recognizes both pathogenic and commensal bacteria through the family of Toll-like receptors (TLR) (Hemmi et al., 2000).”
Background
The Art of War: Innate and adaptive immune responses
Dempsey, P. W., Vaidya, S. A., & Cheng, G. (2003) · Cellular and Molecular Life Sciences · doi:10.1007/s00018-003-3180-y · Cited by 203
Intracellular vs extracellular recognition of pathogens – common concepts in mammals and flies
Girardin, S. E., Sansonetti, P. J., & Philpott, D. J. (2002) · Trends in Microbiology · doi:10.1016/s0966-842x(02)02334-x · Cited by 188
Distinct Mechanism of Helicobacter pylori-mediated NF-κB Activation between Gastric Cancer Cells and Monocytic Cells
Maeda, S., Akanuma, M., Mitsuno, Y., Hirata, Y., Ogura, K., Yoshida, H., Shiratori, Y., & Omata, M. (2001) · Journal of Biological Chemistry · doi:10.1074/jbc.m105381200 · Cited by 190
Toll-Like Receptor Signaling and Regulation of Cytokine Gene Expression in the Immune System
Ozato, K., Tsujimura, H., & Tamura, T. (2002) · BioTechniques · doi:10.2144/oct0208 · Cited by 189
Genome-wide DNA hypomethylation and RNA:DNA hybrid accumulation in Aicardi–Goutières syndrome
Lim, Y. W., Sanz, L. A., Xu, X., Hartono, S. R., & Chedin, F. L. (2015) · eLife · doi:10.7554/elife.08007 · Cited by 195
“, 2014) in addition to its canonical role in sensing unmethylated CpG-rich DNA (Hemmi et al., 2000).”
Background
Mechanisms of chemotherapy-induced behavioral toxicities
Vichaya, E. G., Chiu, G. S., Krukowski, K., Lacourt, T. E., Kavelaars, A., Dantzer, R., Heijnen, C. J., & Walker, A. K. (2015) · Frontiers in Neuroscience · doi:10.3389/fnins.2015.00131 · Cited by 197
“Interestingly, mitochondrial DNA (mtDNA) and bacterial DNA are both rich in CpG motifs which is the primary ligand of TLR-9, suggesting that mitochondrial damage induced release of mtDNA can be a potent stimulator of the immune system via TLR-9 activation (Zhang et al., 2010).”
BackgroundInfluential
In vivo administration of lentiviral vectors triggers a type I interferon response that restricts hepatocyte gene transfer and promotes vector clearance
Brown, B. D., Sitia, G., Annoni, A., Hauben, E., Sergi, L. S., Zingale, A., Roncarolo, M. G., Guidotti, L. G., & Naldini, L. (2006) · Blood · doi:10.1182/blood-2006-10-049312 · Cited by 187
TLR9-Targeted STAT3 Silencing Abrogates Immunosuppressive Activity of Myeloid-Derived Suppressor Cells from Prostate Cancer Patients
Hossain, D. M. S., Pal, S. K., Moreira, D., Duttagupta, P. A., Zhang, Q., Won, H., Jones, J. O., D’Apuzzo, M., Forman, S. J., & Kortylewski, M. (2015) · Clinical Cancer Research · doi:10.1158/1078-0432.ccr-14-3145 · Cited by 192
“This is consistent with the common expression of TLR9 in mouse myeloid cells (36).”
Signal transduction pathways mediated by the interaction of CpG DNA with Toll-like receptor 9
Takeshita, F., Gürsel, İ., Ishii, K. J., Suzuki, K., Gürsel, M., & Klinman, D. M. (2004) · Seminars in Immunology · doi:10.1016/j.smim.2003.10.009 · Cited by 189
“Northern blot analysis of various tissues including heart, brain, spleen, lung, liver, skeletal muscle, kidney, and testis indicated that murine TLR9 (mTLR9) transcripts were most abundantly expressed in spleen [11].”
Background
Role of adenosine receptors in regulating chemotaxis and cytokine production of plasmacytoid dendritic cells
Schnurr, M. M., Toy, T., Shin, A., Hartmann, G., Rothenfußer, S., Soellner, J., Davis, I. D., Cebon, J. S., & Maraskovsky, E. (2003) · Blood · doi:10.1182/blood-2003-06-1959 · Cited by 189
Pure Hemozoin Is Inflammatory In Vivo and Activates the NALP3 Inflammasome via Release of Uric Acid
Griffith, J. W., Sun, T., McIntosh, M. T., & Bucala, R. (2009) · The Journal of Immunology · doi:10.4049/jimmunol.0713552 · Cited by 187
Is targeting Toll‐like receptors and their signaling pathway a useful therapeutic approach to modulating cytokine‐driven inflammation?
Andreakos, E., Foxwell, B. M. J., & Feldmann, M. (2004) · Immunological Reviews · doi:10.1111/j.0105-2896.2004.00202.x · Cited by 191
“Genomic DNA released from dying cells has also been reported to activate human DCs, but whether TLR9 or another TLR is involved in that process has not yet been shown (110).”
BackgroundInfluential
Collaboration between the innate immune receptors dectin‐1, TLRs, and Nods
Underhill, D. M. (2007) · Immunological Reviews · doi:10.1111/j.1600-065x.2007.00548.x · Cited by 195
“Bauer S, et al. Human TLR9 confers respon- siveness to bacterial DNA via species-specific CpG motif recognition.”
BackgroundInfluential
Essential role of IRAK-4 protein and its kinase activity in Toll-like receptor–mediated immune responses but not in TCR signaling
Kawagoe, T., Sato, S., Jung, A., Yamamoto, M., Matsui, K., Kato, H., Uematsu, S., Takeuchi, O., & Akira, S. (2007) · The Journal of Experimental Medicine · doi:10.1084/jem.20061523 · Cited by 187
Self-citation
Toll-Like Receptor–Mediated Intestinal Inflammatory Imbalance in the Pathogenesis of Necrotizing Enterocolitis
Hackam, D. J., & Sodhi, C. P. (2018) · Cellular and Molecular Gastroenterology and Hepatology · doi:10.1016/j.jcmgh.2018.04.001 · Cited by 191
Rational designs of in vivo CRISPR-Cas delivery systems
Xu, C., Chen, G., Luo, Y., Zhang, Y., Zhao, G., Lu, Z.-D., Czarna, A., Gu, Z., & Wang, J. (2019) · Advanced Drug Delivery Reviews · doi:10.1016/j.addr.2019.11.005 · Cited by 187
CpG Still Rocks! Update on an Accidental Drug
Krieg, A. Μ. (2012) · Nucleic Acid Therapeutics · doi:10.1089/nat.2012.0340 · Cited by 184
“Five years after the discovery of the CpG motif, Toll-like receptor 9 (TLR9) was identiﬁed as the mediator of the immune stimulatory effects of CpG ODN (Hemmi et al., 2000).”
Crohn’s disease is associated with a toll-like receptor-9 polymorphism
Török, H., Glas, J., Tonenchi, L., Brünnler, G., Folwaczny, M., & Folwaczny, C. (2004) · Gastroenterology · doi:10.1053/j.gastro.2004.05.051 · Cited by 187
Role of TLR4 Tyrosine Phosphorylation in Signal Transduction and Endotoxin Tolerance
Medvedev, A. E., Piao, W., Shoenfelt, J. L., Rhee, S. H., Chen, H., Basu, S., Wahl, L. M., Fenton, M. J., & Vogel, S. N. (2007) · Journal of Biological Chemistry · doi:10.1074/jbc.m606781200 · Cited by 190
Local Modulation of Antigen-Presenting Cell Development after Resolution of Pneumonia Induces Long-Term Susceptibility to Secondary Infections
Roquilly, A., McWilliam, H. E. G., Jacqueline, C., Tian, Z., Cinotti, R., Rimbert, M., Wakim, L. M., Caminschi, I., Lahoud, M. H., Belz, G. T., et al. (2017) · Immunity · doi:10.1016/j.immuni.2017.06.021 · Cited by 195
DNA-stimulated cell death: implications for host defence, inflammatory diseases and cancer
Paludan, S. R., Reinert, L. S., & Hornung, V. (2019) · Nature reviews. Immunology · doi:10.1038/s41577-018-0117-0 · Cited by 187
Induction of immune responses by DNA vaccines in large animals
Babiuk, L. A. (2003) · Vaccine · doi:10.1016/s0264-410x(02)00574-1 · Cited by 186
Structural Analyses of Toll-like Receptor 7 Reveal Detailed RNA Sequence Specificity and Recognition Mechanism of Agonistic Ligands
Zhang, Z., Ohto, U., Shibata, T., Taoka, M., Yamauchi, Y., Sato, R., Shukla, N. M., David, S. A., Isobe, T., Miyake, K., et al. (2018) · Cell Reports · doi:10.1016/j.celrep.2018.11.081 · Cited by 195
Immune Sensing Mechanisms that Discriminate Self from Altered Self and Foreign Nucleic Acids
Bartok, E., & Hartmann, G. (2020) · Immunity · doi:10.1016/j.immuni.2020.06.014 · Cited by 190
Resistance to CpG DNA–induced autoimmunity through tolerogenic B cell antigen receptor ERK signaling
Rui, L., Vinuesa, C. G., Blasioli, J., & Goodnow, C. C. (2003) · Nature Immunology · doi:10.1038/ni924 · Cited by 184
“The proliferative response of B cells to CpG DNA is mediated by TLR9 and enhanced by simultaneous antibody cross-linking of the BC”
Background
Toll-Like Receptor 4 Mediates Innate Immune Responses to Haemophilus influenzae Infection in Mouse Lung
Wang, X., Moser, C., Louboutin, J., Lysenko, E. S., Weiner, D. J., Weiser, J. N., & Wilson, J. M. (2002) · The Journal of Immunology · doi:10.4049/jimmunol.168.2.810 · Cited by 185
“, peptidoglycans and lipoteichoic acid) (14, 15), mycobacteria (16) and fungi (17); and TLR9 recognizes nucleic acid motifs (18).”
Pharmacological modulation of nucleic acid sensors - therapeutic potential and persisting obstacles
Vanpouille-Box, C., Hoffmann, J. A., & Galluzzi, L. (2019) · Nature Reviews Drug Discovery · doi:10.1038/s41573-019-0043-2 · Cited by 183
The Hygiene Hypothesis of Atopic Disease–An Extended Version
Rautava, S., Ruuskanen, O., Ouwehand, A. C., Salminen, S., & Isolauri, E. (2004) · Journal of Pediatric Gastroenterology and Nutrition · doi:10.1097/00005176-200404000-00004 · Cited by 182
Conventional DCs reduce liver ischemia/reperfusion injury in mice via IL-10 secretion
Bamboat, Z. M., Ocuin, L. M., Balachandran, V. P., Obaid, H., Plitas, G., & DeMatteo, R. P. (2010) · Journal of Clinical Investigation · doi:10.1172/jci40008 · Cited by 188
Delivery of oligonucleotides with lipid nanoparticles
Wang, Y., Miao, L., Satterlee, A., & Huang, L. (2015) · Advanced Drug Delivery Reviews · doi:10.1016/j.addr.2015.02.007 · Cited by 184
“ONs containing unmethylated CpG dinucleotide motifs are recognized by the innate immune system through the pattern recognition receptor Toll Like Receptor 9 (TLR9) located inside the endosome [103].”
Background
A Bcl-2-dependent molecular timer regulates the lifespan and immunogenicity of dendritic cells
Hou, W.-S., & Parijs, L. V. (2004) · Nature Immunology · doi:10.1038/ni1071 · Cited by 184
“; and the TLR9 ligand cytosine-phosphate-guanine (CpG) DN”
Background
Induction of Systemic TH1-Like Innate Immunity in Normal Volunteers Following Subcutaneous but Not Intravenous Administration of CPG 7909, a Synthetic B-Class CpG Oligodeoxynucleotide TLR9 Agonist
Krieg, A. Μ., Efler, S. M., Wittpoth, M., Adhami, M. J. A., & Davis, H. L. (2004) · Journal of Immunotherapy · doi:10.1097/00002371-200411000-00006 · Cited by 183
Immunomodulatory and antitumor effects of type I interferons and their application in cancer therapy
Medrano, R. F. V., Hunger, A., Mendonça, S. A., Barbuto, J. A. M., & Strauss, B. E. (2017) · Oncotarget · doi:10.18632/oncotarget.19531 · Cited by 192
“In humans, TLR9 is expressed only in pDCs and B cells [258] and recognizes unmethylated CpG motifs that are found in bacterial and viral genomes [239].”
Background
Interaction of Viral Capsid-Derived Virus-Like Particles (VLPs) with the Innate Immune System
Mohsen, M. O., Gomes, A. C., Vogel, M., & Bachmann, M. F. (2018) · Vaccines · doi:10.3390/vaccines6030037 · Cited by 183
“The homologous TLR7/8 expressed within the endosomal compartments of APCs can recognize guanine nucleotide-homologues such as loxoribine, R848, imidazouinoline components, and uridine/guanosine rich ssRNA [47].”
Background

Authors: Hemmi, H., Takeuchi, O., Kawai, T., Kaisho, T., Sato, S., Sanjo, H., Matsumoto, M., Hoshino, K., Wagner, H., Takeda, K., & Akira, S.
Affiliations: Research Institute for Microbial Diseases, The University of Osaka (JP)
Japan Science and Technology Agency (JP)
Technical University of Munich (DE)
Corresponding author: Akira, Shizuo
ORCID: Hemmi, Hiroaki
Takeuchi, Osamu
Kawai, Taro
Kaisho, Tsuneyasu
Sato, Shintaro
Sanjo, Hideki
Hoshino, Katsuaki
Takeda, Kiyoshi
Akira, Shizuo
Venue: Nature
Publisher: Springer Science and Business Media LLC
Published: 2000-12-07
Volume: 408
Issue: 6813
Pages: 740-745
ISSN: 0028-0836 (ISSN-L)
1476-4687
DOI: 10.1038/35047123
OpenAlex: W1514540900
Cited by: 6,491
References: 33
Citations by year: 2026: 85 · 2025: 115 · 2024: 136 · 2023: 167 · 2022: 156 · 2021: 191 · 2020: 180 · 2019: 164 · 2018: 187 · 2017: 219 · 2016: 201 · 2015: 226 · 2014: 276 · 2013: 281 · 2012: 235
FWCI: 102.08
Type: journal article
Language: en
Open access: closed
Licence: www.springer.com/tdm (tdm)
www.springer.com/tdm (vor)
Locations: Nature (publishedVersion)
PubMed (publishedVersion)
RePEc: Research Papers in Economics (submittedVersion)
Funders: Japan Society for the Promotion of Science
Topics: Life Sciences › Immunology and Microbiology › Immunology › Immune Response and Inflammation
Life Sciences › Immunology and Microbiology › Immunology › Immunotherapy and Immune Responses
Life Sciences › Immunology and Microbiology › Immunology › T-cell and B-cell Immunology
Keywords: TLR9, CpG, innate immunity, T helper 1 response, adjuvants, vaccination, dendritic cell maturation, macrophage cytokine production, self-DNA, TLR9-deficient mice
MeSH terms: Amino Acid Sequence, Animals, Antigens, Differentiation, Base Sequence, Cells, Cultured, Cloning, Molecular, Dendritic Cells, DNA-Binding Proteins, DNA, Bacterial, T-Lymphocytes, Helper-Inducer, Humans, Membrane Glycoproteins, Mice, Inbred C57BL, Molecular Sequence Data, Receptors, Cell Surface, Receptors, Immunologic, Dinucleoside Phosphates, Signal Transduction, Cytokines, Mutagenesis, Sequence Homology, Amino Acid, Drosophila Proteins, Adaptor Proteins, Signal Transducing, Toll-Like Receptors, Toll-Like Receptor 9, Mice, Myeloid Differentiation Factor 88

About these checks

Registry, retraction, Cites and statistics results are computed, not judged, with one exception: a printed reference that no index lists is read once by a model before it counts as a citation error. Claims are extracted by a model and kept only when their quote appears verbatim in the text; each cited source is then checked, with a model’s help, for whether it says what the claim relies on. Those verdicts can be wrong — read the claim’s quote and the cited source before relying on one.

Statistics and arithmetic are recomputed, not judged.

Confidence bands are shown only for fields calibrated on our annotated test set. None is calibrated yet, so no band is shown.

What counts as a claim ›How we measure confidence ›How we check this ›

Are you an author, or do you see a problem with this page? Request a review

A Toll-like receptor recognizes bacterial DNA

Abstract

Overview

Integrity signals

Verification

Claims the paper makes

Claims other papers make about this one

Citations

Cites

Cited by

Related

Metadata

Record

About these checks