The DOI matches its Crossref record; 69 of the 70 references it cites were found in a registry or an index.
Placental hormones and the control of maternal metabolism and fetal growth
Abstract
PURPOSE OF REVIEW: To examine the roles of the placental and pituitary hormones in the control of maternal metabolism and fetal growth. RECENT FINDINGS: In addition to promoting growth of maternal tissues, placental growth hormone (GH-V) induces maternal insulin resistance and thereby facilitates the mobilization of maternal nutrients for fetal growth. Human placental lactogen (hPL) and prolactin increase maternal food intake by induction of central leptin resistance and promote maternal beta-cell expansion and insulin production to defend against the development of gestational diabetes mellitus. The effects of the lactogens are mediated by diverse signaling pathways and are potentiated by glucose. Pathologic conditions of pregnancy are associated with dysregulation of GH-V and hPL gene expression. SUMMARY: The somatogenic and lactogenic hormones of the placenta and maternal pituitary gland integrate the metabolic adaptations of pregnancy with the demands of fetal and neonatal development. Dysregulation of placental growth hormone and/or placental lactogen in pathologic conditions of pregnancy may adversely impact fetal growth and postnatal metabolic function.
Overview
Integrity signals
Registry
Cites
Statistics
Verification
Claims the paper makes
Claims other papers make about this one
Each is checked against this paper’s own text: does it say what the citing paper says it does?
In the citing paper
“This is perhaps not surprising given that a proportion of the nutrients that support fetal growth, particularly in late pregnancy, come from turnover of maternal fat reserves that are built up in early pregnancy (414).”
From Placental Origins of Chronic Disease (2016) · cites this paper as [414]
In the citing paper
“Progesterone also stimulates maternal appetite during early pregnancy, as does human placental lactogen (hPL), enabling the deposition of maternal adipose energy reserves that can be utilized later in pregnancy and during lactation (414).”
From Placental Origins of Chronic Disease (2016) · cites this paper as [414]
Citations
Cites
Effect of In Utero and Early-Life Conditions on Adult Health and Disease
Gluckman, P. D., Hanson, M. A., Cooper, C., & Thornburg, K. L. (2008) · New England Journal of Medicine · doi:10.1056/nejmra0708473 · Cited by 3,898
Nonadipose tissue production of leptin: Leptin as a novel placenta-derived hormone in humans
Masuzaki, H., Ogawa, Y., Sagawa, N., Hosoda, K., Matsumoto, T., Mise, H., Nishimura, H., Yoshimasa, Y., Tanaka, I., Mori, T., et al. (1997) · Nature Medicine · doi:10.1038/nm0997-1029 · Cited by 1,277
Cellular Mechanisms for Insulin Resistance in Normal Pregnancy and Gestational Diabetes
Barbour, L. A., McCurdy, C. E., Hernandez, T. L., Kirwan, J. P., Catalano, P. M., & Friedman, J. E. (2007) · Diabetes Care · doi:10.2337/dc07-s202 · Cited by 811
TNF-α Is a Predictor of Insulin Resistance in Human Pregnancy
Kirwan, J. P., Hauguel-De Mouzon, S., Lepercq, J., Challier, J.-C., Huston-Presley, L., Friedman, J. E., Kalhan, S. C., & Catalano, P. M. (2002) · Diabetes · doi:10.2337/diabetes.51.7.2207 · Cited by 738
Pregnancy-Stimulated Neurogenesis in the Adult Female Forebrain Mediated by Prolactin
Shingo, T., Gregg, C., Enwere, E. K., Fujikawa, H., Hassam, R., Geary, C. L., Cross, J. C., & Weiss, S. (2003) · Science · doi:10.1126/science.1076647 · Cited by 711
Meier, J. J., Butler, A. E., Saisho, Y., Monchamp, T., Galasso, R., Bhushan, A., Rizza, R. A., & Butler, P. C. (2008) · Diabetes · doi:10.2337/db07-1369 · Cited by 683
Endocrine Regulation of Human Fetal Growth: The Role of the Mother, Placenta, and Fetus
Murphy, V. E., Smith, R., Giles, W. B., & Clifton, V. L. (2006) · Endocrine Reviews · doi:10.1210/er.2005-0011 · Cited by 673
Maternal and Fetal Hypothalamic‐Pituitary‐Adrenal Axes During Pregnancy and Postpartum
MASTORAKOS, G., & ILIAS, I. (2003) · Annals of the New York Academy of Sciences · doi:10.1196/annals.1290.016 · Cited by 621
β cell replication is the primary mechanism for maintaining postnatal β cell mass
Georgia, S. K., & Bhushan, A. (2004) · Journal of Clinical Investigation · doi:10.1172/jci22098 · Cited by 510
Role of Gestational Hormones in the Induction of Insulin Resistance*
Ryan, E. A., & Enns, L. (1988) · The Journal of Clinical Endocrinology & Metabolism · doi:10.1210/jcem-67-2-341 · Cited by 401
Research works printed but not linked: 1
- Setia, 2009, Changes in GHIGF-1 axis in intrauterine growth retardation: consequences of fetal programming Horm Metab R, es, 41, 791
Cited by
Sorted by citations
Host Remodeling of the Gut Microbiome and Metabolic Changes during Pregnancy
Koren, O., Goodrich, J. K., Cullender, T. C., Spor, A., Laitinen, K., Kling Bäckhed, H., Gonzalez, A., Werner, J. J., Angenent, L. T., Knight, R., et al. (2012) · Cell · doi:10.1016/j.cell.2012.07.008 · Cited by 2,165
“Over the course of a normal, healthy pregnancy, the body undergoes substantial hormonal, immunological, and metabolic changes (Mor and Cardenas, 2010; Newbern and Freemark, 2011).”
BackgroundPhysiological changes in pregnancy
Soma-Pillay, P., Nelson-Piercy, C., Tolppanen, H., & Mebazaa, A. (2016) · Cardiovascular Journal of Africa · doi:10.5830/cvja-2016-021 · Cited by 1,483
“These hormones cause a decrease in insulin sensitivity in the peripheral tissues such as adipocytes and skeletal muscle by interfering with insulin receptor signalling.(32) The effect of the placental hormones on insulin sensitivity is made evident postpartum when there is a sudden decrease in insulin resistance.”
BackgroundThe Placenta: A Multifaceted, Transient Organ
Burton, G. J., & Fowden, A. L. (2015) · Philosophical Transactions of the Royal Society B: Biological Sciences · doi:10.1098/rstb.2014.0066 · Cited by 833
“During early pregnancy, they drive an increase in food intake and energy storage, whereas towards term, they mobilize these reserves to support fetal growth and preparation for lactation [66,67].”
BackgroundInfluentialPlacental Origins of Chronic Disease
Burton, G. J., Fowden, A. L., & Thornburg, K. L. (2016) · Physiological Reviews · doi:10.1152/physrev.00029.2015 · Cited by 717
Microbial Changes during Pregnancy, Birth, and Infancy
Nuriel‐Ohayon, M., Neuman, H., & Koren, O. (2016) · Frontiers in Microbiology · doi:10.3389/fmicb.2016.01031 · Cited by 647
“…that occur in the metabolic syndrome, including weight gain, elevated fasting bloodglucose levels, insulin resistance, glucose intolerance, lowgrade inflammation, and changes in metabolic hormone levels (Fuglsang, 2008; Newbern and Freemark, 2011; Emanuela et al., 2012; Kumar and Magon, 2012).”
BackgroundMicrobial endocrinology: the interplay between the microbiota and the endocrine system
Neuman, H., Debelius, J. W., Knight, R. D., & Koren, O. (2015) · FEMS Microbiology Reviews · doi:10.1093/femsre/fuu010 · Cited by 624
“Normally, hormones such as estrogen, progesterone and leptin increase dramatically with gestational age, while adiponectin and pituitary GH decrease (Newbern and Freemark 2011).”
BackgroundDevelopmental origins of metabolic diseases
Hoffman, D. J., Powell, T. L., Barrett, E. S., & Hardy, D. B. (2020) · Physiological Reviews · doi:10.1152/physrev.00002.2020 · Cited by 504
Pediatric Outcome after Maternal Cancer Diagnosed during Pregnancy
Amant, F. C., Vandenbroucke, T., Verheecke, M., Fumagalli, M., Halaska, M. J., Boere, I. A., Han, S., Gzirí, M. M., Peccatori, F. A., Rob, L., et al. (2015) · New England Journal of Medicine · doi:10.1056/nejmoa1508913 · Cited by 371
60 YEARS OF NEUROENDOCRINOLOGY: The hypothalamo-prolactin axis
Grattan, D. R. (2015) · Journal of Endocrinology · doi:10.1530/joe-15-0213 · Cited by 379
“…of b-cells in the islets (Parsons et al. 1992), enhanced insulin synthesis (Bone & Taylor 1976), and decreased threshold for glucose-stimulated insulin secretion (Sorenson & Parsons 1985), with prolactin playing a critical adaptive role in promoting these changes (Newbern & Freemark 2011).”
Connections between the human gut microbiome and gestational diabetes mellitus
Kuang, Y., Lu, J., Li, S., Li, J., Yuan, M., He, J., Chen, N., Xiao, W., Shen, S., Qiu, L., et al. (2017) · GigaScience · doi:10.1093/gigascience/gix058 · Cited by 322
Parrettini, S., Caroli, A., & Torlone, E. (2020) · Frontiers in Endocrinology · doi:10.3389/fendo.2020.611929 · Cited by 340
“Furthermore, hPL seems to have a direct plastic action on the b-cell mass, and induce insulin secretion (43, 57).”
BackgroundIlekis, J. V., Tsilou, E. T., Fisher, S. J., Abrahams, V. M., Soares, M. J., Cross, J. C., Zamudio, S., Illsley, N. P., Myatt, L., Colvis, C. M., et al. (2016) · American Journal of Obstetrics and Gynecology · doi:10.1016/j.ajog.2016.03.001 · Cited by 298
Pregnancy and cardiovascular disease
Ramlakhan, K. P., Johnson, M. R., & Roos‐Hesselink, J. W. (2020) · Nature Reviews Cardiology · doi:10.1038/s41569-020-0390-z · Cited by 316
Maternal vertical transmission affecting early-life microbiota development
Wang, S., Ryan, C. A., Boyaval, P., Dempsey, E. M., Ross, R. P., & Stanton, C. (2020) · Trends in Microbiology · doi:10.1016/j.tim.2019.07.010 · Cited by 243
Oxidative Stress in Pancreatic Beta Cell Regeneration
Wang, J., & Wang, H. (2017) · Oxidative Medicine and Cellular Longevity · doi:10.1155/2017/1930261 · Cited by 254
“Beta cell regeneration (neogenesis and proliferation) during the neonatal period is critical for the generation of sufficient pancreatic β cell mass/reserve and has a profound impact on long-term protection against T2D [1].”
BackgroundMetabolic Adaptations in Pregnancy: A Review
Zeng, Z., Liu, F., & Li, S. (2017) · Annals of Nutrition and Metabolism · doi:10.1159/000459633 · Cited by 234
Breast Cancer Diagnosed During Pregnancy
Loibl, S., Schmidt, A., Gentilini, O., Kaufman, B., Kuhl, C. K., Denkert, C., von Minckwitz, G., Parokonnaya, A. A., Stensheim, H., Thomssen, C., et al. (2015) · JAMA Oncology · doi:10.1001/jamaoncol.2015.2413 · Cited by 224
“Theplacenta is thecentralorganfor fetalmaternal exchange, in addition to its functions such as the protectionof the fetusandpreparing thematernalbody forpregnancyand subsequent lactation.(60)Althoughthetransplacental transferofpharmaceuticals canbewell analyzedusing theperfusedhumanexvivo placenta, toxic effects of ca…”
BackgroundOnly humans have human placentas: molecular differences between mice and humans
Schmidt, A., Prieto, D. M. M., Pastuschek, J., Fröhlich, K., & Markert, U. R. (2015) · Journal of Reproductive Immunology · doi:10.1016/j.jri.2015.03.001 · Cited by 233
Vallès, Y., Artacho, A., Pascual‐García, A., Ferrús, M. L., Gosalbes, M. J., Abellan, J. J., & Francino, M. P. (2014) · PLoS Genetics · doi:10.1371/journal.pgen.1004406 · Cited by 217
“The suite of changes that occur during late pregnancy [45,46] may facilitate the transport of maternal bacteria to the fetal GIT.”
BackgroundAntibiotic use during pregnancy: how bad is it?
Kuperman, A. A., & Koren, O. (2016) · BMC Medicine · doi:10.1186/s12916-016-0636-0 · Cited by 173
“Maternal gut and vaginal microbiome changes during normal pregnancy and pregnancy complications Pregnancy is characterized by profound hormonal, immunological, and metabolic changes aimed at supporting the growth of the fetoplacental unit [6].”
BackgroundOral microbiome and pregnancy: A bidirectional relationship
Saadaoui, M., Singh, P., & Khodor, S. A. (2021) · Journal of Reproductive Immunology · doi:10.1016/j.jri.2021.103293 · Cited by 184
Intrauterine growth restriction: Clinical consequences on health and disease at adulthood
Armengaud, J.-B., Yzydorczyk, C., Siddeek, B., Peyter, A., & Siméoni, U. (2020) · Reproductive Toxicology · doi:10.1016/j.reprotox.2020.10.005 · Cited by 178
New Insights Into Gestational Glucose Metabolism: Lessons Learned From 21st Century Approaches
Angueira, A. R., Ludvik, A. E., Reddy, T. E., Wicksteed, B. L., Lowe, W. L., & Layden, B. T. (2015) · Diabetes · doi:10.2337/db14-0877 · Cited by 165
“The mechanisms underlying the changes in insulin sensitivity have been detailed previously (6).”
BackgroundInfluentialThe Role of Placental Nutrient Sensing in Maternal-Fetal Resource Allocation1
Díaz, P., Powell, T. L., & Jansson, T. (2014) · Biology of Reproduction · doi:10.1095/biolreprod.114.121798 · Cited by 158
“There is a 60% increase in insulin secretion, which stimulates lipogenesis and reduces fatty acid oxidation, thereby promoting maternal lipid accumulation [8].”
BackgroundInfluentialGenetics of Recurrent Miscarriage: Challenges, Current Knowledge, Future Directions
Rull, K., Nagirnaja, L., & Laan, M. (2012) · Frontiers in Genetics · doi:10.3389/fgene.2012.00034 · Cited by 155
“…genes that regulate implantation, fetal and placental development, and maternal adaptation to pregnancy are synthesized by the fetus or the placenta, e.g., placental hormones as hCG, placental growth hormone and lactogen (Mannik et al., 2010; Nagirnaja et al., 2010; Newbern and Freemark, 2011).”
BackgroundThe Evolving Microbiome from Pregnancy to Early Infancy: A Comprehensive Review
Mesa, M. D., Loureiro, B., Iglesia, I., Gonzalez, S. F., Llurba, E., García‐Algar, Ó., Solana, M. J., Cabero-Pérez, M. J., Sainz, T., Martínez, L., et al. (2020) · Nutrients · doi:10.3390/nu12010133 · Cited by 151
“Pregnancy induces a number of immunological, hormonal, and metabolic changes necessary for the normal development of the fetus and for a timely onset of labor and successful delivery [1].”
BackgroundMaternal Fatty Acid Metabolism in Pregnancy and Its Consequences in the Feto-Placental Development
Duttaroy, A. K., & Basak, S. (2022) · Frontiers in Physiology · doi:10.3389/fphys.2021.787848 · Cited by 139
“Increased blood levels of human placental lactogen, placentally derived human growth hormone, human chorionic gonadotropin, progesterone, cortisol, prolactin, and other hormones increase insulin resistance in peripheral tissues such as adipocytes and skeletal muscle (Newbern and Freemark, 2011).”
BackgroundMuralimanoharan, S., Maloyan, A., & Myatt, L. (2016) · Clinical Science · doi:10.1042/cs20160076 · Cited by 137
Kamai, E. M., McElrath, T. F., & Ferguson, K. K. (2019) · Environmental Health · doi:10.1186/s12940-019-0480-8 · Cited by 138
“Key players include estrogen and progesterone, placental lactogen, placental growth hormone, and placental corticotropin-releasing hormone [70].”
BackgroundEarly life events influence whole-of-life metabolic health via gut microflora and gut permeability
Kerr, C. A., Grice, D. M., Tran, C. D., Bauer, D. C., Li, D., Hendry, P. L., & Hannan, G. N. (2014) · Critical Reviews in Microbiology · doi:10.3109/1040841x.2013.837863 · Cited by 129
“Throughout a healthy pregnancy the mother’s body undergoes substantial hormonal, immunological and metabolic changes (Mor & Cardenas, 2010; Newbern & Freemark, 2011).”
BackgroundSoliman, A., Lacasse, A., Lanoix, D., Sagrillo‐Fagundes, L., Boulard, V., & Vaillancourt, C. (2015) · Journal of Pineal Research · doi:10.1111/jpi.12236 · Cited by 114
Placental Nutrient Transport in Gestational Diabetic Pregnancies
Castillo‐Castrejón, M., & Powell, T. L. (2017) · Frontiers in Endocrinology · doi:10.3389/fendo.2017.00306 · Cited by 119
“The placenta secretes hormones such as estrogens, progesterone, growth hormone, and human placental lactogen which may contribute to the establishment and maintenance of pregnancy by regulating the maternal physiological adaptations to pregnancy (16).”
BackgroundHussain, T., Murtaza, G., Kalhoro, D. H., Kalhoro, M. S., Metwally, E., Chughtai, M. I., Mazhar, M. U., & Khan, S. A. (2021) · Animal Nutrition · doi:10.1016/j.aninu.2020.11.005 · Cited by 110
“Physiologically, estrogen, progesterone and leptin are greatly increased during pregnancy, whereas, adiponectin and pituitary gonadotropins are reduced (Newbern and Freemark, 2011).”
BackgroundGenetics of Gestational Diabetes Mellitus and Maternal Metabolism
Lowe, W. L., Scholtens, D. M., Sandler, V., & Hayes, M. G. (2016) · Current Diabetes Reports · doi:10.1007/s11892-015-0709-z · Cited by 108
Delhaes, F., Giza, S. A., Koreman, T., Eastabrook, G., McKenzie, C. A., Bedell, S., Regnault, T. R. H., & de Vrijer, B. (2018) · Placenta · doi:10.1016/j.placenta.2018.05.011 · Cited by 107
Zhou, L., & Xiao, X. (2017) · Bioscience Reports · doi:10.1042/bsr20171234 · Cited by 110
Changes in the Gut Microbiome and Pathologies in Pregnancy
Gorczyca, K., Obuchowska, A., Kimber-Trojnar, Ż., Wierzchowska-Opoka, M., & Leszczyńska‐Gorzelak, B. (2022) · International Journal of Environmental Research and Public Health · doi:10.3390/ijerph19169961 · Cited by 103
“During pregnancy, a number of metabolic, immune, and hormonal changes have an influence on the development of the fetus [13].”
BackgroundVerburg, P. E., Tucker, G. R. R., Scheil, W., Erwich, J. J., Dekker, G., & Roberts, C. T. (2016) · PLoS ONE · doi:10.1371/journal.pone.0158807 · Cited by 97
“Although insulin resistance is a feature of normal pregnancy[39], the male placenta may cause the mother to become relatively more insulin resistant and in association with other factors, this may increase the risk of GDM and macrosomia in male bearing pregnancies.”
BackgroundYung, H. W., Alnæs‐Katjavivi, P., Jones, C. J. P., El‐Bacha, T., Golić, M., Staff, A.-C., & Burton, G. J. (2016) · Diabetologia · doi:10.1007/s00125-016-4040-2 · Cited by 96
Roland, M. C. P., Friis, C. M., Godang, K., Bollerslev, J., Haugen, G. N., & Henriksen, T. (2014) · PLoS ONE · doi:10.1371/journal.pone.0087303 · Cited by 95
“The surface area of the villous tissue, a main determinant of the capacity to transport nutrients, is linearly related to placental weight [18], as is maternal plasma levels of placental hormones [19].”
BackgroundPlacental Regulation of Energy Homeostasis During Human Pregnancy
Armistead, B., Johnson, E., Vanderkamp, R., Kula-Eversole, E., Kadam, L., Drewlo, S., & Kohan‐Ghadr, H. (2020) · Endocrinology · doi:10.1210/endocr/bqaa076 · Cited by 99
The matter of the reproductive microbiome
Schoenmakers, S., Steegers‐Theunissen, R. P. M., & Faas, M. M. (2018) · Obstetric Medicine · doi:10.1177/1753495x18775899 · Cited by 91
“goes a series of physiological adaptions to prepare for support, protect and nurture the embryo and fetus.(32,33) Besides anatomical,”
BackgroundLaw, K. P., Han, T.-L., Mao, X., & Zhang, H. (2017) · Clinica Chimica Acta · doi:10.1016/j.cca.2017.02.018 · Cited by 91
Impacts of bisphenol A (BPA) and phthalate exposures on epigenetic outcomes in the human placenta
Strakovsky, R. S., & Schantz, S. L. (2018) · Current Zoology · doi:10.1093/eep/dvy022 · Cited by 94
McIlvride, S., Dixon, P. H., & Williamson, C. (2017) · Molecular Aspects of Medicine · doi:10.1016/j.mam.2017.05.003 · Cited by 90
“This fall in blood glucose is accompanied by enhanced insulin sensitivity in early pregnancy; however during the second and third trimesters there is marked insulin resistance (Newbern and Freemark, 2011).”
BackgroundInfluentialProlactin (PRL) in Adipose Tissue: Regulation and Functions
Ben‐Jonathan, N., & Hugo, E. R. (2014) · Advances in experimental medicine and biology · doi:10.1007/978-3-319-12114-7_1 · Cited by 88
Cholesterol cholelithiasis in pregnant women: pathogenesis, prevention and treatment
de Bari, O., Wang, T. Y., Liu, M., Paik, C. N., Portincasa, P., & Wang, D. Q. ‐. (2014) · Annals of Hepatology · doi:10.1016/s1665-2681(19)30975-5 · Cited by 88
Mallott, E. K., Borries, C., Koenig, A., Amato, K. R., & Lu, A. (2020) · Scientific Reports · doi:10.1038/s41598-020-66865-2 · Cited by 89
Pregnancy‐induced changes in β‐cell function: what are the key players?
Salazar‐Petres, E., & Sferruzzi-Perri, A. N. (2021) · The Journal of Physiology · doi:10.1113/jp281082 · Cited by 91
“…induced by increased levels of placental and maternal hormones, including placental lactogen, growth hormone variant, progesterone, cortisol and PRL, which interfere with insulin receptor signalling particularly during the third trimester of pregnancy (Newbern & Freemark, 2011; Napso et al. 2018).”
BackgroundSex Differences: A Resultant of an Evolutionary Pressure?
Torre, S. D., & Maggi, A. C. (2017) · Cell Metabolism · doi:10.1016/j.cmet.2017.01.006 · Cited by 88
“Placental hormones are the main driver of such a change (Burton and Fowden, 2015; Hull and Harvey, 2001; Milona et al., 2010; Newbern and Freemark, 2011).”
BackgroundHypoxia and Mitochondrial Dysfunction in Pregnancy Complications
Hu, X., & Zhang, L. (2021) · Antioxidants · doi:10.3390/antiox10030405 · Cited by 93
The Emerging Role of Biomarkers in the Diagnosis of Gestational Diabetes Mellitus
Rodrigo, N., & Glastras, S. J. (2018) · Journal of Clinical Medicine · doi:10.3390/jcm7060120 · Cited by 90
“Human placental growth hormone (hPGH) concentrations also increase during pregnancy, increasing peripheral insulin resistance [65,67].”
BackgroundCannabis Use in Pregnancy in British Columbia and Selected Birth Outcomes
Luke, S., Hutcheon, J. A., & Kendall, T. (2019) · Journal of Obstetrics and Gynaecology Canada · doi:10.1016/j.jogc.2018.11.014 · Cited by 86
Sibiak, R., Jankowski, M., Gutaj, P., Mozdziak, P. E., Kempisty, B., & Wender-Ożegowska, E. (2020) · Journal of Clinical Medicine · doi:10.3390/jcm9041142 · Cited by 83
“Although the PL expression is only present in placental tissue cells, it is considered to play a significant role in the regulation of both maternal and fetal metabolic adaptations throughout the pregnancy [19,27].”
BackgroundProlactin receptor targeting in breast and prostate cancers: New insights into an old challenge
Goffin, V. (2017) · Pharmacology & Therapeutics · doi:10.1016/j.pharmthera.2017.05.009 · Cited by 82
Maternal gut microbiota in the health of mothers and offspring: from the perspective of immunology
Lu, X., Shi, Z., Jiang, L., & Zhang, S. (2024) · Frontiers in Immunology · doi:10.3389/fimmu.2024.1362784 · Cited by 95
Immunoendocrine Dysregulation during Gestational Diabetes Mellitus: The Central Role of the Placenta
Olmos‐Ortiz, A., Flores‐Espinosa, P., Dı́az, L., Velázquez, P., Ramírez-Isarraraz, C., & Zaga‐Clavellina, V. (2021) · International Journal of Molecular Sciences · doi:10.3390/ijms22158087 · Cited by 81
“Derived from this structural homology, lactogens share with GH their binding capacity to both somatogenic and lactogenic receptors [89].”
BackgroundMöllers, L. S., Yousuf, E. I., Hamatschek, C., Morrison, K. M., Hermanussen, M., Fusch, C., & Rochow, N. (2021) · Pediatric Research · doi:10.1038/s41390-021-01566-8 · Cited by 76
Natural Physiological Changes During Pregnancy
Chandra, M., & Paray, A. A. (2024) · The Yale Journal of Biology and Medicine · doi:10.59249/jtiv4138 · Cited by 76
“These hormones lessen the sensitivity of peripheral tissues, such as adipocytes and skeletal muscle, to insulin by inter - fering with insulin receptor signaling [23].”
BackgroundHjort, L., Novakovic, B., Grunnet, L. G., Maple-Brown, L. J., Damm, P., Desoyé, G., & Saffery, R. (2019) · The Lancet Diabetes & Endocrinology · doi:10.1016/s2213-8587(19)30078-6 · Cited by 76
When a Neonate Is Born, So Is a Microbiota
Coscia, A., Bardanzellu, F., Caboni, E., Fanos, V., & Peroni, D. G. (2021) · Life · doi:10.3390/life11020148 · Cited by 77
Elevated Placental Adenosine Signaling Contributes to the Pathogenesis of Preeclampsia
Iriyama, T., Sun, K., Parchim, N. F., Li, J. L., Zhao, C., Song, A., Hart, L. A., Blackwell, S. C., Sibai, B. M., Chan, L.-N. L., et al. (2014) · Circulation · doi:10.1161/circulationaha.114.013740 · Cited by 73
“is an endocrine organ that synthesizes and secretes multiple hormones, neurotransmitters, and vasoactive factors.(5,6)”
BackgroundAdipokines, an adipose tissue and placental product with biological functions during pregnancy
D’Ippolito, S., Tersigni, C., Scambia, G., & Simone, N. D. (2012) · BioFactors · doi:10.1002/biof.201 · Cited by 74
“[7] Newbern, D.”
BackgroundPlacental mitochondrial dysfunction with metabolic diseases: Therapeutic approaches
Hebert, J. F., & Myatt, L. (2020) · Biochimica et Biophysica Acta (BBA) - Molecular Basis of Disease · doi:10.1016/j.bbadis.2020.165967 · Cited by 73
“The release of human placental growth hormone (hPGH) and human placental lactogen (hPL) by the syncytiotrophoblast early in pregnancy drives an increase in maternal energy storage, particularly in the form of triglycerides and glycogen [46,47].”
BackgroundNovel roles of mechanistic target of rapamycin signaling in regulating fetal growth†
Gupta, M. B., & Jansson, T. (2018) · Biology of Reproduction · doi:10.1093/biolre/ioy249 · Cited by 71
Trosvik, P., de Muinck, E. J., Rueness, E. K., Fashing, P. J., Beierschmitt, E. C., Callingham, K. R., Kraus, J. B., Trew, T. H., Moges, A., Mekonnen, A. D., et al. (2018) · Microbiome · doi:10.1186/s40168-018-0468-6 · Cited by 70
“metabolic changes [45, 46], and substantial remodeling of the GI microbiome has been documented from the first to the third trimester [47].”
BackgroundAlptekin, H., Çizmecioğlu, A., Işık, H., Cengiz, T., Yildiz, M., & Iyisoy, M. S. (2016) · Journal of Endocrinological Investigation · doi:10.1007/s40618-015-0427-z · Cited by 67
“In addition, human placental lactogen and prolactin improve the mother’s appetite by increasing leptin resistance and promote maternal beta-cell expansion and insulin production to defend against the development of GDM [14].”
BackgroundPrescribing physical activity to prevent and manage gestational diabetes
Colberg, S. R. (2013) · World Journal of Diabetes · doi:10.4239/wjd.v4.i6.256 · Cited by 67
Chiu, Y., Mínguez‐Alarcón, L., Ford, J. B., Keller, M. G., Seely, E. W., Messerlian, C., Petrozza, J. C., Williams, P. L., Ye, X., Calafat, A. M., et al. (2017) · The Journal of Clinical Endocrinology & Metabolism · doi:10.1210/jc.2017-00022 · Cited by 66
Genetics, genomics and metabolomics: new insights into maternal metabolism during pregnancy
Lowe, W. L., & Karban, J. (2013) · Diabetic Medicine · doi:10.1111/dme.12352 · Cited by 65
Ecological succession in the vaginal microbiota during pregnancy and birth
Rasmussen, M. A., Thorsen, J., Domínguez-Bello, M. G., Blaser, M. J., Mortensen, M. S., Brejnrod, A., Shah, S. A., Hjelmsø, M. H., Lehtimäki, J., Trivedi, U., et al. (2020) · The ISME Journal · doi:10.1038/s41396-020-0686-3 · Cited by 65
Retnakaran, R., Ye, C., Kramer, C. K., Connelly, P. W., Hanley, A. J., Sermer, M., & Zinman, B. (2016) · Diabetes Care · doi:10.2337/dc16-0043 · Cited by 64
“Of note, the peak of b-cell proliferation coincides with increased circulating levels of prolactin and HPL, supporting the importance of these hormones in this context (9).”
BackgroundGonzález, P., Gasperowicz, M., Barbeito‐Andrés, J., Klenin, N., Cross, J. C., & Hallgrímsson, B. (2016) · PLoS ONE · doi:10.1371/journal.pone.0152227 · Cited by 62
“Human placenta-specific hormones related to Growth Hormone have been implicated in regulation of maternal metabolism and fetal growth [36] and are the most obvious candidates.”
BackgroundGut Microbiome Changes in Gestational Diabetes
Ionescu, R. F., Enache, R. M., Creţoiu, S. M., & Gașpar, B. S. (2022) · International Journal of Molecular Sciences · doi:10.3390/ijms232112839 · Cited by 69
“During pregnancy, physiological changes that aim to maintain the health of the mother and the fetus, can modify the microbiota of the gut, oral cavity, and vagina of the mother [30].”
BackgroundLü, C., Pasupulati, A. K., Sun, J., Aggarwal, A., Fan, Y., Sperling, M. A., Lumeng, C. N.-K., & Menon, R. K. (2013) · Journal of Biological Chemistry · doi:10.1074/jbc.m113.460212 · Cited by 63
“The decrease in insulin sensitivity observed during puberty and in gestational diabetes is, in part, attributed to increased GH action (1, 2).”
BackgroundZhou, P., Zhao, Y., Zhang, P., Li, Y., Gui, T., Wang, J., Jin, C., Che, L., Li, J., Lin, Y., et al. (2017) · Frontiers in Microbiology · doi:10.3389/fmicb.2017.02242 · Cited by 63
“…period is a key window for both mother and offspring with tremendous hormonal, metabolic and immunological changes occurring in the maternal body (Newbern and Freemark, 2011), during which microbiota remodeling is thought to be a positive response for mother to support a successful pregnancy…”
BackgroundGestational Diabetes, Maternal Obesity, and the NCD Burden
Ronald, C. W., Chan, J. C. N., Tam, W. H., Hanson, M. A., & Gluckman, P. D. (2013) · Clinical Obstetrics & Gynecology · doi:10.1097/grf.0b013e31829e5bb0 · Cited by 62
“During pregnancy, the delivery of nutrients such as glucose, fatty acids, and amino acids to the fetus is optimized(32) through a range of maternal metabolic changes, induced by placental factors including placental lactogen, growth hormone, and leptin.(33) These induce a state of relative maternal insulin resistance,…”
BackgroundThe parental brain and behavior: A target for endocrine disruption
Keller, M., Vandenberg, L. N., & Charlier, T. D. (2019) · Frontiers in Neuroendocrinology · doi:10.1016/j.yfrne.2019.100765 · Cited by 64
Fetal and maternal metabolic responses to exercise during pregnancy
Mottola, M. F., & Artal, R. (2016) · Early Human Development · doi:10.1016/j.earlhumdev.2016.01.008 · Cited by 62
Bedell, S., Hutson, J. R., de Vrijer, B., & Eastabrook, G. D. M. (2020) · Current Vascular Pharmacology · doi:10.2174/1570161118666200616144512 · Cited by 94
Dietary fiber and microbiota interaction regulates sow metabolism and reproductive performance
Tian, M., Chen, J., Liu, J., Chen, F., Guan, W., & Zhang, S. (2020) · Animal nutrition · doi:10.1016/j.aninu.2020.10.001 · Cited by 61
“As a result, the stability of the intestinal flora structure is fragile and easily broken (Newbern and Freemark, 2011).”
BackgroundOsorio, J. S., Trevisi, E., Ballou, M., Bertoni, G., Drackley, J. K., & Loor, J. J. (2013) · Journal of Dairy Science · doi:10.3168/jds.2012-5759 · Cited by 58
“Human and rat studies reported that influence of the pituitary on fetal growth might be overridden by hormones, such as growth hormone, lactogen, and leptin (Farley et al., 2010; Newbern and Freemark, 2011).”
BackgroundStages of pregnancy and weaning influence the gut microbiota diversity and function in sows
Ji, Y., Li, H., Xie, P., Li, Z., Li, H. W., Yin, Y., Blachier, F., & Kong, X. (2019) · Journal of Applied Microbiology · doi:10.1111/jam.14344 · Cited by 59
“The relationships between pregnancy and gut microbiota are of particular interest since pregnancy is characterized by dramatic changes in hormones, immune functions and metabolism to support the growth of the mother and foetoplacental unit (Newbern and Freemark 2011).”
BackgroundEllerbrock, J., Spaanderman, B., van Drongelen, J., Mulder, E., van Balen, V. A. L., Schiffer, V. M. M. M., Jorissen, L. M., Alers, R., Leenen, J., Ghossein‐Doha, C., et al. (2022) · Nutrients · doi:10.3390/nu14122444 · Cited by 68
“GDM is thought to originate when beta cell function cannot be sufficiently upregulated relative to the increased insulin resistance [3].”
BackgroundSferruzzi-Perri, A. N., Lopez-Tello, J., Napso, T., & Yong, H. E. J. (2020) · Placenta · doi:10.1016/j.placenta.2020.01.015 · Cited by 58
Li, H., Miao, C., Liu, W., Gao, H., Li, W., Wu, Z., Cao, H., & Zhu, Y. (2022) · Diabetes Metabolic Syndrome and Obesity · doi:10.2147/dmso.s378964 · Cited by 57
“In pregnant women, several suggested mechanisms contribute to the state of IR, which is prone to generate metabolic disorders, chronic inflammation, and related disorders (eg, diabetes, hypertension, dyslipidemia).(15,16) Therefore, it is essential to be aware of complications during pregnancy.”
BackgroundZampieri, T. T., Ramos-Lobo, A. M., Furigo, I. C., Pedroso, J. A. B., Buonfiglio, D. D. C., & Donato, J. (2014) · Molecular Metabolism · doi:10.1016/j.molmet.2014.12.005 · Cited by 59
Melnik, B. C., John, S. M., & Schmitz, G. (2015) · Journal of Translational Medicine · doi:10.1186/s12967-014-0377-9 · Cited by 59
“Dysregulation of placental growth hormones in pathologic conditions of pregnancy adversely affects fetal growth and postnatal metabolic function [106].”
BackgroundRetnakaran, R. R., Ye, C., Kramer, C. K., Connelly, P. W., Hanley, A. J., Sermer, M., & Zinman, B. (2016) · The Journal of Clinical Endocrinology & Metabolism · doi:10.1210/jc.2016-1402 · Cited by 56
Janssen, A. B., Capron, L., O’Donnell, K. J., Tunster, S. J., Ramchandani, P. G., Heazell, A. E. P., Glover, V. A. S., & John, R. M. (2016) · Psychological Medicine · doi:10.1017/s0033291716001598 · Cited by 55
“…(Diplas et al. 2009); hPL forward: CATGACTCCCAGACCTCCTTC and reverse: TGCGGAGCAGCTCTAGATTG (Dutton et al. 2012). hPL primers were designed to analyse the expression of CSH1/hPL-A and CSH2/hPL-B, from which the majority of circulating placental lactogens is derived (Newbern & Freemark, 2011).”
BackgroundSerotonin transporter deficiency drives estrogen-dependent obesity and glucose intolerance
Zha, W., Ho, H. T. B., Hu, T., Hébert, M. F., & Wang, J. (2017) · Scientific Reports · doi:10.1038/s41598-017-01291-5 · Cited by 58
Dunlop, A. L., Knight, A. K., Satten, G. A., Cutler, A. J., Wright, M. L., Mitchell, R., Read, T. D., Mullé, J. G., Hertzberg, V., Hill, C. C., et al. (2019) · PeerJ · doi:10.7717/peerj.8004 · Cited by 60
Endoplasmic reticulum stress responses in placentation - A true balancing act
Bastida-Ruiz, D., Aguilar, E. R. C., Ditisheim, A., Yart, L., & Cohen, M. (2017) · Placenta · doi:10.1016/j.placenta.2017.07.004 · Cited by 54
“These changes in the endocrine regulation ensure an adequate circulating blood glucose level to fulfill the fetus demand [67].”
BackgroundHabibi, N., Mousa, A., Tay, C. T., Khomami, M. B., Patten, R. K., Andraweera, P. H., Wassie, M., Vandersluys, J., Aflatounian, A., Bianco‐Miotto, T., et al. (2022) · Diabetes/Metabolism Research and Reviews · doi:10.1002/dmrr.3532 · Cited by 53
Bile acids metabolism in the gut-liver axis mediates liver injury during lactation
Huang, L. S., Li, Y., Tang, R., Yang, P., Zhuo, Y., Jiang, X., Che, L., Lin, Y., Xu, S., Li, J., et al. (2023) · Life Sciences · doi:10.1016/j.lfs.2023.122380 · Cited by 53
Metabolomics in gestational diabetes
Mao, X., Chen, X., Chen, C., Zhang, H., & Law, K. P. (2017) · Clinica Chimica Acta · doi:10.1016/j.cca.2017.10.019 · Cited by 53
Liu, Y., Qin, S., Feng, Y., Song, Y., Lv, N., Liu, F., Zhang, X., Wang, S., Wei, Y., Li, S., et al. (2020) · Journal of Developmental Origins of Health and Disease · doi:10.1017/s2040174420000768 · Cited by 54
Fetoplacental vasculature as a model to study human cardiovascular endocrine disruption
Lorigo, M., & Cairrão, E. (2021) · Molecular Aspects of Medicine · doi:10.1016/j.mam.2021.101054 · Cited by 50
Rassie, K. L., Giri, R., Joham, A. E., Teede, H. J., & Mousa, A. (2022) · International Journal of Molecular Sciences · doi:10.3390/ijms232415621 · Cited by 63
“It has been widely implicated in pregnancy-induced insulin resistance, maternal beta cell adaptation to pregnancy, and regulation of fetal growth in pre-clinical studies [3,9].”
BackgroundIntestinal dysbiosis: An emerging cause of pregnancy complications?
Zhang, D., Huang, Y., & Ye, D. (2015) · Medical Hypotheses · doi:10.1016/j.mehy.2014.12.029 · Cited by 50
“Furthermore, maternal maladaptations may result in several pregnancy disorders, including intrauterine growth restriction (IUGR), spontaneous miscarriages and preeclampsia (PE) [2–4,6,10–13].”
BackgroundInfluential
Metadata
- Authors
- Newbern, D., & Freemark, M.
- Affiliations
- Duke University (US)
- Corresponding author
- Newbern, Dorothee
- Venue
- Current Opinion in Endocrinology, Diabetes & Obesity
- Published
- 2011-12
- Volume
- 18
- Issue
- 6
- Pages
- 409-416
- ISSN
- 1752-296X (ISSN-L)
- OpenAlex
- W2160934677
- Cited by
- 487
- References
- 70
- Citations by year
- 2026: 15 · 2025: 27 · 2024: 43 · 2023: 24 · 2022: 46 · 2021: 49 · 2020: 54 · 2019: 40 · 2018: 35 · 2017: 34 · 2016: 33 · 2015: 27 · 2014: 28 · 2013: 19 · 2012: 12
- FWCI
- 2.63
- Type
- journal article
- Language
- en
- Open access
- closed
- Locations
- Current Opinion in Endocrinology Diabetes and Obesity (publishedVersion)
- PubMed (publishedVersion)
- Funders
- Endocrine Fellows Foundation
- National Institutes of Health
- Topics
- Health Sciences › Medicine › Endocrinology, Diabetes and Metabolism › Growth Hormone and Insulin-like Growth Factors
- Health Sciences › Medicine › Obstetrics and Gynecology › Pregnancy and preeclampsia studies
- Health Sciences › Medicine › Obstetrics and Gynecology › Gestational Diabetes Research and Management
- Keywords
- placental hormones, maternal metabolism, fetal growth, placental growth hormone, human placental lactogen, prolactin, leptin resistance, maternal insulin resistance, gestational diabetes mellitus, beta-cell expansion, glucose signaling, pregnancy complications, pituitary hormones
- MeSH terms
- Female, Fetus, Glucocorticoids, Humans, Insulin, Maternal-Fetal Exchange, Pituitary Gland, Placenta, Placental Hormones, Pregnancy, Leptin, Fetal Development, Adipokines
About these checks
Registry, retraction, Cites and statistics results are computed, not judged, with one exception: a printed reference that no index lists is read once by a model before it counts as a citation error. Claims are extracted by a model and kept only when their quote appears verbatim in the text; each cited source is then checked, with a model’s help, for whether it says what the claim relies on. Those verdicts can be wrong — read the claim’s quote and the cited source before relying on one.
Statistics and arithmetic are recomputed, not judged.
Confidence bands are shown only for fields calibrated on our annotated test set. None is calibrated yet, so no band is shown.
What counts as a claim ›How we measure confidence ›How we check this ›
Are you an author, or do you see a problem with this page? Request a review
