Cited by 762Gut microbiota and healthClostridium difficile and Clostridium perfringens researchMicrobial Community Ecology and Physiology

The DOI matches its Crossref record; 51 of the 51 references it cites were found in a registry or an index.

Characterization of Bacterial Communities in Feces from Healthy Elderly Volunteers and Hospitalized Elderly Patients by Using Real-Time PCR and Effects of Antibiotic Treatment on the Fecal Microbiota

Open access

Bartosch, Sabine, Fite, Alemu, Macfarlane, George T., McMurdo, Marion E. T.·2004·Applied and Environmental Microbiology

DOI 10.1128/aem.70.6.3575-3581.2004PMC PMC427772

Open this paper in CoChat — free account

Abstract

Fecal bacteria were studied in healthy elderly volunteers (age, 63 to 90 years;n= 35) living in the local community, elderly hospitalized patients (age, 66 to 103;n= 38), and elderly hospitalized patients receiving antibiotic treatment (age, 65 to 100;n= 21). Group- and species-specific primer sets targeting 16S rRNA genes were used to quantitate intestinal bacteria by using DNA extracted from feces and real-time PCR. The principal difference between healthy elderly volunteers and both patient cohorts was a marked reduction in the Bacteroides-Prevotella group following hospitalization. Reductions in bifidobacteria,Desulfovibrio spp.,Clostridium clostridiiforme, and Faecalibacterium prausnitzii were also found in the hospitalized patients. However, total 16S rRNA gene copy numbers (per gram of wet weight of feces) were generally lower in the stool samples of the two groups of hospitalized patients compared to the number in the stool samples of elderly volunteers living in the community, so the relative abundance (percentage of the group- and species-specific rRNA gene copies in relation to total bacterial rRNA gene copies) of bifidobacteria,Desulfovibrio spp.,C. clostridiiforme, and F. prausnitzii did not change. Antibiotic treatment resulted in further reductions in the numbers of bacteria and their prevalence and, in some patients, complete elimination of certain bacterial communities. Conversely, the numbers of enterobacteria increased in the hospitalized patients who did not receive antibiotics, and due to profound changes in fecal microbiotas during antibiotic treatment, the opportunistic species Enterococcus faecalis proliferated.

The claims and statistics of this paper haven’t been checked yet.

Run the check — free, no account needed. It reads the open-access text and checks the sources it cites.

Integrity signals

Registry

Crossref · 10.1128/aem.70.6.3575-3581.2004

Cites

51 of 51 references verified0 citation errors · 0 not checkable

Statistics

Claims the paper makes

The claims and statistics of this paper haven’t been checked yet.

Run the check — free, no account needed. It reads the open-access text and checks the sources it cites.

Claims other papers make about this one

Each is checked against this paper’s own text: does it say what the citing paper says it does?

Self-check

Percentages, sums and reported differences re-computed from the paper’s own numbers.

The self-check needs the paper’s full text.

Bergey's Manual of Systematic Bacteriology
(1990) · Annals of Internal Medicine · doi:10.7326/0003-4819-112-5-391_3 · Cited by 15,633
Determination of bacterial load by real-time PCR using a broad-range (universal) probe and primers set
Nadkarni, M. A., Martin, F. E., Jacques, N. A., & Hunter, N. (2002) · Microbiology · doi:10.1099/00221287-148-1-257 · Cited by 1,931
Direct analysis of genes encoding 16S rRNA from complex communities reveals many novel molecular species within the human gut
Suau, A., Bonnet, R., Sutren, M., Godon, J.-J., Gibson, G. R., Collins, M. D., & Doré, J. (1999) · Applied and Environmental Microbiology · doi:10.1128/aem.65.11.4799-4807.1999 · Cited by 1,490
The Ribosomal Database Project (RDP-II): previewing a new autoaligner that allows regular updates and the new prokaryotic taxonomy
Cole, J. R. (2003) · Nucleic Acids Research · doi:10.1093/nar/gkg039 · Cited by 1,435
Temperature Gradient Gel Electrophoresis Analysis of 16S rRNA from Human Fecal Samples Reveals Stable and Host-Specific Communities of Active Bacteria
Zoetendal, E. G., Akkermans, A. D. L., & de Vos, W. M. (1998) · Applied and Environmental Microbiology · doi:10.1128/aem.64.10.3854-3859.1998 · Cited by 1,360
rrndb: the Ribosomal RNA Operon Copy Number Database
Klappenbach, J., Saxman, P., Cole, J., & Schmidt, T. M. (2001) · Nucleic Acids Res. · doi:10.1093/nar/29.1.181 · Cited by 1,140
Quantitative fluorescence in situ hybridization of Bifidobacterium spp. with genus-specific 16S rRNA-targeted probes and its application in fecal samples
Langendijk-Genevaux, P. S., Schut, F., Jansen, G. J., Raangs, G. C., Kamphuis, G. R., Wilkinson, M. H. F., & Welling, G. W. (1995) · Applied and Environmental Microbiology · doi:10.1128/aem.61.8.3069-3075.1995 · Cited by 974
Effect of antimicrobial agents on the ecological balance of human microflora
Sullivan, Å., Edlund, C., & Nord, C. E. (2001) · The Lancet Infectious Diseases · doi:10.1016/s1473-3099(01)00066-4 · Cited by 816
Growth requirements and fermentation products of Fusobacterium prausnitzii, and a proposal to reclassify it as Faecalibacterium prausnitzii gen. nov., comb. nov
Duncan, S. H., Hold, G. L., Harmsen, H. J. M., Stewart, C. S., & Flint, H. J. (2002) · INTERNATIONAL JOURNAL OF SYSTEMATIC AND EVOLUTIONARY MICROBIOLOGY · doi:10.1099/00207713-52-6-2141 · Cited by 753
Development of 16S rRNA-Gene-Targeted Group-Specific Primers for the Detection and Identification of Predominant Bacteria in Human Feces
Matsuki, T., Watanabe, K., Fujimoto, J., Miyamoto, Y., Takada, T., Matsumoto, K., Oyaizu, H., & Tanaka, R. (2002) · Applied and Environmental Microbiology · doi:10.1128/aem.68.11.5445-5451.2002 · Cited by 663

Flagged first, then by citations

Show all 51 references

Research works printed but not linked: 2

10.1111/j.1574-6968.1991.tb04588.x · DOI
Mitsuoka, T., K. Hayakawa, and N. Kimura. 1974. Die Faekalflora bei Menschen II. Mitteilung: Die Zusammensetzung der Bifidobakterienflora der verschiedenen Altersgruppen. Zentbl. Bakteriol. Hyg. Abt. 1 Orig. A226:469-478.

Sorted by citations

Items 301–400 of 761

Effects of Whole Milk Supplementation on Gut Microbiota and Cardiometabolic Biomarkers in Subjects with and without Lactose Malabsorption
Li, X., Yin, J., Zhu, Y., Wang, X., Hu, X., Bao, W., Huang, Y., Chen, L., Chen, S., Yang, W. Q., et al. (2018) · Nutrients · doi:10.3390/nu10101403 · Cited by 48
Comparative study of a new quantitative real-time PCR targeting the xylulose-5-phosphate/fructose-6-phosphate phosphoketolase bifidobacterial gene (xfp) in faecal samples with two fluorescence in situ hybridization methods
Cleusix, V., Lacroix, C., Dasen, G., Meile, L., & Blay, G. L. (2009) · Journal of Applied Microbiology · doi:10.1111/j.1365-2672.2009.04408.x · Cited by 46
Diverse effects of oats on cholesterol metabolism in C57BL/6 mice correlate with expression of hepatic bile acid-producing enzymes
Andersson, K. E., Axling, U., Xu, J., Swärd, K., Ahrné, S., Molin, G., Holm, C., & Hellstrand, P. (2012) · European Journal of Nutrition · doi:10.1007/s00394-012-0479-1 · Cited by 45
Clostridium butyricumCombined withBifidobacterium infantisProbiotic Mixture Restores Fecal Microbiota and Attenuates Systemic Inflammation in Mice with Antibiotic-Associated Diarrhea
Ling, Z., Liu, X., Cheng, Y., Luo, Y., Li, Y., Li, L., & Xiang, C. (2015) · BioMed Research International · doi:10.1155/2015/582048 · Cited by 47
Lactobacillus plantarum IFPL935 Favors the Initial Metabolism of Red Wine Polyphenols When Added to a Colonic Microbiota
Barroso, E., Sánchez‐Patán, F., Martín-Álvarez, P. J., Bartolomé, B., Moreno-Arribas, M. V., Peláez, C., Requena, T., de Wiele, T. V., & Martínez‐Cuesta, M. C. (2013) · Journal of Agricultural and Food Chemistry · doi:10.1021/jf402816r · Cited by 46
Gut microbiota in older subjects: variation, health consequences and dietary intervention prospects
O’Connor, E. M., O’Herlihy, E. A., & O’Toole, P. W. (2014) · Proceedings of The Nutrition Society · doi:10.1017/s0029665114000597 · Cited by 45
“Bacteroides is difficult to determine given the effect of other factors such as antibiotics treatment and hospitalisation which need to be considered((113)).”
Background
Unexpected consequences of administering bacteriocinogenic probiotic strains for Salmonella populations, revealed by an in vitro colonic model of the child gut
Zihler, A., Gagnon, M., Chassard, C., Hegland, A., Stevens, M. J. A., Braegger, C., & Lacroix, C. (2010) · Microbiology · doi:10.1099/mic.0.042036-0 · Cited by 47
A combination of the probiotic and prebiotic product can prevent the germination of Clostridium difficile spores and infection
Rätsep, M., Kõljalg, S., Sepp, E., Smidt, I., Truusalu, K., Songisepp, E., Štšepetova, J., Naaber, P., Mikelsaar, R.-H., & Mikelsaar, M. (2017) · Anaerobe · doi:10.1016/j.anaerobe.2017.03.019 · Cited by 45
“The 320 purified plasmids were quantified by spectrophotometry (Quibit, Invitrogen) of 321 multiple dilutions [20].”
Method
The gut microbiome but not the resistome is associated with urogenital schistosomiasis in preschool-aged children
Osakunor, D. N. M., Munk, P., Mduluza, T., Petersen, T. N., Brinch, C., Ivens, A. C., Chimponda, T. N., Amanfo, S., Murray, J., Woolhouse, M. E. J., et al. (2020) · Communications Biology · doi:10.1038/s42003-020-0859-7 · Cited by 45
A novel 3D in vitro model of the human gut microbiota
Biagini, F., Calvigioni, M., Lapomarda, A., Vecchione, A., Magliaro, C., Maria, C. D., Montemurro, F., Celandroni, F., Mazzantini, D., Mattioli‐Belmonte, M., et al. (2020) · Scientific Reports · doi:10.1038/s41598-020-78591-w · Cited by 44
Chemically Defined Diet Alters the Protective Properties of Fructo-Oligosaccharides and Isomalto-Oligosaccharides in HLA-B27 Transgenic Rats
Koleva, P. T., Ketabi, A., Valcheva, R. S., Gänzle, M. G., & Dieleman, L. A. (2014) · PLoS ONE · doi:10.1371/journal.pone.0111717 · Cited by 45
P1A Recombinant β-Lactamase Prevents Emergence of Antimicrobial Resistance in Gut Microflora of Healthy Subjects during Intravenous Administration of Ampicillin
Tarkkanen, A.-M., Heinonen, T., Jögi, R., Mentula, S., van der Rest, M. E., Donskey, C. J., Kemppainen, T., Gurbanov, K., & Nord, C. E. (2009) · Antimicrobial Agents and Chemotherapy · doi:10.1128/aac.00853-08 · Cited by 45
“PCR of TEM -lactamase genes (blaTEM) existing in the fecal samples of the study subjects (3).”
Background
Lactiplantibacillus plantarum Postbiotics: Alternative of Antibiotic Growth Promoter to Ameliorate Gut Health in Broiler Chickens
Chang, H. M., Loh, T. C., Foo, H. L., & Lim, E. T. C. (2022) · Frontiers in Veterinary Science · doi:10.3389/fvets.2022.883324 · Cited by 50
Current and future uses of real-time polymerase chain reaction and microarrays in the study of intestinal microbiota, and probiotic use and effectiveness
Carey, C. M., Kirk, J. L., Ojha, S., & Kostrzynska, M. (2007) · Canadian Journal of Microbiology · doi:10.1139/w07-039 · Cited by 45
Lactobacillus plantarum BSGP201683 Isolated from Giant Panda Feces Attenuated Inflammation and Improved Gut Microflora in Mice Challenged with Enterotoxigenic Escherichia coli
Liu, Q., Ni, X., Wang, Q., Peng, Z., Niu, L., Wang, H., Zhou, Y., Sun, H., Pan, K., Jing, B., et al. (2017) · Frontiers in Microbiology · doi:10.3389/fmicb.2017.01885 · Cited by 44
Zinc hydroxychloride supplementation improves tibia bone development and intestinal health of broiler chickens
Nguyen, H. T. T., Morgan, N. K., Roberts, J. R., Wu, S., Swick, R. A., & Toghyani, M. (2021) · Poultry Science · doi:10.1016/j.psj.2021.101254 · Cited by 44
Dynamics of integron structures across a wastewater network – Implications to resistance gene transfer
Baluja, M. Q., Frigon, D., Abouelnaga, M. I., Jobling, K., Romalde, J. L., López, M. G., & Graham, D. W. (2021) · Water Research · doi:10.1016/j.watres.2021.117720 · Cited by 44
Characterization of human intestinal bifidobacteria using competitive PCR and PCR-TTGE
Mangin, I., Suau, A., Magne, F., Garrido, D. A., Gotteland, M., Neut, C., & Pochart, P. (2005) · FEMS Microbiology Ecology · doi:10.1111/j.1574-6941.2005.00005.x · Cited by 44
The Potential Effects of Quercetin-Loaded Nanoliposomes on Amoxicillin/Clavulanate-Induced Hepatic Damage: Targeting the SIRT1/Nrf2/NF-κB Signaling Pathway and Microbiota Modulation
El-Emam, M. M. A., Mostafa, M., Farag, A. A., Youssef, H. S., El-Demerdash, A. S., Bayoumi, H., Gebba, M. A., El-Halawani, S. M., Saleh, A. M., Badr, A. M., et al. (2023) · Antioxidants · doi:10.3390/antiox12081487 · Cited by 44
Oral Administration of Saccharomyces boulardii Ameliorates Carbon Tetrachloride-Induced Liver Fibrosis in Rats via Reducing Intestinal Permeability and Modulating Gut Microbial Composition
Li, M., Zhu, L., Xie, A., & Yuan, J. (2014) · Inflammation · doi:10.1007/s10753-014-0019-7 · Cited by 43
“leptumR1367 for Clostridium leptum [28], and Enco-F and Enco-R for Enterococcus faecalis [29].”
Background
Microbial communities present in the lower respiratory tract of clinically healthy birds in Pakistan
Shabbir, M. Z., Malys, T., Ivanov, Y. V., JiHye, P., Shabbir, M. A. B., Rabbani, M., Yaqub, T., & Harvill, E. T. (2015) · Poultry Science · doi:10.3382/ps/pev010 · Cited by 42
“Added to this, varying clinical consequences of bacterial infection with respect to breed and age have been reported (Glisson, 1998; Bartosch et al., 2004; Cox et al., 2010).”
Background
Does release of encapsulated nutrients have an important role in the efficacy of xylanase in broilers?
Khadem, A. G., Lourenço, M. R. A., Delezie, E., Maertens, L., Goderis, A., Mombaerts, R., Höfte, M., Eeckhaut, V., Immerseel, F. V., & Janssens, G. P. J. (2016) · Poultry Science · doi:10.3382/ps/pew002 · Cited by 43
“Bacterial groups/ Functional gene Primers (5′-3′) Reference Enterobacteriaceae F1 : CATTGACGTTACCCGCAGAAGAAGC Bartosch et al., 2004 R2 : CTCTACGAGACTCAAGCTTGC Clostridium cluster I F : TACCHRAGGAGGAAGCCAC Song et al., 2004 R : GTTCTTCCTAATCTCTACGCAT Clostridium cluster IV F : GCACAAGCAGTGGAGT…”
Background
In Vitro Evaluation of Different Prebiotics on the Modulation of Gut Microbiota Composition and Function in Morbid Obese and Normal-Weight Subjects
Nogacka, A. M., Salazar, N., Arboleya, S., Ruas‐Madiedo, P., Mancabelli, L., Suárez, A., Faedo, C. M., Ventura, M., Tochio, T., Hirano, K., et al. (2020) · International Journal of Molecular Sciences · doi:10.3390/ijms21030906 · Cited by 43
“Absolute levels of some relevant intestinal microbial groups (Bacteroides–Prevotella–Porphyromonas group, Lactobacillus group, Akkermansia, Clostridium cluster XIVa, Bifidobacterium and Faecalibacterium genus), as well as total bacteria, were determined at 0 and 24 h of fermentation by qPCR using previously described…”
Method
Gut microbiota differs between treatment outcomes early after fecal microbiota transplantation against recurrent Clostridioides difficile infection
Wei, S., Bahl, M. I., Baunwall, S. M. D., Dahlerup, J. F., Hvas, C. L., & Licht, T. R. (2022) · Gut Microbes · doi:10.1080/19490976.2022.2084306 · Cited by 43
Impact of Gut Microbiota in Brain Ageing: Polyphenols as Beneficial Modulators
Sarubbo, F., Moranta, D., Tejada, S., Jiménez-García, M., & Esteban, S. (2023) · Antioxidants · doi:10.3390/antiox12040812 · Cited by 44
“On the contrary, others microorganisms are associated with a reduction of frailty in older populations, such as the Bacteroidetes family [68–70], or the species Clostridium cluster XIVa and Faecalibacterium prausnitzii [68,70,71].”
Background
Stability and efficacy of frozen and lyophilized fecal microbiota transplant (FMT) product in a mouse model of Clostridium difficile infection (CDI)
Jiang, Z., Alexander, A., Shi, K., Valilis, E., Hu, S., Li, B., & DuPont, H. L. (2017) · Anaerobe · doi:10.1016/j.anaerobe.2017.08.003 · Cited by 42
“F GGGTGGTAATGCCGGATG 442 bp [12] R TAAGCGATGGACTTTCACACC Lactobacillu spp.”
Background
Gut Microbiota Modulation, Anti-Diabetic and Anti-Inflammatory Properties of Polyphenol Extract from Mung Bean Seed Coat (Vigna radiata L.)
Charoensiddhi, S., Chanput, W. P., & Sae‐tan, S. (2022) · Nutrients · doi:10.3390/nu14112275 · Cited by 42
The search for disease-associated compositional shifts in bowel bacterial communities of humans
Tannock, G. W. (2008) · Trends in Microbiology · doi:10.1016/j.tim.2008.07.005 · Cited by 42
Characterization of Fecal Microbiota across Seven Chinese Ethnic Groups by Quantitative Polymerase Chain Reaction
Kwok, L., Zhang, J., Guo, Z., Gesudu, Q., Zheng, Y., Qiao, J., Huo, D., & Zhang, H. (2014) · PLoS ONE · doi:10.1371/journal.pone.0093631 · Cited by 41
Effect of early antibiotic administration on cecal bacterial communities and their metabolic profiles in pigs fed diets with different protein levels
Zhang, C., Yu, M., Yang, Y., Mu, C., Su, Y., & Zhu, W. (2016) · Anaerobe · doi:10.1016/j.anaerobe.2016.10.016 · Cited by 42
Dietary proline supplementation alters colonic luminal microbiota and bacterial metabolite composition between days 45 and 70 of pregnancy in Huanjiang mini-pigs
Ji, Y., Guo, Q., Yin, Y., Blachier, F., & Kong, X. (2018) · Journal of Animal Science and Biotechnology/Journal of animal science and biotechnology · doi:10.1186/s40104-018-0233-5 · Cited by 41
“coccoides Firmicutes F: AAATGACGGTACCTGACTAA R: CTTTGAGTTTCATTCTTGCGAA 440 [65]”
Prebiotic effects of pectooligosaccharides obtained from lemon peel on the microbiota from elderly donors using an in vitro continuous colon model (TIM-2)
Míguez, B., Vila, C., Venema, K., Parajó, J. C., & Alonsó, J. L. (2020) · Food & Function · doi:10.1039/d0fo01848a · Cited by 43
Gastrointestinal Microbiota and Their Contribution to Healthy Aging
Mello, A. M., Paroni, G., Daragjati, J., & Pilotto, A. (2016) · Digestive Diseases · doi:10.1159/000443350 · Cited by 40
Modeling Metabolic Interactions in a Consortium of the Infant Gut Microbiome
Pinto, F. R., Medina, D. A., Pérez‐Correa, J. R., & Garrido, D. A. (2017) · Frontiers in Microbiology · doi:10.3389/fmicb.2017.02507 · Cited by 40
“, 2004); and for La, LACTO_F (5-TGGAAACAGRTGCTAATACCG3) and LACTO_R (5-GTCCATTGTGGAAGATTCCC-3) (Bartosch et al., 2004).”
Method
Effects of Probiotics and Prebiotics on Frailty and Ageing: A Narrative Review
Jayanama, K., & Theou, O. (2019) · Current Clinical Pharmacology · doi:10.2174/1574884714666191120124548 · Cited by 43
Effects of Bifidobacterium breve on inflammatory gene expression in neonatal and weaning rat intestine
Ohtsuka, Y., Ikegami, T., Izumi, H., Namura, M., Ikeda, T., Ikuse, T., Baba, Y., Kudo, T., Suzuki, R., & Shimizu, T. (2011) · Pediatric Research · doi:10.1038/pr.2011.11 · Cited by 39
New insights into the impact of Lactobacillus population on host-bacteria metabolic interplay
Roy, C. I. L., Štšepetova, J., Sepp, E., Songisepp, E., Claus, S. P., & Mikelsaar, M. (2015) · Oncotarget · doi:10.18632/oncotarget.5906 · Cited by 39
“In order to establish a quantitative assay, we cloned plasmids containing the amplified region of the target bacteria L. paracasei using the pGEM-T vector system (Promega, Madison, WI, USA) [64].”
Fecal microbial characterization of hospitalized patients with suspected infectious diarrhea shows significant dysbiosis
Braun, T., Segni, A. D., BenShoshan, M., Asaf, R., Squires, J. E., Barhom, S. F., Saar, E. G., Cesarkas, K., Smollan, G., Weiss, B., et al. (2017) · Scientific Reports · doi:10.1038/s41598-017-01217-1 · Cited by 40
The response of canine faecal microbiota to increased dietary protein is influenced by body condition
Xu, J., Verbrugghe, A., Lourenço, M., Cools, A., Liu, D. J. X., van de Wiele, T., Marzorati, M., Eeckhaut, V., van Immerseel, F., Vanhaecke, L., et al. (2017) · BMC Veterinary Research · doi:10.1186/s12917-017-1276-0 · Cited by 39
“Enterobacteriaceae fwd CATTGACGTTACCCGCAGAAGAAGC [59]”
Impact of polyols on Oral microbiome of Estonian schoolchildren
Štšepetova, J., Truu, J., Runnel, R., Nõmmela, R., Saag, M., Olak, J., Nõlvak, H., Preem, J., Oopkaup, K., Krjutškov, K., et al. (2019) · BMC Oral Health · doi:10.1186/s12903-019-0747-z · Cited by 45
Defining the Role of Gut Bacteria in the Metabolism of Deleobuvir: In Vitro and In Vivo Studies
McCabe, M., Sane, R. S., Keith-Luzzi, M., Xu, J., King, I., Whitcher-Johnstone, A., Johnstone, N., Tweedie, D. J., & Li, Y. (2015) · Drug Metabolism and Disposition · doi:10.1124/dmd.115.064477 · Cited by 37
Consumption effect of a synbiotic beverage made from soy and yacon extracts containing Bifidobacterium animalis ssp. lactis BB-12 on the intestinal polyamine concentrations in elderly individuals
Manzoni, M. S. J., Rossi, E. A., Pauly-Silveira, N. D., Pinto, R. A., Roselino, M. N., Carlos, I. Z., Quilles, M. B., Glória, M. B. A., & Cavallini, D. (2017) · Food Research International · doi:10.1016/j.foodres.2017.06.005 · Cited by 39
“In this context, an investigation has been conducted to monitor bacterial groups in stool samples obtained from older people, thus reporting that elderly people that still had relatively high levels of fecal bifidobacteria were very cognizant and lively (Bartosch et al., 2004).”
Background
Synbiotic yogurt consumption by healthy adults and the elderly: the fate of bifidobacteria and LGG probiotic strain
Granata, M., Brandi, G., Borsari, A., Gasbarri, R., & Gioia, D. D. (2012) · International Journal of Food Sciences and Nutrition · doi:10.3109/09637486.2012.718742 · Cited by 38
“…is quite stable from the weaning period throughout life until the seventh decade when some significant changes occur: bifidobacteria decrease in favour of clostridia, streptococci and enterobacteria (Hopkins and Macfarlane 2002; Saunier and Dorè 2002; Bartosch et al. 2004; Claesson et al. 2011).”
Background
Abundance of Enterobacteriaceae in the colon mucosa in diverticular disease
Linninge, C., Roth, B., Erlanson‐Albertsson, C., Molin, G., Tóth, E., & Ohlsson, B. (2018) · World Journal of Gastrointestinal Pathophysiology · doi:10.4291/wjgp.v9.i1.18 · Cited by 38
In vitro fecal fermentation characteristics of bamboo shoot (Phyllostachys edulis) polysaccharide
Li, Q., Wu, W., Chen, H., Fang, X., Han, Y., Xie, M., & Gao, H. (2021) · Food Chemistry X · doi:10.1016/j.fochx.2021.100129 · Cited by 38
Colostrum of Healthy Slovenian Mothers: Microbiota Composition and Bacteriocin Gene Prevalence
Obermajer, T., Lipoglavšek, L., Tompa, G., Treven, P., Lorbeg, P. M., Matijašić, B. B., & Rogelj, I. (2015) · PLoS ONE · doi:10.1371/journal.pone.0123324 · Cited by 38
Spinach consumption ameliorates the gut microbiota and dislipaemia in rats with diet-induced non-alcoholic fatty liver disease (NAFLD)
Elvira-Torales, L. I., Periago, M. J., González‐Barrio, R., Hidalgo, N., NAVARRO-GONZÁLEZ, I., Gómez-Gallego, C., Masuero, D., Soini, E., Vrhovšek, U., & García-Alonso, F. J. (2019) · Food & Function · doi:10.1039/c8fo01630e · Cited by 38
Preparation and characterization of selenium enriched- Bifidobacterium longum DD98, and its repairing effects on antibiotic-induced intestinal dysbacteriosis in mice
Zhu, H., Zhou, Y., Qi, Y., Ji, R., Zhang, J., Qian, Z., Wu, C., Tan, J., Shao, L., & Chen, D. (2019) · Food & Function · doi:10.1039/c9fo00960d · Cited by 37
A study of the prebiotic-like effects of tomato juice consumption in rats with diet-induced non-alcoholic fatty liver disease (NAFLD)
García-Alonso, F. J., González‐Barrio, R., Martín‐Pozuelo, G., Hidalgo, N., NAVARRO-GONZÁLEZ, I., Masuero, D., Soini, E., Vrhovšek, U., & Periago, M. J. (2017) · Food & Function · doi:10.1039/c7fo00393e · Cited by 38
Exploring the Effect of Probiotics, Prebiotics, and Postbiotics in Strengthening Immune Activity in the Elderly
Akatsu, H. (2021) · Vaccines · doi:10.3390/vaccines9020136 · Cited by 38
“For example, Toll-like receptor 5 (TLR5) mediates the sensing of common GM-produced compounds by immune cells, and bacterial flagellin promotes host antibody titers and plasma cell growth [25].”
Background
Effect of prebiotics on the health of the elderly
Scheid, M. M. A., Moreno, Y. M. F., Maróstica, M. R., & Pastore, G. M. (2013) · Food Research International · doi:10.1016/j.foodres.2013.04.003 · Cited by 37
Increased EHEC survival and virulence gene expression indicate an enhanced pathogenicity upon simulated pediatric gastrointestinal conditions
Roussel, C., Cordonnier, C., Galia, W., Goff, O. L., Thévenot, J., Chalançon, S., Alric, M., Thévenot-Sergentet, D., Leriche, F., de Wiele, T. V., et al. (2016) · Pediatric Research · doi:10.1038/pr.2016.144 · Cited by 36
PCR-based diagnostics for anaerobic infections
Song, Y. (2005) · Anaerobe · doi:10.1016/j.anaerobe.2004.10.006 · Cited by 36
Probiotics and Prebiotics in Elderly Individuals
Salminen, S., Satokari, R. M., Rantanen, R., & Pitkälä, K. H. (2009) · CRC Press eBooks · doi:10.1201/9781420062151.ch16 · Cited by 38
The Association between Modulating Inflammatory Cytokines and Constipation of Geriatrics in Iran
Mokhtare, M., Alimoradzadeh, R., Agah, S., Mirmiranpour, H., & Khodabandehloo, N. (2017) · Middle East Journal of Digestive Diseases · doi:10.15171/mejdd.2017.78 · Cited by 35
Role of systemic infection, cross contaminations and super‐shedders in Salmonella carrier state in chicken
Menanteau, P., Kempf, F., Trotereau, J., Virlogeux‐Payant, I., Gitton, E., Dalifard, J., Gabriel, I., Rychlı́k, I., & Velge, P. (2018) · Environmental Microbiology · doi:10.1111/1462-2920.14294 · Cited by 35
Enhanced E. coli LF82 Translocation through the Follicle-associated Epithelium in Crohn’s Disease is Dependent on Long Polar Fimbriae and CEACAM6 expression, and Increases Paracellular Permeability
Keita, Å. V., Alkaissi, L. Y., Holm, E. B., Heil, S. D. S., Chassaing, B., Darfeuille–Michaud, A., McKay, D. M., & Söderholm, J. D. (2019) · Journal of Crohn s and Colitis · doi:10.1093/ecco-jcc/jjz144 · Cited by 35
The effect of storage conditions on microbial communities in stool
Zyl, K. N. V., Whitelaw, A. C., & Newton-Foot, M. (2020) · PLoS ONE · doi:10.1371/journal.pone.0227486 · Cited by 35
“, 2008 R: AGCTGACGACAACCATGCAC Enterobacteriaceae F: CATTGACGTTACCCGCAGAAGAAGC 195 [18] Bartosch et al.”
Background
Carob fruit extract-enriched meat, as preventive and curative treatments, improves gut microbiota and colonic barrier integrity in a late-stage T2DM model
Macho‐González, A., Garcimartín, A., Redondo, N., Cofrades, S., Bastida, S., Nova, E., Benedí, J., Sánchez-Muniz, F. J., Marcos, A., & López‐Oliva, M. E. (2021) · Food Research International · doi:10.1016/j.foodres.2021.110124 · Cited by 37
Long-Term Safety and Efficacy of Prebiotic Enriched Infant Formula—A Randomized Controlled Trial
Neumer, F., Urraca, O., Alonso, J. J., Palencia, J., Varea, V., Theis, S., Rodríguez-Palmero, M., Moreno-Muñoz, J. A., Guarner, F., Veereman, G., et al. (2021) · Nutrients · doi:10.3390/nu13041276 · Cited by 39
Emerging frontiers of antibiotics use and their impacts on the human gut microbiome
Kumari, R., Yadav, Y., Misra, R., Das, U., Adhikari, U. D., Malakar, P., & Dubey, G. P. (2022) · Microbiological Research · doi:10.1016/j.micres.2022.127127 · Cited by 37
Detection of antibiotic resistant E. coli and Enterococcus spp. in stool of healthy growing children in Portugal
Barreto, Â., Guimarães, B., Radhouani, H., Araújo, C., Gonçalves, A., Gaspar, E., Rodrigues, J., Igrejas, G., & Poeta, P. A. C. Q. D. (2009) · Journal of Basic Microbiology · doi:10.1002/jobm.200900124 · Cited by 36
“A blaTEM gene was identified by PCR in 33 of 37 ampicillin-resistant isolates; the combination blaTEM + blaSHV in two isolates and the blaSHV gene alone in one isolate.”
BackgroundInfluential
Dietary pea fibre alters the microbial community and fermentation with increase in fibre degradation‐associated bacterial groups in the colon of pigs
Luo, Y., Chen, H., Yu, B., He, J., Zheng, P., Mao, X., Yu, J., Luo, J., Huang, Z., & Chen, D. (2017) · Journal of Animal Physiology and Animal Nutrition · doi:10.1111/jpn.12736 · Cited by 37
Diet-Microbiota-Health Interactions in Older Subjects: Implications for Healthy Aging
Lynch, D. B., Jeffery, I. B., Cusack, S., O’Connor, E. M., & O’Toole, P. W. (2014) · Interdisciplinary topics in gerontology and geriatrics · doi:10.1159/000364976 · Cited by 35
Pathogenic Factors Involved in the Development of Irritable Bowel Syndrome: Focus on a Microbial Role
Bolino, C., & Berčík, P. (2010) · Infectious Disease Clinics of North America · doi:10.1016/j.idc.2010.07.005 · Cited by 34
Antipsychotics and the microbiota
Chen, A., Park, T. Y., Li, K. J., & DeLisi, L. E. (2020) · Current Opinion in Psychiatry · doi:10.1097/yco.0000000000000594 · Cited by 34
“Specific microbial taxa were associated with reduced frailty in elderly population, including Bacteriodetes, Clostridium cluster XIVa, and Faecalibacterium prausnitzii [20].”
Background
Microbes in Infant Gut Development: Placing Abundance Within Environmental, Clinical and Growth Parameters
Obermajer, T., Grabnar, I., Benedik, E., Tušar, T., Pikel, T. R., Mis, N. F., Matijašić, B. B., & Rogelj, I. (2017) · Scientific Reports · doi:10.1038/s41598-017-10244-x · Cited by 33
“Subjects experiencing health complications at birth (3) diverged from the majority of healthy individuals (54) by relative abundance of Bifidobacterium (m: 2.”
Background
The role of gut microbiota in human metabolism and inflammatory diseases: a focus on elderly individuals
Khaledi, M., Poureslamfar, B., Alsaab, H. O., Tafaghodi, S., Hjazi, A. M., Singh, R., Alawadi, A. H., Alsaalamy, A. H., Qasim, Q. A., & Sameni, F. (2024) · Annals of Microbiology · doi:10.1186/s13213-023-01744-5 · Cited by 50
“…strains and infections, and a microbiota that has been impacted by antibiotics, which may have fewer numbers and species, which can favor the establishment of opportunistic species like Enterococcus faecalis (Bartosch et al. 2004) and even increase the risk of C. difficile (Kwok et al. 2012).”
Background
Lactobacillus sakei modulates mule duck microbiota in ileum and ceca during overfeeding
Vasaï, F., Ricaud, K., Cauquil, L., Daniel, P., Peillod, C., Gontier, K., Tizaoui, A., Bouchez, O., Combes, S., & Davail, S. (2014) · Poultry Science · doi:10.3382/ps.2013-03497 · Cited by 33
Lactobacillus paracasei subsp. paracasei LC01 positively modulates intestinal microflora in healthy young adults
Zhang, H., Sun, J., Liu, X., Hong, C., Zhu, Y., Liu, A., Li, S., Guo, H., & Ren, F. (2013) · The Journal of Microbiology · doi:10.1007/s12275-013-3279-2 · Cited by 33
Effects of Age and Region on Fecal Microflora in Elderly Subjects Living in Bama, Guangxi, China
Zhao, L., Xu, W., Ibrahim, S. A., Jin, J., Feng, J., Jiang, J., Meng, J., & Ren, F. (2010) · Current Microbiology · doi:10.1007/s00284-010-9676-4 · Cited by 33
“Ten groups of fecal dominant bacteria, which might be affected by age or region, were quantified using real-time PCR [ 1 , 15].”
BackgroundMethodInfluential
A Comparison of Diets Supplemented with a Feed Additive Containing Organic Acids, Cinnamaldehyde and a Permeabilizing Complex, or Zinc Oxide, on Post-Weaning Diarrhoea, Selected Bacterial Populations, Blood Measures and Performance in Weaned Pigs Experimentally Infected with Enterotoxigenic E. coli
Stensland, I., Kim, J.-C., Bowring, B. G., Collins, A. M., Mansfield, J. P., & Pluske, J. R. (2015) · Animals · doi:10.3390/ani5040403 · Cited by 33
Feeding spinach thylakoids to rats modulates the gut microbiota, decreases food intake and affects the insulin response
Montelius, C., Osman, N., Weström, B. R., Ahrné, S., Molin, G., Albertsson, P., & Erlanson‐Albertsson, C. (2013) · Journal of Nutritional Science · doi:10.1017/jns.2012.29 · Cited by 33
Gut microbiota of the European Brown Hare (Lepus europaeus)
Stalder, G. L., Pinior, B., Zwirzitz, B., Loncaric, I., Jakupović, D., Vetter, S. G., Smith, S., Posautz, A., Hoelzl, F., Wagner, M., et al. (2019) · Scientific Reports · doi:10.1038/s41598-019-39638-9 · Cited by 33
An analysis of microbiota-targeted therapies in patients with avian influenza virus subtype H7N9 infection
Lu, H., Zhang, C., Qian, G., Hu, X., Zhang, H., Chen, C., Liang, W., Gao, H., Yang, Y., & Li, L. (2014) · BMC Infectious Diseases · doi:10.1186/1471-2334-14-359 · Cited by 32
“DNA was extracted from the feces and bacterial precipitates using a Qiagen Stool Kit (Qiagen, Hilden, Germany) with a modified protocol for cell lysis [13].”
Method
Resembling breast milk: influence of polyamine-supplemented formula on neonatal BALB/cOlaHsd mouse microbiota
Gómez-Gallego, C., Collado, M. C., Pérez‐Martínez, G., Ilo, T., Jaakkola, U.-M., Bernal, M. J., Periago, M. J., Frías, R., Ros, G., & Salminen, S. (2013) · British Journal Of Nutrition · doi:10.1017/s0007114513003565 · Cited by 33
Origination, change, and modulation of geriatric disease-related gut microbiota during life
Rajoka, M. S. R., Zhao, H., Li, N., Lu, Y. P., Lian, Z., Shao, D., Jin, M., Li, Q., Zhao, L., & Shi, J. (2018) · Applied Microbiology and Biotechnology · doi:10.1007/s00253-018-9264-2 · Cited by 32
Safety assessment of transgenicBacillus thuringiensisrice T1c‐19 in Sprague–Dawley rats from metabonomics and bacterial profile perspectives
Cao, S., He, X., Xu, W., Luo, Y., Yuan, Y., Liu, P., Cao, B., Shi, H., & Huang, K. (2012) · IUBMB Life · doi:10.1002/iub.601 · Cited by 31
“(24) R: TAAGCCATGGACTTTCACACC Escherichia coli 340 61 F: GTTAATACCTTTGCTCATTGA Malinen et al.”
Background
Anthropometric and metabolic improvements in human type 2 diabetes after introduction of an Okinawan-based Nordic diet are not associated with changes in microbial diversity or SCFA concentrations
Huang, F., Nilholm, C., Roth, B., Linninge, C., Höglund, P., NYMAN, M. E., & Ohlsson, B. (2017) · International Journal of Food Sciences and Nutrition · doi:10.1080/09637486.2017.1408059 · Cited by 31
“Primers used for the qPCR assay have been used and published previously (Bartosch et al. 2004; Castillo et al. 2006).”
Method
Colonic In Vitro Model Assessment of the Prebiotic Potential of Bread Fortified with Polyphenols Rich Olive Fiber
Nissen, L., Casciano, F., Chiarello, E., Nunzio, M. D., Bordoni, A., & Gianotti, A. (2021) · Nutrients · doi:10.3390/nu13030787 · Cited by 31
Kazak faecal microbiota transplantation induces short-chain fatty acids that promote glucagon-like peptide-1 secretion by regulating gut microbiota in db/db mice
Han, X., Wang, Y., Zhang, P., Zhu, M., Li, L., Mao, X., Sha, X., & Li, L. (2021) · Pharmaceutical Biology · doi:10.1080/13880209.2021.1954667 · Cited by 32
“2011) 16S rRNA 112 F: TCTTCCGCATGGTAGAACTATTA 60 R: ACCGTGTCTCAGTTCCAATGTG Mucispirillum schaedleri 16S rRNA 178 F: CGAGCGTTGTTCGGAGTGACTG 65 R: CCAGCCAGATTGCCGCCTTC Faecalibacterium prausnitzii (Bartosch et al. 2004) 16S rRNA 177 F: GATGGCCTCGCGTCCGATTAG 60 R: CCGAAGACCTTCTTCCTCC Ruminococcus gnavus (Cao et al.”
Background
A novel therapeutic combination of dapagliflozin, Lactobacillus and crocin attenuates diabetic cardiomyopathy in rats: Role of oxidative stress, gut microbiota, and PPARγ activation
Khalaf, E. M., Hassan, H. M., El-Baz, A. M., Shata, A., Khodir, A. E., Yousef, M. E., Elgharabawy, R. M., Nouh, N. A. T., Saleh, S., Bin-Meferij, M. M., et al. (2022) · European Journal of Pharmacology · doi:10.1016/j.ejphar.2022.175172 · Cited by 30
Effects of Age and Strain on the Microbiota Colonization in an Infant Human Flora-Associated Mouse Model
Zeng, B., Li, G., Yuan, J., Li, W., Tang, H., & Wei, H. (2013) · Current Microbiology · doi:10.1007/s00284-013-0360-3 · Cited by 32
Enteric microbiome profiles during a randomized Phase 2 clinical trial of surotomycin versus vancomycin for the treatment of Clostridium difficile infection
Cannon, K., Byrne, B., Happe, J., Wu, K., Ward, L., Chesnel, L., & Louie, T. (2017) · Journal of Antimicrobial Chemotherapy · doi:10.1093/jac/dkx318 · Cited by 30
Characterization of the Cultivable Microbiota in Fresh and Stored Mature Human Breast Milk
Schwab, C., Voney, E., Garcia, A. R., Vischer, M., & Lacroix, C. (2019) · Frontiers in Microbiology · doi:10.3389/fmicb.2019.02666 · Cited by 31
The First Report of Differences in Gut Microbiota Composition between Obese and Normal Weight Iranian Subjects
Marvasti, F. E., Moshiri, A., Taghavi, M., Riazi, S., Taati, M., Sadati, S. F., Ghaheri, A., Masoomi, M., Vaziri, F., Fateh, A., et al. (2020) · Iranian Biomedical Journal · doi:10.29252/ibj.24.3.148 · Cited by 31
“Escherichia coli CATTGACGTTACCCGCAGAAGAAGC CTCTACGAGACTCAAGCTTGC [49] Table 1.”
The Interplay between Immunosenescence and Microbiota in the Efficacy of Vaccines
Cianci, R., Franza, L., Massaro, M. G., Borriello, R., Vito, F., & Gambassi, G. (2020) · Vaccines · doi:10.3390/vaccines8040636 · Cited by 32
“Microbiota in older persons tends to change when compared to the younger population, with an increased presence of potentially dangerous bacteria, such as Clostridia and Enterobacteria [82].”
Background
Prebiotic Oligosaccharides: Comparative Evaluation Using In Vitro Cultures of Infants' Fecal Microbiomes
Stiverson, J. A., Williams, T., Chen, J., Adams, S., Hustead, D. S., Price, P., Guerrieri, J. P., Deacon, J. M., & Yu, Z. (2014) · Applied and Environmental Microbiology · doi:10.1128/aem.02200-14 · Cited by 30
“In an attempt to encompass the gut microbiome supported by both feeding types, the abundance of total bacteria, Bacteroides, total bifidobacteria, 7390 aem.asm.org Applied and Environmental Microbiology B. longum, and E. coli was determined for each inoculum collected from both the HM and the FF feeding groups, with a…”
MethodInfluential
A Shift from Colon- to Ileum-Predominant Bacteria in Ileal-Pouch Feces Following Total Proctocolectomy
Hinata, M., Kohyama, A., Ogawa, H., Haneda, S., Watanabe, K., Suzuki, H., Shibata, C., Funayama, Y., Takahashi, K.-I., Sasaki, I., et al. (2012) · Digestive Diseases and Sciences · doi:10.1007/s10620-012-2165-9 · Cited by 30
Nutrient digestibility, digesta volatile fatty acids, and intestinal bacterial profile in growing pigs fed a distillers dried grains with solubles containing diet supplemented with a multi-enzyme cocktail
Agyekum, A. K., Regassa, A., Kiarie, E. G., & Nyachoti, C. M. (2015) · Animal Feed Science and Technology · doi:10.1016/j.anifeedsci.2015.12.006 · Cited by 30
“(1996) R: TTACCGAGGCTGCTGGCAC Enterobacteriaceae 63 F: CATTGACGTTACCCGCAGAAGAAGC Bartosch et al. (2004) R: CTCTACGAGACTCAAGCTTGC Lactobacillus 62 F: AGCAGTAGGGAATCTTCCA Karlsson et al.”
Psychrophile spoilers dominate the bacterial microbiome in musculature samples of slaughter pigs
Mann, E., Wetzels, S. U., Conrady, B., Metzler-Zebeli, B. U., Wagner, M., & Schmitz‐Esser, S. (2016) · Meat Science · doi:10.1016/j.meatsci.2016.02.034 · Cited by 29
Dietary green-plant thylakoids decrease gastric emptying and gut transit, promote changes in the gut microbial flora, but does not cause steatorrhea
Stenblom, E.-L., Weström, B. R., Linninge, C., Bonn, P., Farrell, M., Rehfeld, J. F., & Montelius, C. (2016) · Nutrition & Metabolism · doi:10.1186/s12986-016-0128-4 · Cited by 30
“Enterobacteriaecae Eco1457-F CAT TGA CGT TAC CCG CAG AAG AAG C 195 10 [43]”
Background
Enhancing Immunomodulatory Function of Red Ginseng Through Fermentation Using Bifidobacterium animalis Subsp. lactis LT 19-2
Kim, J. H., Doo, E., Jeong, M., Kim, S., Lee, Y.-Y., Yang, J., Lee, J. S., Kim, J. H., Lee, K. W., Huh, C., et al. (2019) · Nutrients · doi:10.3390/nu11071481 · Cited by 29
“Previous studies also report the use of antibiotics as a reason for the decrease or removal of health promoting gut microbiota [34].”
Effects of a Formula Containing Two Types of Prebiotics, Bifidogenic Growth Stimulator and Galacto-oligosaccharide, and Fermented Milk Products on Intestinal Microbiota and Antibody Response to Influenza Vaccine in Elderly Patients: A Randomized Controlled Trial
Nagafuchi, S., Yamaji, T., Kawashima, A., Saito, Y., Takahashi, T., Yamamoto, T., Maruyama, M., & Akatsu, H. (2015) · Pharmaceuticals · doi:10.3390/ph8020351 · Cited by 29
“These bacterial counts observed in this study were almost the same as previous reports, except for Bifidobacterium [16,18,23,24].”
MethodResult
Quantification of Lactobacillus gasseri, Enterococcus faecium and Bifidobacterium infantis in a probiotic OTC drug by real-time PCR
Matijašić, B. B., Obermajer, T., & Rogelj, I. (2009) · Food Control · doi:10.1016/j.foodcont.2009.07.001 · Cited by 29
Quantitative Analysis of Intestinal Bacterial Populations From Term Infants Fed Formula Supplemented With Fructo‐oligosaccharides
Xia, Q., Williams, T., Hustead, D. S., Price, P. T., Morrison, M., & Yu, Z. (2012) · Journal of Pediatric Gastroenterology and Nutrition · doi:10.1097/mpg.0b013e3182523254 · Cited by 29
Microbiological and immunological effects of enteral feeding on the upper gastrointestinal tract
Smith, A. R., Macfarlane, S., Furrie, E., Ahmed, S., Bahrami, B., Reynolds, N., & Macfarlane, G. T. (2010) · Journal of Medical Microbiology · doi:10.1099/jmm.0.026401-0 · Cited by 29
“Real-time PCR assays for quantification of Candida albicans, members of the genus Bifidobacterium and total enterobacteria were validated in a previous investigation in this laboratory (Bartosch et al., 2004).”
Self-citation
Quantitative Polymerase Chain Reaction-based Analyses of Murine Intestinal Microbiota After Oral Antibiotic Treatment
Jimeno, R., Brailey, P. M., & Barral, P. (2018) · Journal of Visualized Experiments · doi:10.3791/58481 · Cited by 29
Probiotic Microorganisms
Lee, Y. K., Margollés, A., Mayo, B., Ruas‐Madiedo, P., Gueimonde, M., Reyes‐Gavilán, C. G. D. L., Chapman, T. A., Chin, J. J.-C., Crittenden, R. G., Donohue, D., et al. (2008) · Wiley eBooks · doi:10.1002/9780470432624.ch1 · Cited by 28
Bacterial-induced Duox-ROS regulates the Imd immune pathway in the gut by modulating the peritrophic matrix
Bai, S., Yao, Z., Cai, Z., Ma, Q., Guo, Q., Zhang, P., Zhou, Q., Gu, J., Liu, S., Lemaître, B., et al. (2025) · Cell Reports · doi:10.1016/j.celrep.2025.115404 · Cited by 28

Authors: Bartosch, S., Fite, A., Macfarlane, G. T., & McMurdo, M. E. T.
Affiliations: University of Dundee (GB)
MRC Microbiology and Gut Biology Group
Venue: Applied and Environmental Microbiology
Publisher: American Society for Microbiology
Published: 2004-06
Volume: 70
Issue: 6
Pages: 3575-3581
ISSN: 0099-2240 (ISSN-L)
1098-5336
DOI: 10.1128/aem.70.6.3575-3581.2004
PMC: PMC427772
OpenAlex: W2109744701
Cited by: 762
References: 51
Citations by year: 2026: 15 · 2025: 29 · 2024: 12 · 2023: 31 · 2022: 36 · 2021: 51 · 2020: 49 · 2019: 36 · 2018: 38 · 2017: 63 · 2016: 59 · 2015: 65 · 2014: 44 · 2013: 46 · 2012: 46
FWCI: 4.63
Type: journal article
Language: en
Open access: green
europepmc.org
Licence: journals.asm.org/non-commercial-tdm-license (tdm)
Locations: Applied and Environmental Microbiology (publishedVersion)
Europe PMC (PubMed Central) (publishedVersion)
PubMed Central (publishedVersion)
PubMed (publishedVersion)
Discovery Research Portal (University of Dundee) (submittedVersion)
Funders: Medical Research Council
Topics: Life Sciences › Biochemistry, Genetics and Molecular Biology › Molecular Biology › Gut microbiota and health
Health Sciences › Medicine › Infectious Diseases › Clostridium difficile and Clostridium perfringens research
Physical Sciences › Environmental Science › Ecology › Microbial Community Ecology and Physiology
Keywords: fecal microbiota, older adults, hospitalized patients, antibiotic therapy, Bifidobacterium, Desulfovibrio, Faecalibacterium prausnitzii, 16S rRNA gene quantification, Enterobacteriaceae, Enterococcus faecalis, intestinal bacteria, community-acquired infections
MeSH terms: Aged, Aged, 80 and over, Anti-Bacterial Agents, Bacteria, Bacterial Infections, DNA, Bacterial, DNA, Ribosomal, Feces, Hospitalization, Humans, RNA, Ribosomal, 16S, Species Specificity, Polymerase Chain Reaction, Ecosystem, DNA Primers, Gene Dosage, Genes, rRNA

About these checks

Registry, retraction, Cites and statistics results are computed, not judged, with one exception: a printed reference that no index lists is read once by a model before it counts as a citation error. Claims are extracted by a model and kept only when their quote appears verbatim in the text; each cited source is then checked, with a model’s help, for whether it says what the claim relies on. Those verdicts can be wrong — read the claim’s quote and the cited source before relying on one.

Statistics and arithmetic are recomputed, not judged.

Confidence bands are shown only for fields calibrated on our annotated test set. None is calibrated yet, so no band is shown.

What counts as a claim ›How we measure confidence ›How we check this ›

Are you an author, or do you see a problem with this page? Request a review

Characterization of Bacterial Communities in Feces from Healthy Elderly Volunteers and Hospitalized Elderly Patients by Using Real-Time PCR and Effects of Antibiotic Treatment on the Fecal Microbiota

Abstract

Overview

Integrity signals

Verification

Claims the paper makes

Claims other papers make about this one

Self-check

Citations

Cites

Cited by

Related

Metadata

Record

About these checks