Cited by 762Gut microbiota and healthClostridium difficile and Clostridium perfringens researchMicrobial Community Ecology and Physiology

The DOI matches its Crossref record; 51 of the 51 references it cites were found in a registry or an index.

Characterization of Bacterial Communities in Feces from Healthy Elderly Volunteers and Hospitalized Elderly Patients by Using Real-Time PCR and Effects of Antibiotic Treatment on the Fecal Microbiota

Open access

Bartosch, Sabine, Fite, Alemu, Macfarlane, George T., McMurdo, Marion E. T.·2004·Applied and Environmental Microbiology

DOI 10.1128/aem.70.6.3575-3581.2004PMC PMC427772

Open this paper in CoChat — free account

Abstract

Fecal bacteria were studied in healthy elderly volunteers (age, 63 to 90 years;n= 35) living in the local community, elderly hospitalized patients (age, 66 to 103;n= 38), and elderly hospitalized patients receiving antibiotic treatment (age, 65 to 100;n= 21). Group- and species-specific primer sets targeting 16S rRNA genes were used to quantitate intestinal bacteria by using DNA extracted from feces and real-time PCR. The principal difference between healthy elderly volunteers and both patient cohorts was a marked reduction in the Bacteroides-Prevotella group following hospitalization. Reductions in bifidobacteria,Desulfovibrio spp.,Clostridium clostridiiforme, and Faecalibacterium prausnitzii were also found in the hospitalized patients. However, total 16S rRNA gene copy numbers (per gram of wet weight of feces) were generally lower in the stool samples of the two groups of hospitalized patients compared to the number in the stool samples of elderly volunteers living in the community, so the relative abundance (percentage of the group- and species-specific rRNA gene copies in relation to total bacterial rRNA gene copies) of bifidobacteria,Desulfovibrio spp.,C. clostridiiforme, and F. prausnitzii did not change. Antibiotic treatment resulted in further reductions in the numbers of bacteria and their prevalence and, in some patients, complete elimination of certain bacterial communities. Conversely, the numbers of enterobacteria increased in the hospitalized patients who did not receive antibiotics, and due to profound changes in fecal microbiotas during antibiotic treatment, the opportunistic species Enterococcus faecalis proliferated.

The claims and statistics of this paper haven’t been checked yet.

Run the check — free, no account needed. It reads the open-access text and checks the sources it cites.

Integrity signals

Registry

Crossref · 10.1128/aem.70.6.3575-3581.2004

Cites

51 of 51 references verified0 citation errors · 0 not checkable

Statistics

Claims the paper makes

The claims and statistics of this paper haven’t been checked yet.

Run the check — free, no account needed. It reads the open-access text and checks the sources it cites.

Claims other papers make about this one

Each is checked against this paper’s own text: does it say what the citing paper says it does?

Self-check

Percentages, sums and reported differences re-computed from the paper’s own numbers.

The self-check needs the paper’s full text.

Bergey's Manual of Systematic Bacteriology
(1990) · Annals of Internal Medicine · doi:10.7326/0003-4819-112-5-391_3 · Cited by 15,633
Determination of bacterial load by real-time PCR using a broad-range (universal) probe and primers set
Nadkarni, M. A., Martin, F. E., Jacques, N. A., & Hunter, N. (2002) · Microbiology · doi:10.1099/00221287-148-1-257 · Cited by 1,931
Direct analysis of genes encoding 16S rRNA from complex communities reveals many novel molecular species within the human gut
Suau, A., Bonnet, R., Sutren, M., Godon, J.-J., Gibson, G. R., Collins, M. D., & Doré, J. (1999) · Applied and Environmental Microbiology · doi:10.1128/aem.65.11.4799-4807.1999 · Cited by 1,490
The Ribosomal Database Project (RDP-II): previewing a new autoaligner that allows regular updates and the new prokaryotic taxonomy
Cole, J. R. (2003) · Nucleic Acids Research · doi:10.1093/nar/gkg039 · Cited by 1,435
Temperature Gradient Gel Electrophoresis Analysis of 16S rRNA from Human Fecal Samples Reveals Stable and Host-Specific Communities of Active Bacteria
Zoetendal, E. G., Akkermans, A. D. L., & de Vos, W. M. (1998) · Applied and Environmental Microbiology · doi:10.1128/aem.64.10.3854-3859.1998 · Cited by 1,360
rrndb: the Ribosomal RNA Operon Copy Number Database
Klappenbach, J., Saxman, P., Cole, J., & Schmidt, T. M. (2001) · Nucleic Acids Res. · doi:10.1093/nar/29.1.181 · Cited by 1,140
Quantitative fluorescence in situ hybridization of Bifidobacterium spp. with genus-specific 16S rRNA-targeted probes and its application in fecal samples
Langendijk-Genevaux, P. S., Schut, F., Jansen, G. J., Raangs, G. C., Kamphuis, G. R., Wilkinson, M. H. F., & Welling, G. W. (1995) · Applied and Environmental Microbiology · doi:10.1128/aem.61.8.3069-3075.1995 · Cited by 974
Effect of antimicrobial agents on the ecological balance of human microflora
Sullivan, Å., Edlund, C., & Nord, C. E. (2001) · The Lancet Infectious Diseases · doi:10.1016/s1473-3099(01)00066-4 · Cited by 816
Growth requirements and fermentation products of Fusobacterium prausnitzii, and a proposal to reclassify it as Faecalibacterium prausnitzii gen. nov., comb. nov
Duncan, S. H., Hold, G. L., Harmsen, H. J. M., Stewart, C. S., & Flint, H. J. (2002) · INTERNATIONAL JOURNAL OF SYSTEMATIC AND EVOLUTIONARY MICROBIOLOGY · doi:10.1099/00207713-52-6-2141 · Cited by 753
Development of 16S rRNA-Gene-Targeted Group-Specific Primers for the Detection and Identification of Predominant Bacteria in Human Feces
Matsuki, T., Watanabe, K., Fujimoto, J., Miyamoto, Y., Takada, T., Matsumoto, K., Oyaizu, H., & Tanaka, R. (2002) · Applied and Environmental Microbiology · doi:10.1128/aem.68.11.5445-5451.2002 · Cited by 663

Show all 51 references

Research works printed but not linked: 2

10.1111/j.1574-6968.1991.tb04588.x · DOI
Mitsuoka, T., K. Hayakawa, and N. Kimura. 1974. Die Faekalflora bei Menschen II. Mitteilung: Die Zusammensetzung der Bifidobakterienflora der verschiedenen Altersgruppen. Zentbl. Bakteriol. Hyg. Abt. 1 Orig. A226:469-478.

Sorted by citations

The Microbiota-Gut-Brain Axis
Cryan, J. F., O'Riordan, K. J., Cowan, C. S. M., Sandhu, K. V., Bastiaanssen, T. F. S., Boehme, M., Codagnone, M. G., Cussotto, S., Fulling, C., Golubeva, A. V., et al. (2019) · Physiological Reviews · doi:10.1152/physrev.00018.2018 · Cited by 5,286
Gut Microbiota in Human Adults with Type 2 Diabetes Differs from Non-Diabetic Adults
Larsen, N., Vogensen, F. K., van den Berg, F. W. J., Nielsen, D. S., Andreasen, A. S., Pedersen, B. K., Al-Soud, W. A., Sørensen, S. J., Hansen, L. H., & Jakobsen, M. (2010) · PLoS ONE · doi:10.1371/journal.pone.0009085 · Cited by 2,952
The pervasive effects of an antibiotic on the human gut microbiota, as revealed by deep 16S rRNA sequencing
Dethlefsen, L., Huse, S., Sogin, M. L., & Relman, D. A. (2008) · PLoS Biology · doi:10.1371/journal.pbio.0060280 · Cited by 2,361
“Studies comparing changes in the gut microbiota over time or between treatments have often used alternative molecular techniques that are more rapid and less expensive than sequencing, but that offer lower taxonomic resolution and reveal only the more abundant members of the community [23-25,34-37].”
Background
The Firmicutes/Bacteroidetes ratio of the human microbiota changes with age
Mariat, D., Firmesse, O., Levenez, F., Guimarăes, V., Sokol, H., Doré, J., Corthier, G., & Furet, J.-P. (2009) · BMC Microbiology · doi:10.1186/1471-2180-9-123 · Cited by 1,755
Through Ageing, and Beyond: Gut Microbiota and Inflammatory Status in Seniors and Centenarians
Biagi, E., Nylund, L., Candela, M., Ostan, R., Bucci, L., Pini, E., Nikkïla, J., Monti, D., Satokari, R., Franceschi, C., et al. (2010) · PLoS ONE · doi:10.1371/journal.pone.0010667 · Cited by 1,483
“The uniqueness of this comparative study resides in the introduction of this third, extremely aged, group, alongside to the young and elderly adults that have been addressed by earlier studies”
Age-Associated Microbial Dysbiosis Promotes Intestinal Permeability, Systemic Inflammation, and Macrophage Dysfunction
Thevaranjan, N., Puchta, A., Schulz, C., Naidoo, A., Szamosi, J. C., Verschoor, C. P., Loukov, D., Schenck, L. P., Jury, J., Foley, K. P., et al. (2017) · Cell Host & Microbe · doi:10.1016/j.chom.2017.03.002 · Cited by 1,322
“, 2009) and that these changes correlate with health status in the elderly population (Bartosch et al., 2004; Claesson et al., 2012).”
Interaction between Phenolics and Gut Microbiota: Role in Human Health
Selma, M. V., Espín, J. C., & Tomás-Barberán, F. A. (2009) · Journal of Agricultural and Food Chemistry · doi:10.1021/jf902107d · Cited by 1,324
Phylogenetic distribution of three pathways for propionate production within the human gut microbiota
Reichardt, N., Duncan, S. H., Young, P., Belenguer, Á., Leitch, E. C. M., Scott, K. P., Flint, H. J., & Louis, P. (2014) · The ISME Journal · doi:10.1038/ismej.2014.14 · Cited by 1,327
Human colonic microbiota associated with diet, obesity and weight loss
Duncan, S. H., Lobley, G. E., Holtrop, G., Ince, J., Johnstone, A. M., Louis, P., & Flint, H. J. (2008) · International Journal of Obesity · doi:10.1038/ijo.2008.155 · Cited by 1,222
Long-term ecological impacts of antibiotic administration on the human intestinal microbiota
Jernberg, C., Löfmark, S., Edlund, C., & Jansson, J. K. (2007) · The ISME Journal · doi:10.1038/ismej.2007.3 · Cited by 1,134
Characterization of fecal microbial communities in patients with liver cirrhosis
Chen, Y., Yang, F., Lu, H., Wang, B., Chen, Y., Lei, D., Wang, Y., Zhu, B., & Li, L. (2011) · Hepatology · doi:10.1002/hep.24423 · Cited by 1,038
“Faecalibacterium prausnitzii Pfra-F 50-GATGGCCTCGCGTCCGATTAG-30 58 Bartosch et al.(25)”
BackgroundInfluential
Differences in Fecal Microbiota in Different European Study Populations in Relation to Age, Gender, and Country: a Cross-Sectional Study
Mueller, S., Saunier, K., Hanisch, C., Norin, E., Alm, L., Midtvedt, T., Cresci, A., Silvi, S., Orpianesi, C., Verdenelli, M. C., et al. (2006) · Applied and Environmental Microbiology · doi:10.1128/aem.72.2.1027-1033.2006 · Cited by 1,006
“Progressive colonization seems to happen in old age where competitiveness and colonization resistance are often affected by medical treatment, in particular by antibiotics (3).”
Background
Two Routes of Metabolic Cross-Feeding between Bifidobacterium adolescentis and Butyrate-Producing Anaerobes from the Human Gut
Belenguer, A., Duncan, S. H., Calder, A. G., Holtrop, G., Louis, P., Lobley, G. E., & Flint, H. J. (2006) · Applied and Environmental Microbiology · doi:10.1128/aem.72.5.3593-3599.2006 · Cited by 856
Effect of inulin on the human gut microbiota: stimulation of Bifidobacterium adolescentis and Faecalibacterium prausnitzii
Ramirez-Farias, C., Slezak, K., Fuller, Z., Duncan, A., Holtrop, G., & Louis, P. (2008) · British Journal of Nutrition · doi:10.1017/s0007114508019880 · Cited by 822
Intestinal microbiota in human health and disease: the impact of probiotics
Gerritsen, J., Smidt, H., Rijkers, G. T., & de Vos, W. M. (2011) · Genes & Nutrition · doi:10.1007/s12263-011-0229-7 · Cited by 724
Gut Bifidobacteria Populations in Human Health and Aging
Arboleya, S., Watkins, C., Stanton, C., & Ross, R. P. (2016) · Frontiers in Microbiology · doi:10.3389/fmicb.2016.01204 · Cited by 701
“The same trend was observed by Bartosch et al. (2004) between elderly living in the local community and elderly in a hospitalized environment.”
Background
Gut microbiome and aging: physiological and mechanistic insights
Nagpal, R., Mainali, R., Ahmadi, S., Wang, S., Singh, R., Kavanagh, K., Kitzman, D. W., Kushugulova, A., Marotta, F., & Yadav, H. (2018) · Nutrition and Healthy Aging · doi:10.3233/nha-170030 · Cited by 670
“between gut microbiota and host chronological aging 276 are still limited [8, 36, 73], but a reduced gut 277 microbiota diversity has been speculated to be asso278 ciated with increased old-age frailty [23, 31, 74, 75].”
BackgroundInfluential
Stool microbiome and metabolome differences between colorectal cancer patients and healthy adults
Weir, T. L., Manter, D. K., Sheflin, A. M., Barnett, B. A., Heuberger, A. L., & Ryan, E. P. (2013) · PLoS ONE · doi:10.1371/journal.pone.0070803 · Cited by 642
The Microbiota of the Gut in Preschool Children With Normal and Excessive Body Weight
Karlsson, C., Önnerfält, J., Xu, J., Molin, G., Ahrné, S., & Thorngren‐Jerneck, K. (2012) · Obesity · doi:10.1038/oby.2012.110 · Cited by 556
Diet and the development of the human intestinal microbiome
Voreades, N., Kozil, A., & Weir, T. L. (2014) · Frontiers in Microbiology · doi:10.3389/fmicb.2014.00494 · Cited by 519
“…of the gut are: (1) physiological changes, (2) dietary choices and malnutrition, (3) living situation (community-dwelling, hospitalized, or long-term care), and (4) use of antibiotics (Bartosch et al., 2004; Woodmansey, 2007; Claesson et al., 2012) and other prescription drugs (Qato et al., 2008).”
BackgroundInfluential
Intestinal microbiota, diet and health
Power, S. E., O'Toole, P. W., Stanton, C., Ross, R. P., & Fitzgerald, G. F. (2014) · British Journal Of Nutrition · doi:10.1017/s0007114513002560 · Cited by 476
“Antibiotic treatment in hospitalised elderly subjects has been shown to increase the intestinal abundance of proteolytic bacteria((73)), to reduce overall bacterial numbers and, in some subjects, to completely eliminate certain bacterial communities((46)).”
Intestinal bacteria and ageing
Woodmansey, E. J. (2007) · Journal of Applied Microbiology · doi:10.1111/j.1365-2672.2007.03400.x · Cited by 462
“Numerous studies have shown a decline in viable counts of bacteroides with increased age, an observation that is unsurprisingly magnified following antibiotic therapy (Hopkins and Macfarlane 2002; Bartosch et al. 2004; Woodmansey et al. 2004).”
Background
Enteric Salmonellosis Disrupts the Microbial Ecology of the Murine Gastrointestinal Tract
Barman, M., Unold, D., Shifley, K., Amir, E., Hung, K.-C., Bos, N. A., & Salzman, N. H. (2007) · Infection and Immunity · doi:10.1128/iai.01432-07 · Cited by 428
Microbes and the gut‐brain axis
Bercik, P., Collins, S. M., & Verdu, E. F. (2012) · Neurogastroenterology & Motility · doi:10.1111/j.1365-2982.2012.01906.x · Cited by 417
Influence of antibiotic exposure in the early postnatal period on the development of intestinal microbiota
Tanaka, S., Kobayashi, T., Songjinda, P., Tateyama, A., Tsubouchi, M., Kiyohara, C., Shirakawa, T., Sonomoto, K., & Nakayama, J. (2009) · FEMS Immunology & Medical Microbiology · doi:10.1111/j.1574-695x.2009.00553.x · Cited by 396
“However, it is well-known that antibiotic exposure affects the ecological balance of gastrointestinal tract microbiota (Sullivan et al., 2001; Bartosch et al., 2004; Nord et al., 2006).”
Background
Techniques used to characterize the gut microbiota: a guide for the clinician
Fraher, M. H., O'Toole, P. W., & Quigley, E. M. M. (2012) · Nature Reviews Gastroenterology & Hepatology · doi:10.1038/nrgastro.2012.44 · Cited by 385
Functional metagenomic profiling of intestinal microbiome in extreme ageing
Rampelli, S., Candela, M., Turroni, S., Biagi, E., Collino, S., Franceschi, C., O'Toole, P. W., & Brigidi, P. (2013) · Aging · doi:10.18632/aging.100623 · Cited by 359
“physiology of the ageing process can ultimately compromise this homeostasis with a subject-specific timing, depending on the individual physiological status, diet, lifestyle and frailty [7-13].”
Background
Ageing of the human metaorganism: the microbial counterpart
Biagi, E., Candela, M., Fairweather‐Tait, S. J., Franceschi, C., & Brigidi, P. (2011) · AGE · doi:10.1007/s11357-011-9217-5 · Cited by 375
“…have different purposes, such as the relationship between microbiota and frailty (van Tongeren et al. 2005), the impact of antibiotic treatments (Bartosch et al. 2004; Woodmansey et al. 2004) and the differences between the GI health status of hospitalised and non-hospitalised patients…”
BackgroundInfluential
Primates and the Ecology of their Infectious Diseases: How will Anthropogenic Change Affect Host-Parasite Interactions?
Chapman, C. A., Gillespie, T. R., & Goldberg, T. L. (2005) · Evolutionary Anthropology Issues News and Reviews · doi:10.1002/evan.20068 · Cited by 371
Correction: Through Ageing, and Beyond: Gut Microbiota and Inflammatory Status in Seniors and Centenarians
Biagi, E., Nylund, L., Candela, M., Ostan, R., Bucci, L., Pini, E., Nikkïla, J., Monti, D., Satokari, R., Franceschi, C., et al. (2010) · PLoS ONE · doi:10.1371/annotation/df45912f-d15c-44ab-8312-e7ec0607604d · Cited by 345
Fecal Microbiota Composition and Frailty
van Tongeren, S. P., Slaets, J. P. J., Harmsen, H. J. M., & Welling, G. W. (2005) · Applied and Environmental Microbiology · doi:10.1128/aem.71.10.6438-6442.2005 · Cited by 333
“(3) characterized bacterial communities in feces from healthy elderly volunteers and hospitalized elderly patients by real-time PCR.”
Background
Resilience of the Dominant Human Fecal Microbiota upon Short-Course Antibiotic Challenge
Cochetiere, M. F. D. L., Durand, T., Lepage, P., Bourreille, A., Galmiche, J. P., & Dore, J. M. (2005) · Journal of Clinical Microbiology · doi:10.1128/jcm.43.11.5588-5592.2005 · Cited by 333
“Oral antibiotic administration profoundly affects the intestinal microbiota (1, 11).”
Background
Human Gut Microbiota: Repertoire and Variations
Lagier, J., Million, M., Hugon, P., Armougom, F., & Raoult, D. (2012) · Frontiers in Cellular and Infection Microbiology · doi:10.3389/fcimb.2012.00136 · Cited by 347
“Antibiotics and total bacterial count According to the literature, oral or intravenous antibiotics tend to decrease the bacterial load in the digestive tracts of infants (Palmer et al., 2007) and elderly patients (Bartosch et al., 2004).”
Mechanisms of Disease: the hygiene hypothesis revisited
Guarner, F., Bourdet‐Sicard, R., Brandtzæg, P., Gill, H. S., McGuirk, P., van Eden, W., Versalovic, J. A., Weinstock, J. V., & Rook, G. A. W. (2006) · Nature Clinical Practice Gastroenterology & Hepatology · doi:10.1038/ncpgasthep0471 · Cited by 315
Fidaxomicin Preserves the Intestinal Microbiome During and After Treatment of Clostridium difficile Infection (CDI) and Reduces Both Toxin Reexpression and Recurrence of CDI
Louie, T., Cannon, K., Byrne, B., Emery, J., Ward, L., Eyben, M., & Krulicki, W. (2012) · Clinical Infectious Diseases · doi:10.1093/cid/cis338 · Cited by 309
Methods for Improving Human Gut Microbiome Data by Reducing Variability through Sample Processing and Storage of Stool
Gorzelak, M. A., Gill, S. K., Tasnim, N., Zahra, A.-V., Jay, M., & Gibson, D. L. (2015) · PLoS ONE · doi:10.1371/journal.pone.0134802 · Cited by 311
The gut microbiome composition associates with bipolar disorder and illness severity
Evans, S. J., Bassis, C. M., Hein, R., Assari, S., Flowers, S. A., Kelly, M., Young, V. B., Ellingrod, V. E., & McInnis, M. G. (2016) · Journal of Psychiatric Research · doi:10.1016/j.jpsychires.2016.12.007 · Cited by 318
“Hospitalized (30) and frail elderly (31), compared to healthy elderly, have lower gut Faecalibacterium.”
Composition and temporal stability of gastrointestinal microbiota in irritable bowel syndrome â a longitudinal study in IBS and control subjects
MÃ¤ttÃ¶, J., Maunuksela, L., Kajander, K., Palva, A., Korpela, R., Kassinen, A., & Saarela, M. (2005) · FEMS Immunology & Medical Microbiology · doi:10.1016/j.femsim.2004.08.009 · Cited by 301
“Antibiotic therapy can cause disturbances of the intestinal microbiota [38,39], and may affect also the predominant bacterial groups [40].”
Background
Sensitive Quantitative Detection of Commensal Bacteria by rRNA-Targeted Reverse Transcription-PCR
Matsuda, K., Tsuji, H., Asahara, T., Kado, Y., & Nomoto, K. (2006) · Applied and Environmental Microbiology · doi:10.1128/aem.01224-06 · Cited by 296
“To determine the bacterial population in the human gastrointestinal tract, the applications of qPCR have been expanded (5, 16, 29, 30).”
Background
Prebiotic fibres dose-dependently increase satiety hormones and alter Bacteroidetes and Firmicutes in lean and obese JCR:LA-cp rats
Parnell, J. A., & Reimer, R. A. (2011) · British Journal Of Nutrition · doi:10.1017/s0007114511003163 · Cited by 304
Nutrition and the gut microbiome in the elderly
Salazar, N., Valdés-Varela, L., González, S., Gueimonde, M., & de los Reyes-Gavilán, C. G. (2017) · Gut Microbes · doi:10.1080/19490976.2016.1256525 · Cited by 282
Gut bacterial microbiota and obesity
Million, M., Lagier, J., Yahav, D., & Paul, M. (2013) · Clinical Microbiology and Infection · doi:10.1111/1469-0691.12172 · Cited by 297
“Oral and intravenous antibiotics have been reported to decrease the bacterial load in the digestive tract [46,47], although other studies have found that only the microbiota composition is changed [48].”
Result
16S rRNA gene-based profiling of the human infant gut microbiota is strongly influenced by sample processing and PCR primer choice
Walker, A. W., Martin, J. C., Scott, P., Parkhill, J., Flint, H. J., & Scott, K. P. (2015) · Microbiome · doi:10.1186/s40168-015-0087-4 · Cited by 273
Gut microbiota: Changes throughout the lifespan from infancy to elderly
O’Toole, P. W., & Claesson, M. J. (2009) · International Dairy Journal · doi:10.1016/j.idairyj.2009.11.010 · Cited by 287
Ageing and gut microbes: Perspectives for health maintenance and longevity
Biagi, E., Candela, M., Turroni, S., Garagnani, P., Franceschi, C., & Brigidi, P. (2013) · Pharmacological Research · doi:10.1016/j.phrs.2012.10.005 · Cited by 276
Immunological alteration and changes of gut microbiota after dextran sulfate sodium (DSS) administration in mice
Håkansson, Å., Tormo-Badia, N., Baridi, A., Xu, J., Molin, G., Hagslätt, M.-L. J., Karlsson, C., Jeppsson, B. W., Cilio, C., & Ahrné, S. (2014) · Clinical and Experimental Medicine · doi:10.1007/s10238-013-0270-5 · Cited by 276
“plantarum 299v and Escherichia coli CCUG 29300, respectively, using primers listed in Table 1 [19–21].”
Method
The gut microbiota: A treasure for human health
Li, D., Wang, P., Wang, P., Hu, X., & Chen, F. (2016) · Biotechnology Advances · doi:10.1016/j.biotechadv.2016.08.003 · Cited by 271
“…and was characterized by higher proportions of pathogenic enterobacteria and lower proportions of probiotic Bifidobacteria (Hopkins and Macfarlane, 2002; Woodmansey et al., 2004; Bartosch et al., 2004; Mueller et al., 2006; Claesson et al., 2011; Zwielehner et al., 2009; Mariat et al., 2009).”
Background
Establishment of an Analytical System for the Human Fecal Microbiota, Based on Reverse Transcription-Quantitative PCR Targeting of Multicopy rRNA Molecules
Matsuda, K., Tsuji, H., Asahara, T., Matsumoto, K., Takada, T., & Nomoto, K. (2009) · Applied and Environmental Microbiology · doi:10.1128/aem.01843-08 · Cited by 264
Food and human gut as reservoirs of transferable antibiotic resistance encoding genes
Rolain, J. (2013) · Frontiers in Microbiology · doi:10.3389/fmicb.2013.00173 · Cited by 265
“It has been shown that the diversity of gut microbiota is reduced after antibiotic therapy in children (Penders et al., 2006) and in elderly patients (Bartosch et al., 2004, 2005).”
Background
The effect of age and non-steroidal anti-inflammatory drugs on human intestinal microbiota composition
Mäkivuokko, H., Tiihonen, K., Tynkkynen, S., Paulin, L. G., & Rautonen, N. (2009) · British Journal Of Nutrition · doi:10.1017/s0007114509991553 · Cited by 243
The relationship between phenolic compounds from diet and microbiota: impact on human health
Valdés, L., Cuervo, A. J. V., Salazar, N., Ruas‐Madiedo, P., Gueimonde, M., & González, S. (2015) · Food & Function · doi:10.1039/c5fo00322a · Cited by 243
High-level colonisation of the human gut by Verrucomicrobia following broad-spectrum antibiotic treatment
Dubourg, G., Lagier, J., Armougom, F., Robert, C., Audoly, G., Papazian, L., & Raoult, D. (2013) · International Journal of Antimicrobial Agents · doi:10.1016/j.ijantimicag.2012.10.012 · Cited by 241
Intestinal Microbiota in Healthy U.S. Young Children and Adults—A High Throughput Microarray Analysis
Ringel-Kulka, T., Cheng, J., Ringel, Y., Salojärvi, J., Carroll, I., Palva, A., de Vos, W. M., & Satokari, R. (2013) · PLoS ONE · doi:10.1371/journal.pone.0064315 · Cited by 230
“qPCR was performed using the SYBRH Green PCR master mix (Applied Biosystems, Carlsbad, CA) with primers that amplify the genes encoding 16S rRNA from Bifidobacterium genus [49] (forward, 59GGGTGGTAATGCCGGATG-39; reverse, 59TAAGCGATGGACTTTCACACC-39) [6].”
Method
Quantitative analysis of the intestinal bacterial community in one- to three-week-old commercially reared broiler chickens fed conventional or antibiotic-free vegetable-based diets
Wise, M. G. G., & Siragusa, G. R. (2006) · Journal of Applied Microbiology · doi:10.1111/j.1365-2672.2006.03153.x · Cited by 230
Mucosa-Associated Bacterial Diversity in Relation to Human Terminal Ileum and Colonic Biopsy Samples
Ahmed, S., Macfarlane, G. T., Fite, A., McBain, A. J., Gilbert, P., & Macfarlane, S. (2007) · Applied and Environmental Microbiology · doi:10.1128/aem.01143-07 · Cited by 227
“In particular, PCR coupled with denaturing gradient gel electrophoresis (DGGE) has been a useful tool in providing visual fingerprints of the gut microbiota (1, 38, 49), while the more recent development of real-time PCR provides a sensitive and quantitative device for population analysis (5, 10, 15).”
BackgroundMethodSelf-citation
Hypocaloric diet supplemented with probiotic cheese improves body mass index and blood pressure indices of obese hypertensive patients - a randomized double-blind placebo-controlled pilot study
Sharafedtinov, K. K., Plotnikova, O. A., Исмаиловна, А. Р., Sentsova, T. B., Songisepp, E., Štšepetova, J., Smidt, I., & Mikelsaar, M. (2013) · Nutrition Journal · doi:10.1186/1475-2891-12-138 · Cited by 226
“The purified plasmids were quantified by spectrophotometry (Quibit, Invitrogen) of multiple dilutions [26].”
Method
Intestinal Microbiota Was Assessed in Cirrhotic Patients with Hepatitis B Virus Infection
Lu, H., Wu, Z., Xu, W., Yang, J., Chen, Y., & Li, L. (2011) · Microbial Ecology · doi:10.1007/s00248-010-9801-8 · Cited by 225
“Enterobacteriaceae CATTGACGTTACCCGCAGAAGAAGC 63 [ 2 ]”
BackgroundMethodInfluential
The Early Settlers: Intestinal Microbiology in Early Life
Scholtens, P. A. M. J., Oozeer, R., Martı́n, R., Amor, K. B., & Knol, J. (2012) · Annual Review of Food Science and Technology · doi:10.1146/annurev-food-022811-101120 · Cited by 231
Association of dietary type with fecal microbiota in vegetarians and omnivores in Slovenia
Matijašić, B. B., Obermajer, T., Lipoglavšek, L., Grabnar, I., Avguštin, G., & Rogelj, I. (2013) · European Journal of Nutrition · doi:10.1007/s00394-013-0607-6 · Cited by 228
The inflammatory status of old age can be nurtured from the intestinal environment
Guigoz, Y., Dore, J. M., & Schiffrin, E. J. (2008) · Current Opinion in Clinical Nutrition & Metabolic Care · doi:10.1097/mco.0b013e3282f2bfdf · Cited by 230
Disrupted Intestinal Microbiota and Intestinal Inflammation in Children with Cystic Fibrosis and Its Restoration with Lactobacillus GG: A Randomised Clinical Trial
Bruzzese, E., Callegari, M. L., Raia, V., Viscovo, S., Scotto, R., Ferrari, S., Morelli, L., Buccigrossi, V., Vecchio, A. L., Ruberto, E., et al. (2014) · PLoS ONE · doi:10.1371/journal.pone.0087796 · Cited by 217
Age-dependent changes in GI physiology and microbiota: time to reconsider?
An, R., Wilms, E., Masclee, A. A. M., Smidt, H., Zoetendal, E. G., & Jonkers, D. (2018) · Gut · doi:10.1136/gutjnl-2017-315542 · Cited by 209
Site and Strain-Specific Variation in Gut Microbiota Profiles and Metabolism in Experimental Mice
Friswell, M. K., Gika, H., Stratford, I. J., Theodoridis, G., Telfer, B., Wilson, I. D., & McBain, A. J. (2010) · PLoS ONE · doi:10.1371/journal.pone.0008584 · Cited by 207
“…within different strains of mice Fecal samples from six strains of mice (n = 3 of each strain) were subject to Q-PCR using methods as described in Bartosch et al (2004) Primers sets, designed to specifically target lactobacilli, PLoS ONE | www.plosone.org 7 January 2010 | Volume 5 | Issue 1 |…”
Method
Nanoparticle curcumin ameliorates experimental colitis via modulation of gut microbiota and induction of regulatory T cells
Ohno, M., Nishida, A., Sugitani, Y., Nishino, K., Inatomi, O., Sugimoto, M., Kawahara, M., & Andoh, A. (2017) · PLoS ONE · doi:10.1371/journal.pone.0185999 · Cited by 217
Luminal and mucosal-associated intestinal microbiota in patients with diarrhea-predominant irritable bowel syndrome
Carroll, I. M., Chang, Y.-H., Park, J., Sartor, R. B., & Ringel, Y. (2010) · Gut Pathogens · doi:10.1186/1757-4749-2-19 · Cited by 203
The links between the gut microbiome, aging, modern lifestyle and Alzheimer's disease
Askarova, S., Umbayev, B., Masoud, A.-R., Kaiyrlykyzy, A., Safarova, Y., Tsoy, A., Olzhayev, F., & Kushugulova, A. (2020) · Frontiers in Cellular and Infection Microbiology · doi:10.3389/fcimb.2020.00104 · Cited by 208
The intestinal microbiota in aged mice is modulated by dietary resistant starch and correlated with improvements in host responses
Tachon, S., Zhou, J., Keenan, M. J., Martin, R. J., & Marco, M. L. (2012) · FEMS Microbiology Ecology · doi:10.1111/j.1574-6941.2012.01475.x · Cited by 212
“…genus level, depletion of specific beneficial gut bacteria such as Bifidobacterium and Akkermansia spp. has been reported for elderly individuals (Bartosch et al., 2004; van Tongeren et al., 2005; Collado et al., 2007; FEMS Microbiol Ecol 83 (2013) 299–309 ª 2012 Federation of European…”
Background
Principles and applications of polymerase chain reaction in medical diagnostic fields: a review
Valones, M. A. A., Guimarães, R. L., Brandão, L. A. C., de Souza, P. R. E., Carvalho, A. D. A. T., & Crovella, S. (2009) · Brazilian Journal of Microbiology · doi:10.1590/s1517-83822009000100001 · Cited by 203
“There are a considerable number of studies using real-time PCR in the characterization of bacterial communities in the human intestine (6,40,58).”
Background
Human gut microbiota and healthy aging: Recent developments and future prospective
Kumar, M., Babaei, P., Ji, B., & Nielsen, J. (2016) · Nutrition and Healthy Aging · doi:10.3233/nha-150002 · Cited by 211
“Most studies have analyzed variation in the gut microbiota at different stages of host age [69, 72, 73], but there have also been studies on looking into the variability at the individual-level in older subjects [74, 75].”
Background
Microbiological Effects of Consuming a Synbiotic Containing Bifidobacterium bifidum, Bifidobacterium lactis, and Oligofructose in Elderly Persons, Determined by Real-Time Polymerase Chain Reaction and Counting of Viable Bacteria
Bartosch, S., Woodmansey, E. J., Paterson, J. C. M., McMurdo, M. E. T., & Macfarlane, G. T. (2004) · Clinical Infectious Diseases · doi:10.1086/426027 · Cited by 199
“Old age is often associated with increased ill health, and it is known that detrimental changes in the gut microflora are more prevalent in hospitalized elderly patients than in older people who are healthy, whereas increased use of antibiotics in older members of the community further contributes to degenerative chan…”
BackgroundSelf-citation
Combined PCR-DGGE fingerprinting and quantitative-PCR indicates shifts in fecal population sizes and diversity of Bacteroides, bifidobacteria and Clostridium cluster IV in institutionalized elderly
Zwielehner, J., Liszt, K. I., Handschur, M., Laßl, C., Lapin, A., & Haslberger, A. G. (2009) · Experimental Gerontology · doi:10.1016/j.exger.2009.04.002 · Cited by 201
Review: Maternal health and the placental microbiome
Pelzer, E., Gómez-Arango, L. F., Barrett, H. L., & Nitert, M. D. (2016) · Placenta · doi:10.1016/j.placenta.2016.12.003 · Cited by 199
Related actions of probiotics and antibiotics on gut microbiota and weight modification
Angelakis, E., Merhej, V., & Raoult, D. (2013) · The Lancet Infectious Diseases · doi:10.1016/s1473-3099(13)70179-8 · Cited by 190
Gut Microbiome and Antibiotics
Iizumi, T., Battaglia, T., Ruiz, V. E., & Perez, G. I. P. (2017) · Archives of Medical Research · doi:10.1016/j.arcmed.2017.11.004 · Cited by 195
Dysbiosis of Intestinal Microbiota Associated With Inflammation Involved in the Progression of Acute Pancreatitis
Tan, C., Ling, Z., Huang, Y., Cao, Y.-D., Liu, Q., Cai, T., Yuan, H., Liu, C., Li, Y., & Ke-qian, X. (2015) · Pancreas · doi:10.1097/mpa.0000000000000355 · Cited by 184
The gut microbiota as a novel regulator of cardiovascular function and disease
Battson, M. L., Lee, D. M., Weir, T. L., & Gentile, C. L. (2017) · The Journal of Nutritional Biochemistry · doi:10.1016/j.jnutbio.2017.12.010 · Cited by 191
Effects of Feeding Different Postbiotics Produced by Lactobacillus plantarum on Growth Performance, Carcass Yield, Intestinal Morphology, Gut Microbiota Composition, Immune Status, and Growth Gene Expression in Broilers under Heat Stress
Humam, A. M., Loh, T. C., Foo, H. L., Samsudin, A. A., Mustapha, N. M., ZULKIFLI, I., & Izuddin, W. I. (2019) · Animals · doi:10.3390/ani9090644 · Cited by 182
“Bifidobacterium F—GGGTGGTAATGCCGGATG 278 [60] R—TAAGCCATGGACTTTCACACC”
Hospitalization type and subsequent severe sepsis
Prescott, H. C., Dickson, R. P., Rogers, M. A. M., Langa, K. M., & Iwashyna, T. J. (2015) · American Journal of Respiratory and Critical Care Medicine · doi:10.1164/rccm.201503-0483oc · Cited by 181
“diversity in hospitalized patients (17, 18).”
Background
Inter-species transplantation of gut microbiota from human to pigs
Pang, X., Hua, X., Yang, Q., Ding, D., Che, C., Cui, L., Jia, W. P., Bucheli, P., & Zhao, L. (2007) · The ISME Journal · doi:10.1038/ismej.2007.23 · Cited by 182
“Enumeration of bifidobacteria and Bacteroides spp using real-time PCR Plasmid DNA standards for real-time PCR were prepared according to Bartosch et al. (2004).”
Method
Human gut microbiota: Does diet matter?
Maukonen, J., & Saarela, M. (2015) · Proceedings of The Nutrition Society · doi:10.1017/s0029665114000688 · Cited by 177
“Moreover, when the hospitalisation was combined with antibiotic treatment, reductions in other bacterial groups were also observed((140)).”
Parkinson’s Disease and the Gastrointestinal Microbiome
Lubomski, M., Tan, A. H., Lim, S.-Y., Holmes, A. J., Davis, R. L., & Sue, C. M. (2020) · Journal of Neurology · doi:10.1007/s00415-019-09320-1 · Cited by 172
“Antibiotic therapy affects the diversity of the GM and is associated with reduced abundance of Bifidobacteria, as well as Bacteroides and Prevotella groups [130].”
Background
A randomised crossover study investigating the effects of galacto-oligosaccharides on the faecal microbiota in men and women over 50 years of age
Walton, G., van den Heuvel, E. G. H. M., Kosters, M. H. W., Rastall, R. A., Tuohy, K. M., & Gibson, G. R. (2011) · British Journal Of Nutrition · doi:10.1017/s0007114511004697 · Cited by 174
“Therefore, microbiota in the elderly and young adults have been observed to show alterations that coincide with dietary changes including increased protein intake (16) and activity changes such as reduced exercise levels (17,18) .”
Ecology and metabolism of the beneficial intestinal commensal bacteriumFaecalibacterium prausnitzii
Miquel, S., Martín, R., Bridonneau, C., Robert, V., Sokol, H., Bermúdez‐Humarán, L. G., Thomas, M., & Langella, P. (2014) · Gut Microbes · doi:10.4161/gmic.27651 · Cited by 177
Impact of a synbiotic food on the gut microbial ecology and metabolic profiles
Vitali, B., Ndagijimana, M., Cruciani, F., Carnevali, P., Candela, M., Guerzoni, M. E., & Brigidi, P. (2010) · BMC Microbiology · doi:10.1186/1471-2180-10-4 · Cited by 172
“Real-time PCR enables specific intestinal bacterial populations to be directly quantified by using DNA isolated from fecal material [23,27-29].”
Blastocystis Is Associated with Decrease of Fecal Microbiota Protective Bacteria: Comparative Analysis between Patients with Irritable Bowel Syndrome and Control Subjects
Nourrisson, C., Scanzi, J., Pereira, B., NkoudMongo, C., Wawrzyniak, I., Cian, A., Viscogliosi, É., Livrelli, V., Delbac, F., Dapoigny, M. C., et al. (2014) · PLoS ONE · doi:10.1371/journal.pone.0111868 · Cited by 182
Diabetic gut microbiota dysbiosis as an inflammaging and immunosenescence condition that fosters progression of retinopathy and nephropathy
Fernandes, R., Viana, S., Nunes, S., & Reis, F. (2018) · Biochimica et Biophysica Acta (BBA) - Molecular Basis of Disease · doi:10.1016/j.bbadis.2018.09.032 · Cited by 171
Unbalance of intestinal microbiota in atopic children
Candela, M., Rampelli, S., Turroni, S., Severgnini, M., Consolandi, C., Bellis, G. D., Masetti, R., Ricci, G., Pession, A., & Brigidi, P. (2012) · BMC Microbiology · doi:10.1186/1471-2180-12-95 · Cited by 172
The gut microbiota of centenarians: Signatures of longevity in the gut microbiota profile
Biagi, E., Rampelli, S., Turroni, S., Quercia, S., Candela, M., & Brigidi, P. (2017) · Mechanisms of Ageing and Development · doi:10.1016/j.mad.2016.12.013 · Cited by 166
Clinical Significance of the Correlation between Changes in the Major Intestinal Bacteria Species and COVID-19 Severity
Tang, L., Gu, S., Gong, Y., Li, B., Lu, H., Li, Q., Zhang, R., Gao, X., Wu, Z., Zhang, J., et al. (2020) · Engineering · doi:10.1016/j.eng.2020.05.013 · Cited by 169
“q-PCR is fast, easy to use, reliable, and less laborious than second-generation sequencing [31].”
Method
Diversity, vitality and activities of intestinal lactic acid bacteria and bifidobacteria assessed by molecular approaches
Vaughan, E. E., Heilig, H. G. H. J., BENAMOR, K., & DEVOS, W. (2005) · FEMS Microbiology Reviews · doi:10.1016/j.femsre.2005.04.009 · Cited by 191
“More recently, real-time quantitative PCR of the 16S rRNA gene is being developed for the detection and quantification of human intestinal bifidobacteria which has the advantages of being high throughput and measuring very low levels of bifidobacteria [48,65,66] (Table 1).”
Background
Characterisation of intestinal bacteria in infant stools using real-time PCR and northern hybridisation analyses
Hopkins, M. J., Macfarlane, G. T., Furrie, E., Fite, A., & Macfarlane, S. (2005) · FEMS Microbiology Ecology · doi:10.1016/j.femsec.2005.03.001 · Cited by 170
Self-citation
Dissecting the interplay between intestinal microbiota and host immunity in health and disease: Lessons learned from germfree and gnotobiotic animal models
Fiebiger, U., Bereswill, S., & Heimesaat, M. M. (2016) · European Journal of Microbiology and Immunology · doi:10.1556/1886.2016.00036 · Cited by 165
Increased Prevalence of Methanosphaera stadtmanae in Inflammatory Bowel Diseases
Lecours, P. B., Marsolais, D., Cormier, Y. F., Berberi, M., Haché, C., Bourdages, R., & Duchaine, C. (2014) · PLoS ONE · doi:10.1371/journal.pone.0087734 · Cited by 154
“Limits in DNA extraction approaches and PCR sensitivity in rich microbial environments where inhibitors are present led to a limit of detection (LOD) similar to what we usually observed [46,47,48].”
Result
Abnormal fecal microbiota community and functions in patients with hepatitis B liver cirrhosis as revealed by a metagenomic approach
Wei, X., Yan, X., Zou, D., Yang, Z., Wang, X., Liu, W., Wang, S., Li, X., Han, J., Huang, L., et al. (2013) · BMC Gastroenterology · doi:10.1186/1471-230x-13-175 · Cited by 160
“All primer sets used are listed in Table 2 [18-20].”
Prevalence and temporal stability of selected clostridial groups in irritable bowel syndrome in relation to predominant faecal bacteria
Maukonen, J., Satokari, R., Mättö, J., Söderlund, H., Mattila-Sandholm, T., & Saarela, M. (2006) · Journal of Medical Microbiology · doi:10.1099/jmm.0.46134-0 · Cited by 156
“... subjects (Table 2). The main difference between the study group of Ma ¨tto ¨ et al. (2005) and the study group in this study was that we did not include subjects who had received antimicrobial therapy during the 2 months prior to the two sampling time-points, since antibiotic therapy can cause disturbances in the…”
Result
Aging and the human gut microbiotaâ€”from correlation to causality
Saraswati, S., & Sitaraman, R. (2015) · Frontiers in Microbiology · doi:10.3389/fmicb.2014.00764 · Cited by 153
The gut microbiota of a patient with resistant tuberculosis is more comprehensively studied by culturomics than by metagenomics
Dubourg, G., Lagier, J., Armougom, F., Robert, C., Hamad, I., Brouqui, P., & Raoult, D. (2013) · European Journal of Clinical Microbiology & Infectious Diseases · doi:10.1007/s10096-012-1787-3 · Cited by 161
“Among the external factors that influence the gut microbiota, it is well known that antibiotics, notably, vancomycin [3] and ciprofloxacin [4], tend to decrease the bacterial load in the digestive tract [5, 6].”
Background
Evolution of the Human Diet and Its Impact on Gut Microbiota, Immune Responses, and Brain Health
Olmo, B. M. G., Butler, M. J., & Barrientos, R. M. (2021) · Nutrients · doi:10.3390/nu13010196 · Cited by 161
“Gut microbes do not age, but the incidences of comorbidities associated with gut microbiota tend to increase as the host grows older [37,38].”
Background
Fecal Microbiota in Patients with Irritable Bowel Syndrome Compared with Healthy Controls Using Real-Time Polymerase Chain Reaction: An Evidence of Dysbiosis
Shukla, R., Ghoshal, U., Dhole, T. N., & Ghoshal, U. C. (2015) · Digestive Diseases and Sciences · doi:10.1007/s10620-015-3607-y · Cited by 147
“Patients with IBS (diagnosed using Rome III criteria, n = 47) and HC (n = 30) were comparable in age (mean 34 years [19–68] vs.”
Method
The human gut microbiome, a taxonomic conundrum
Sankar, S. A., Lagier, J., Pontarotti, P., Raoult, D., & Fournier, P. (2015) · Systematic and Applied Microbiology · doi:10.1016/j.syapm.2015.03.004 · Cited by 157

Authors: Bartosch, S., Fite, A., Macfarlane, G. T., & McMurdo, M. E. T.
Affiliations: University of Dundee (GB)
MRC Microbiology and Gut Biology Group
Venue: Applied and Environmental Microbiology
Publisher: American Society for Microbiology
Published: 2004-06
Volume: 70
Issue: 6
Pages: 3575-3581
ISSN: 0099-2240 (ISSN-L)
1098-5336
DOI: 10.1128/aem.70.6.3575-3581.2004
PMC: PMC427772
OpenAlex: W2109744701
Cited by: 762
References: 51
Citations by year: 2026: 15 · 2025: 29 · 2024: 12 · 2023: 31 · 2022: 36 · 2021: 51 · 2020: 49 · 2019: 36 · 2018: 38 · 2017: 63 · 2016: 59 · 2015: 65 · 2014: 44 · 2013: 46 · 2012: 46
FWCI: 4.63
Type: journal article
Language: en
Open access: green
europepmc.org
Licence: journals.asm.org/non-commercial-tdm-license (tdm)
Locations: Applied and Environmental Microbiology (publishedVersion)
Europe PMC (PubMed Central) (publishedVersion)
PubMed Central (publishedVersion)
PubMed (publishedVersion)
Discovery Research Portal (University of Dundee) (submittedVersion)
Funders: Medical Research Council
Topics: Life Sciences › Biochemistry, Genetics and Molecular Biology › Molecular Biology › Gut microbiota and health
Health Sciences › Medicine › Infectious Diseases › Clostridium difficile and Clostridium perfringens research
Physical Sciences › Environmental Science › Ecology › Microbial Community Ecology and Physiology
Keywords: fecal microbiota, older adults, hospitalized patients, antibiotic therapy, Bifidobacterium, Desulfovibrio, Faecalibacterium prausnitzii, 16S rRNA gene quantification, Enterobacteriaceae, Enterococcus faecalis, intestinal bacteria, community-acquired infections
MeSH terms: Aged, Aged, 80 and over, Anti-Bacterial Agents, Bacteria, Bacterial Infections, DNA, Bacterial, DNA, Ribosomal, Feces, Hospitalization, Humans, RNA, Ribosomal, 16S, Species Specificity, Polymerase Chain Reaction, Ecosystem, DNA Primers, Gene Dosage, Genes, rRNA

About these checks

Registry, retraction, Cites and statistics results are computed, not judged, with one exception: a printed reference that no index lists is read once by a model before it counts as a citation error. Claims are extracted by a model and kept only when their quote appears verbatim in the text; each cited source is then checked, with a model’s help, for whether it says what the claim relies on. Those verdicts can be wrong — read the claim’s quote and the cited source before relying on one.

Statistics and arithmetic are recomputed, not judged.

Confidence bands are shown only for fields calibrated on our annotated test set. None is calibrated yet, so no band is shown.

What counts as a claim ›How we measure confidence ›How we check this ›

Are you an author, or do you see a problem with this page? Request a review

Characterization of Bacterial Communities in Feces from Healthy Elderly Volunteers and Hospitalized Elderly Patients by Using Real-Time PCR and Effects of Antibiotic Treatment on the Fecal Microbiota

Abstract

Overview

Integrity signals

Verification

Claims the paper makes

Claims other papers make about this one

Self-check

Citations

Cites

Cited by

Related

Metadata

Record

About these checks