Cited by 762Gut microbiota and healthClostridium difficile and Clostridium perfringens researchMicrobial Community Ecology and Physiology

The DOI matches its Crossref record; 51 of the 51 references it cites were found in a registry or an index.

Characterization of Bacterial Communities in Feces from Healthy Elderly Volunteers and Hospitalized Elderly Patients by Using Real-Time PCR and Effects of Antibiotic Treatment on the Fecal Microbiota

Open access

Bartosch, Sabine, Fite, Alemu, Macfarlane, George T., McMurdo, Marion E. T.·2004·Applied and Environmental Microbiology

DOI 10.1128/aem.70.6.3575-3581.2004PMC PMC427772

Open this paper in CoChat — free account

Abstract

Fecal bacteria were studied in healthy elderly volunteers (age, 63 to 90 years;n= 35) living in the local community, elderly hospitalized patients (age, 66 to 103;n= 38), and elderly hospitalized patients receiving antibiotic treatment (age, 65 to 100;n= 21). Group- and species-specific primer sets targeting 16S rRNA genes were used to quantitate intestinal bacteria by using DNA extracted from feces and real-time PCR. The principal difference between healthy elderly volunteers and both patient cohorts was a marked reduction in the Bacteroides-Prevotella group following hospitalization. Reductions in bifidobacteria,Desulfovibrio spp.,Clostridium clostridiiforme, and Faecalibacterium prausnitzii were also found in the hospitalized patients. However, total 16S rRNA gene copy numbers (per gram of wet weight of feces) were generally lower in the stool samples of the two groups of hospitalized patients compared to the number in the stool samples of elderly volunteers living in the community, so the relative abundance (percentage of the group- and species-specific rRNA gene copies in relation to total bacterial rRNA gene copies) of bifidobacteria,Desulfovibrio spp.,C. clostridiiforme, and F. prausnitzii did not change. Antibiotic treatment resulted in further reductions in the numbers of bacteria and their prevalence and, in some patients, complete elimination of certain bacterial communities. Conversely, the numbers of enterobacteria increased in the hospitalized patients who did not receive antibiotics, and due to profound changes in fecal microbiotas during antibiotic treatment, the opportunistic species Enterococcus faecalis proliferated.

The claims and statistics of this paper haven’t been checked yet.

Run the check — free, no account needed. It reads the open-access text and checks the sources it cites.

Integrity signals

Registry

Crossref · 10.1128/aem.70.6.3575-3581.2004

Cites

51 of 51 references verified0 citation errors · 0 not checkable

Statistics

Claims the paper makes

The claims and statistics of this paper haven’t been checked yet.

Run the check — free, no account needed. It reads the open-access text and checks the sources it cites.

Claims other papers make about this one

Each is checked against this paper’s own text: does it say what the citing paper says it does?

Self-check

Percentages, sums and reported differences re-computed from the paper’s own numbers.

The self-check needs the paper’s full text.

Bergey's Manual of Systematic Bacteriology
(1990) · Annals of Internal Medicine · doi:10.7326/0003-4819-112-5-391_3 · Cited by 15,633
Determination of bacterial load by real-time PCR using a broad-range (universal) probe and primers set
Nadkarni, M. A., Martin, F. E., Jacques, N. A., & Hunter, N. (2002) · Microbiology · doi:10.1099/00221287-148-1-257 · Cited by 1,931
Direct analysis of genes encoding 16S rRNA from complex communities reveals many novel molecular species within the human gut
Suau, A., Bonnet, R., Sutren, M., Godon, J.-J., Gibson, G. R., Collins, M. D., & Doré, J. (1999) · Applied and Environmental Microbiology · doi:10.1128/aem.65.11.4799-4807.1999 · Cited by 1,490
The Ribosomal Database Project (RDP-II): previewing a new autoaligner that allows regular updates and the new prokaryotic taxonomy
Cole, J. R. (2003) · Nucleic Acids Research · doi:10.1093/nar/gkg039 · Cited by 1,435
Temperature Gradient Gel Electrophoresis Analysis of 16S rRNA from Human Fecal Samples Reveals Stable and Host-Specific Communities of Active Bacteria
Zoetendal, E. G., Akkermans, A. D. L., & de Vos, W. M. (1998) · Applied and Environmental Microbiology · doi:10.1128/aem.64.10.3854-3859.1998 · Cited by 1,360
rrndb: the Ribosomal RNA Operon Copy Number Database
Klappenbach, J., Saxman, P., Cole, J., & Schmidt, T. M. (2001) · Nucleic Acids Res. · doi:10.1093/nar/29.1.181 · Cited by 1,140
Quantitative fluorescence in situ hybridization of Bifidobacterium spp. with genus-specific 16S rRNA-targeted probes and its application in fecal samples
Langendijk-Genevaux, P. S., Schut, F., Jansen, G. J., Raangs, G. C., Kamphuis, G. R., Wilkinson, M. H. F., & Welling, G. W. (1995) · Applied and Environmental Microbiology · doi:10.1128/aem.61.8.3069-3075.1995 · Cited by 974
Effect of antimicrobial agents on the ecological balance of human microflora
Sullivan, Å., Edlund, C., & Nord, C. E. (2001) · The Lancet Infectious Diseases · doi:10.1016/s1473-3099(01)00066-4 · Cited by 816
Growth requirements and fermentation products of Fusobacterium prausnitzii, and a proposal to reclassify it as Faecalibacterium prausnitzii gen. nov., comb. nov
Duncan, S. H., Hold, G. L., Harmsen, H. J. M., Stewart, C. S., & Flint, H. J. (2002) · INTERNATIONAL JOURNAL OF SYSTEMATIC AND EVOLUTIONARY MICROBIOLOGY · doi:10.1099/00207713-52-6-2141 · Cited by 753
Development of 16S rRNA-Gene-Targeted Group-Specific Primers for the Detection and Identification of Predominant Bacteria in Human Feces
Matsuki, T., Watanabe, K., Fujimoto, J., Miyamoto, Y., Takada, T., Matsumoto, K., Oyaizu, H., & Tanaka, R. (2002) · Applied and Environmental Microbiology · doi:10.1128/aem.68.11.5445-5451.2002 · Cited by 663

Flagged first, then by citations

Show all 51 references

Research works printed but not linked: 2

10.1111/j.1574-6968.1991.tb04588.x · DOI
Mitsuoka, T., K. Hayakawa, and N. Kimura. 1974. Die Faekalflora bei Menschen II. Mitteilung: Die Zusammensetzung der Bifidobakterienflora der verschiedenen Altersgruppen. Zentbl. Bakteriol. Hyg. Abt. 1 Orig. A226:469-478.

Sorted by citations

Items 201–300 of 761

In vitro probiotic characteristics of Lactobacillus plantarum ZDY 2013 and its modulatory effect on gut microbiota of mice
Huang, R., Tao, X., Wan, C., Li, S., Xu, H., Xu, F., Shah, N. P., & Wei, H. (2015) · Journal of Dairy Science · doi:10.3168/jds.2014-9153 · Cited by 76
Effect of Bacillus subtilis and Bacillus licheniformis supplementation in diets with low- and high-protein content on ileal crude protein and amino acid digestibility and intestinal microbiota composition of growing pigs
Kaewtapee, C., Burbach, K., Tomforde, G., Hartinger, T., Camarinha‐Silva, A., Heinritz, S. N., Seifert, J., Wiltafsky-Martin, M. K., Mosenthin, R., & Rosenfelder, P. (2017) · Journal of Animal Science and Biotechnology/Journal of animal science and biotechnology · doi:10.1186/s40104-017-0168-2 · Cited by 79
The complex microbiome from native semen to embryo culture environment in human in vitro fertilization procedure
Štšepetova, J., Baranova, J., Simm, J., Parm, Ü., Rööp, T., Sokmann, S., Korrovits, P., Jaagura, M., Rosenstein, K., Salumets, A., et al. (2020) · Reproductive Biology and Endocrinology · doi:10.1186/s12958-019-0562-z · Cited by 75
“[13] that was not found by 454 pyrosequencing.”
Background
Impact of the Consumption of Tea Polyphenols on Early Atherosclerotic Lesion Formation and Intestinal Bifidobacteria in High-Fat-Fed ApoE−/− Mice
Liao, Z., Zeng, B., Wang, W., Li, G., Wu, F. L., Wang, L., Zhong, Q., Wei, H., & Fang, X. (2016) · Frontiers in Nutrition · doi:10.3389/fnut.2016.00042 · Cited by 75
Microbiome: Effects of Ageing and Diet
Salazar, N., González, S., Nogacka, A. M., Ríos-Covián, D., Arboleya, S., Gueimonde, M., & Reyes‐Gavilán, C. G. D. L. (2019) · Current Issues in Molecular Biology · doi:10.21775/cimb.036.033 · Cited by 75
Predominant genera of fecal microbiota in children with atopic dermatitis are not altered by intake of probiotic bacteria Lactobacillus acidophilus NCFM and Bifidobacterium animalis subsp. lactis Bi-07
Larsen, N., Vogensen, F. K., Gøbel, R. J., Michaelsen, K. F., Al‐Soud, W. A., Sørensen, S. J., Hansen, L. H., & Jakobsen, M. (2010) · FEMS Microbiology Ecology · doi:10.1111/j.1574-6941.2010.01024.x · Cited by 73
Effects of dietary combinations of organic acids and medium chain fatty acids as a replacement of zinc oxide on growth, digestibility and immunity of weaned pigs
Kuang, Y.-C., Wang, Y., Zhang, Y., Song, Y., Zhang, X., Lin, Y., Che, L., Xu, S., Wu, D., Xue, B., et al. (2015) · Animal Feed Science and Technology · doi:10.1016/j.anifeedsci.2015.07.010 · Cited by 74
“Enterobacteriaceae F-CATTGACGTTACCCGCAGAAGAAGC 52 Bartosch et al. (2004)”
Fermentation properties of isomaltooligosaccharides are affected by human fecal enterotypes
Wu, Q., Pi, X., Liu, W., Chen, H., Yin, Y., Yu, H. D., Wang, X., & Zhu, L. (2017) · Anaerobe · doi:10.1016/j.anaerobe.2017.08.016 · Cited by 73
Amoxicillin treatment modifies the composition of Bifidobacterium species in infant intestinal microbiota
Mangin, I., Suau, A., Gotteland, M., Brunser, O., & Pochart, P. (2010) · Anaerobe · doi:10.1016/j.anaerobe.2010.06.005 · Cited by 77
Concentrates of two subsets of extracellular vesicles from cow’s milk modulate symptoms and inflammation in experimental colitis
Benmoussa, A., Diallo, I., Salem, M., Michel, S., Gilbert, C., Sévigny, J., & Provost, P. (2019) · Scientific Reports · doi:10.1038/s41598-019-51092-1 · Cited by 76
Long-term effects of early antibiotic intervention on blood parameters, apparent nutrient digestibility, and fecal microbial fermentation profile in pigs with different dietary protein levels
Yu, M., Zhang, C., Yang, Y., Mu, C., Su, Y., Yu, K., & Zhu, W. (2017) · Journal of Animal Science and Biotechnology/Journal of animal science and biotechnology · doi:10.1186/s40104-017-0192-2 · Cited by 72
“Clostridium XIVa Forward: CGGTACCTGACTAAGAAGC [41]”
Natural killer T cells play a necessary role in modulating of immune-mediated liver injury by gut microbiota
Chen, J., Wei, Y., He, J., Cui, G., Zhu, Y., Lu, C., Ding, Y., Xue, R., Bai, L., Uede, T., et al. (2014) · Scientific Reports · doi:10.1038/srep07259 · Cited by 71
Correlation Coefficients Between Different Methods of Expressing Bacterial Quantification Using Real Time PCR
Navidshad, B., Liang, J. B., & Jahromi, M. F. (2012) · International Journal of Molecular Sciences · doi:10.3390/ijms13022119 · Cited by 71
“The following primers (10 ng/mL concentration) were used to quantify different bacteria populations: for total bacteria, F-5′-CGGCAACGAGCGCAACCC-3′ and R-5′-CCATTGTAGCACG TGTGTAGCC-3′ [31]; for Lactobacilli, F-5′-CATCCAGTGCAAACCTAAGAG-3′ and R-5′-GATC CGCTTGCCTTCGCA-3′ [32]; for Escherichia coli, F-5′-GTGTGATATCTACCCG…”
α-Haemolysin of Escherichia coli in IBD: a potentiator of inflammatory activity in the colon
Bücker, R., Schulz, E., Günzel, D., Bojarski, C., Lee, I.-F. M., John, L., Wiegand, S., Janßen, T., Wieler, L. H., Dobrindt, U., et al. (2014) · Gut · doi:10.1136/gutjnl-2013-306099 · Cited by 71
Detection of Human Intestinal Catalase-Negative, Gram-Positive Cocci by rRNA-Targeted Reverse Transcription-PCR
Kubota, H., Tsuji, H., Matsuda, K., Kurakawa, T., Asahara, T., & Nomoto, K. (2010) · Applied and Environmental Microbiology · doi:10.1128/aem.03132-09 · Cited by 73
“Although many studies have demonstrated the application of qPCR for analysis of fecal samples (3, 4, 13, 19, 20, 25, 41, 55), these quantitative detections were limited to several species or restricted to the range above 10(5) cells per gram feces, which is insufficient for the analysis of the subdominant populations…”
BackgroundMethod
Diversity of Intestinal Clostridium coccoides Group in the Japanese Population, as Demonstrated by Reverse Transcription-Quantitative PCR
Kurakawa, T., Ogata, K., Matsuda, K., Tsuji, H., Kubota, H., Takada, T., Kado, Y., Asahara, T., Takahashi, T., & Nomoto, K. (2015) · PLoS ONE · doi:10.1371/journal.pone.0126226 · Cited by 74
The strict anaerobic gut microbe Eubacterium hallii transforms the carcinogenic dietary heterocyclic amine 2‐amino‐1‐methyl‐6‐phenylimidazo[4,5‐b]pyridine ( PhIP )
Fekry, M. I., Engels, C., Zhang, J., Schwab, C., Lacroix, C., Sturla, S. J., & Chassard, C. (2015) · Environmental Microbiology Reports · doi:10.1111/1758-2229.12369 · Cited by 72
— Invited Review — Metagenomic investigation of gastrointestinal microbiome in cattle
Kim, M., Park, T., & Yu, Z. (2017) · Asian-Australasian Journal of Animal Sciences · doi:10.5713/ajas.17.0544 · Cited by 75
“Bacteroides and Prevotella GAAGGTCCCCCACATTG CAATCGGAGTTCTTCGTG 56 418 [122]”
Background
High Amylose Starch with Low In Vitro Digestibility Stimulates Hindgut Fermentation and Has a Bifidogenic Effect in Weaned Pigs
Fouhse, J. M., Gänzle, M. G., Regmi, P. R., Kempen, T. A. T. G. V., & Zijlstra, R. T. (2015) · Journal of Nutrition · doi:10.3945/jn.115.214353 · Cited by 68
Prebiotics in the Gastrointestinal Tract
Macfarlane, S. (2010) · Elsevier eBooks · doi:10.1016/b978-0-12-374938-3.00010-4 · Cited by 68
Gut microbiota of healthy elderly NSAID users is selectively modified with the administration of Lactobacillus acidophilus NCFM and lactitol
Björklund, M., Ouwehand, A. C., Forssten, S. D., Nikkilä, J., Tiihonen, K., Rautonen, N., & Lahtinen, S. J. (2012) · AGE · doi:10.1007/s11357-011-9294-5 · Cited by 67
Dietary supplementation with a nucleotide-rich yeast extract modulates gut immune response and microflora in weaned pigs in response to a sanitary challenge
Waititu, S. M., Yin, F., Patterson, R., Yitbarek, A., Rodriguez-Lecompte, J. C., & Nyachoti, C. M. (2017) · animal · doi:10.1017/s1751731117001276 · Cited by 71
Lactobacillus gasseri KS-13,Bifidobacterium bifidum G9-1, and Bifidobacterium longum MM-2 Ingestion Induces a Less Inflammatory Cytokine Profile and a Potentially Beneficial Shift in Gut Microbiota in Older Adults: A Randomized, Double-Blind, Placebo-Controlled, Crossover Study
Spaiser, S. J., Culpepper, T., Nieves, C., Ukhanova, M., Mai, V., Percival, S. S., Christman, M. C., & Langkamp-Henken, B. (2015) · Journal of the American College of Nutrition · doi:10.1080/07315724.2014.983249 · Cited by 66
Evaluation of different storage methods to characterize the fecal bacterial communities of captive western lowland gorillas (Gorilla gorilla gorilla)
Vlčková, K., Mrázek, J., Kopečný, J., & Petrželková, K. J. (2012) · Journal of Microbiological Methods · doi:10.1016/j.mimet.2012.07.015 · Cited by 68
“…to the authors: all eubacteria (Nadkarni et al., 2002; Bartosch et al., 2004), Bifidobacterium group (Temmerman et al., 2003), Bacteroides group (Bartosch et al., 2004), Lactobacillus group (Walter et al., 2001; Heilig et al., 2002), Enterobacteriaceae (Bartosch et al., 2004), and Clostridium…”
BackgroundMethodInfluential
Therapeutic interventions for gut dysbiosis and related disorders in the elderly: antibiotics, probiotics or faecal microbiota transplantation?
Vemuri, R., Gundamaraju, R., Shinde, T., & Eri, R. D. (2016) · Beneficial Microbes · doi:10.3920/bm2016.0115 · Cited by 69
Polysaccharide and phlorotannin-enriched extracts of the brown seaweed Ecklonia radiata influence human gut microbiota and fermentation in vitro
Charoensiddhi, S., Conlon, M. A., Vuaran, M. S., Franco, C. M. M., & Zhang, W. Y. (2017) · Journal of Applied Phycology · doi:10.1007/s10811-017-1146-y · Cited by 66
“…after 24 h fermentation with a series of microbe-specific primer pairs according to the modified methods from Guo et al. (2008) for Firmicutes, Bartosch et al. (2004) for Bacteroides-Prevotella, and Charoensiddhi et al. (2016a) for the rest of the target bacteria (Bacteroidetes,…”
MethodInfluential
Probiotics-loaded nanoparticles attenuated colon inflammation, oxidative stress, and apoptosis in colitis
Al-Kushi, A. G., Abdelfattah‐Hassan, A., Eldoumani, H., Elazab, S. T., Mohamed, S. A. M., Metwally, A. S., El‐Shetry, E. S., Saleh, A. A., ElSawy, N. A., & Ibrahim, D. (2022) · Scientific Reports · doi:10.1038/s41598-022-08915-5 · Cited by 66
Different Types of Dietary Fibers Trigger Specific Alterations in Composition and Predicted Functions of Colonic Bacterial Communities in BALB/c Mice
Luo, Y., Zhang, L., Li, H., Smidt, H., Wright, A. G., Zhang, K., Ding, X., Zeng, Q., Bai, S., Wang, J., et al. (2017) · Frontiers in Microbiology · doi:10.3389/fmicb.2017.00966 · Cited by 63
Role of Probiotics, Prebiotics, and Synbiotics in the Elderly: Insights Into Their Applications
Ale, E. C., & Binetti, A. G. (2021) · Frontiers in Microbiology · doi:10.3389/fmicb.2021.631254 · Cited by 67
454 pyrosequencing reveals changes in the faecal microbiota of adults consumingLactobacillus caseiZhang
Zhang, J., Wang, L., Guo, Z., Sun, Z., Gesudu, Q., Kwok, L., Menghebilige, & Zhang, H. (2014) · FEMS Microbiology Ecology · doi:10.1111/1574-6941.12328 · Cited by 64
Analysis of the rumen bacterial diversity of goats during shift from forage to concentrate diet
Grilli, D., Fliegerova, K. O., Kopečný, J., Lama, S. P., Egea, V., Sohaefer, N., Pereyra, C., Ruiz, M. S., Sosa, M. A., Arenas, G. N., et al. (2016) · Anaerobe · doi:10.1016/j.anaerobe.2016.07.002 · Cited by 66
“group Bac303F GAAGGTCCCCCACATTG 418 56 [29]”
The Effect of Bifidobacterium animalis ssp. lactis HN019 on Cellular Immune Function in Healthy Elderly Subjects: Systematic Review and Meta-Analysis
Miller, L. E., Lehtoranta, L., & Lehtinen, M. J. (2017) · Nutrients · doi:10.3390/nu9030191 · Cited by 66
“For instance, lower bifidobacteria levels have been found to associate with increased risk of Clostridium difficile associated diarrhea [15], hospitalization [16], antibiotic treatment [17], and frailty [18].”
Background
Molecular characterization of alterations in the intestinal microbiota of patients with grade 3 hypertension
Mushtaq, N., Hussain, S., Zhang, S., Lü, Y., Li, H., Ullah, S., Wang, Y., & Xu, J. (2019) · International Journal of Molecular Medicine · doi:10.3892/ijmm.2019.4235 · Cited by 65
Main gut bacterial composition differs between patients with type 1 and type 2 diabetes and non-diabetic adults
Ejtahed, H., Tavassol, Z. H., Khatami, S., Zangeneh, M., Behrouzi, A., Badi, S. A., Moshiri, A., Hasani‐Ranjbar, S., Soroush, A., Vaziri, F., et al. (2020) · Journal of Diabetes & Metabolic Disorders · doi:10.1007/s40200-020-00502-7 · Cited by 64
Cooperative action of gut-microbiota-accessible carbohydrates improves host metabolic function
Tomioka, S., Seki, N., Sugiura, Y., Akiyama, M., Uchiyama, J., Yamaguchi, G., Yakabe, K., Ejima, R., Hattori, K., Kimizuka, T., et al. (2022) · Cell Reports · doi:10.1016/j.celrep.2022.111087 · Cited by 63
Effects of Agave tequilana fructans with different degree of polymerization profiles on the body weight, blood lipids and count of fecal Lactobacilli/Bifidobacteria in obese mice
Márquez-Aguirre, A. L., Camacho-Ruiz, R. M., Arriaga‐Alba, M., Padilla‐Camberos, E., Kirchmayr, M. R., Blasco, J. L., & González‐Ávila, M. (2013) · Food & Function · doi:10.1039/c3fo60083a · Cited by 62
Promotion of Intestinal Peristalsis by Bifidobacterium spp. Capable of Hydrolysing Sennosides in Mice
Matsumoto, M., Ishige, A., Yazawa, Y., Kondo, M., Muramatsu, K., & Watanabe, K. (2012) · PLoS ONE · doi:10.1371/journal.pone.0031700 · Cited by 62
“[26] This explains why daio does not effectively treat constipation in many patients.”
Background
Distinct gut microbiota of healthy children from two different geographic regions of Thailand
La-ongkham, O., Nakphaichit, M., Leelavatcharamas, V., Keawsompong, S., & Nitisinprasert, S. (2015) · Archives of Microbiology · doi:10.1007/s00203-015-1089-0 · Cited by 65
Insoluble Dietary Fiber from Pear Pomace Can Prevent High-Fat Diet-Induced Obesity in Rats Mainly by Improving the Structure of the Gut Microbiota
Chang, S., Cui, X., Guo, M., Tian, Y., Xu, W., Huang, K., & Zhang, Y. (2017) · Journal of Microbiology and Biotechnology · doi:10.4014/jmb.1610.10058 · Cited by 62
Microbiota and healthy ageing: observational and nutritional intervention studies
Brüssow, H. (2013) · Microbial Biotechnology · doi:10.1111/1751-7915.12048 · Cited by 61
“…not a sufficiently strong disturbing factor to upset the gut microbiota composition, it might need addition events like antibiotic treatment (Bartosch et al., 2004; Woodmansey et al., 2004) or Clostridium difficile infection (Hopkins et al., 2001; Hopkins and MacFarlane, 2002) to get…”
BackgroundInfluential
Analysis of the large bowel microbiota of colitic mice using PCR/DGGE
Bibiloni, R., Simon, M. A., Albright, C. A., Sartor, B. R., & Tannock, G. W. (2005) · Letters in Applied Microbiology · doi:10.1111/j.1472-765x.2005.01720.x · Cited by 61
“…bacterial populations, real-time quantitative PCR is a widely used method for this purpose, emphasizing that these theoretical objections are of small significance in comparative studies (Huijsdens et al. 2002; Requena et al. 2002; Bartosch et al. 2004; Gueimonde et al. 2004; Matsuki et al. 2004).”
Method
Intestinal microbiota: The explosive mixture at the origin of inflammatory bowel disease?
Bringiotti, R. (2014) · World Journal of Gastrointestinal Pathophysiology · doi:10.4291/wjgp.v5.i4.550 · Cited by 65
Age-related changes in the gut microbiota and the core gut microbiome of healthy Thai humans
La-ongkham, O., Nakphaichit, M., Nakayama, J., Keawsompong, S., & Nitisinprasert, S. (2020) · 3 Biotech · doi:10.1007/s13205-020-02265-7 · Cited by 61
“Most common studies have shown decreasing numbers of strict anaerobes (bifidobacteria, bacteroides and clostridia) and increasing numbers of facultative anaerobes (streptococci, staphylococci, enterococci and enterobacteria) in elderly subjects (Hayashi et al. 2003; Bartosch et al. 2004; Mueller et al. 2006; Mariat et…”
BackgroundInfluential
Exploring the microbiota-gut-brain axis: impact on brain structure and function
Yassin, L. K., Nakhal, M. M., Alderei, A., Almehairbi, A., Mydeen, A. B., Akour, A. A., & Hamad, M. I. K. (2025) · Frontiers in Neuroanatomy · doi:10.3389/fnana.2025.1504065 · Cited by 64
Influence of age on the absorption, metabolism, and excretion of cocoa flavanols in healthy subjects
Rodriguez‐Mateos, A., Cifuentes‐Gomez, T., Gonzalez‐Salvador, I., Ottaviani, J. I., Schroeter, H., Kelm, M., Heiß, C., & Spencer, J. P. E. (2015) · Molecular Nutrition & Food Research · doi:10.1002/mnfr.201500091 · Cited by 61
The composition and metabolic activity of child gut microbiota demonstrate differential adaptation to varied nutrient loads in an in vitro model of colonic fermentation
Payne, A. N., Chassard, C., Banz, Y., & Lacroix, C. (2012) · FEMS Microbiology Ecology · doi:10.1111/j.1574-6941.2012.01330.x · Cited by 64
Populations of Select Cultured and Uncultured Bacteria in the Rumen of Sheep and the Effect of Diets and Ruminal Fractions
Stiverson, J. A., Morrison, M., & Yu, Z. (2011) · International Journal of Microbiology · doi:10.1155/2011/750613 · Cited by 60
“Bac303f GAA GGT CCC CCA CAT TG Bacteroides and Prevotella 56 418 [21] Bac708r CAA TCG GAG TTC TTC GTG”
Transitions in Oral and Intestinal Microflora Composition and Innate Immune Receptor-Dependent Stimulation during Mouse Development
Hasegawa, M., Osaka, T., Tawaratsumida, K., Yamazaki, T., Tada, H., Chen, G., Tsuneda, S., Núñez, G., & Inohara, N. (2009) · Infection and Immunity · doi:10.1128/iai.01043-09 · Cited by 58
“To determine the DNA amounts of enterobacteria, quantitative PCR was performed by using universal 16S rRNA gene primers Eco1457F/Eco1652R(4) with various cycles at 94°C for 1 min, 65°C for 1 min, and 72°C for 1 min on an ABI Prism 7900HT system (Applied Biosystems, Foster City, CA).”
Background
Antibiotic treatments and microbes in the gut
Macfarlane, S. (2014) · Environmental Microbiology · doi:10.1111/1462-2920.12399 · Cited by 61
“…effects of antibiotics on the physiology and antibiotic resistance of commensal bacteria, advances in molecular approaches (Donskey et al., 2003; Bartosch et al., 2004; Jernberg et al., 2007; Dethlefsen et al., 2008) have increased our knowledge of antibiotic-related changes in gut community…”
Influential
Senior Thai Fecal Microbiota Comparison Between Vegetarians and Non-Vegetarians Using PCR-DGGE and Real-Time PCR
Ruengsomwong, S., Korenori, Y., Sakamoto, N., Wannissorn, B., Nakayama, J., & Nitisinprasert, S. (2014) · Journal of Microbiology and Biotechnology · doi:10.4014/jmb.1310.10043 · Cited by 61
Effects of antibiotic residues in milk on growth, ruminal fermentation, and microbial community of preweaning dairy calves
Li, J. H., Yousif, M., Li, Z. Q., Wu, Z., Li, S. L., Yang, H., Wang, Y. J., & Cao, Z. (2019) · Journal of Dairy Science · doi:10.3168/jds.2018-15506 · Cited by 65
Development of intestinal bifidobacteria and lactobacilli in breast-fed neonates
Chen, J., Cai, W., & Feng, Y. (2007) · Clinical Nutrition · doi:10.1016/j.clnu.2007.03.003 · Cited by 59
Small Bowel Resection Induces Long-Term Changes in the Enteric Microbiota of Mice
Sommovilla, J., Zhou, Y., Sun, R. C., Choi, P. M., Diaz-Miron, J. L., Shaikh, N., Sodergren, E. J., Warner, B. B., Weinstock, G. M., Tarr, P. I., et al. (2014) · Journal of Gastrointestinal Surgery · doi:10.1007/s11605-014-2631-0 · Cited by 59
Our gut microbiota: a long walk to homeostasis
Dicks, L. M. T., Geldenhuys, J., Mikkelsen, L. S., Brandsborg, E., & Marcotte, H. (2017) · Beneficial Microbes · doi:10.3920/bm2017.0066 · Cited by 61
Exploring the effects of galacto-oligosaccharides on the gut microbiota of healthy adults receiving amoxicillin treatment
Ladirat, S. E., Schoterman, M. H. C., Rahaoui, H., Mars, M., Schuren, F. H. J., Gruppen, H., Nauta, A., & Schols, H. A. (2014) · British Journal Of Nutrition · doi:10.1017/s0007114514001135 · Cited by 60
“In both the placebo and GOS groups, the mean number of total bacteria remained stable during AMX treatment, which is in contradiction to the results of previous in vivo studies((32,33)).”
Enterohemorrhagic Escherichia coli infection has donor-dependent effect on human gut microbiota and may be antagonized by probiotic yeast during interaction with Peyer’s patches
Thévenot, J., Cordonnier, C., Rougeron, A., Goff, O. L., Nguyen, H. T. T., Denis, S., Alric, M., Livrelli, V., & Blanquet‐Diot, S. (2015) · Applied Microbiology and Biotechnology · doi:10.1007/s00253-015-6704-0 · Cited by 57
“In this study, we chose to use a prophylactic strategy, as previous studies by Dahan et al. (2003) and Dalmasso et al. (2006) with the well-known probiotic yeast S. boulardii showed that preincubation, but not coincubation, of EHEC-infected T84 cells with the probiotic decreased IL-8 secretion and TNF-α induced apopto…”
Background
Gut Check Time: Antibiotic Delivery Strategies to Reduce Antimicrobial Resistance
Kelly, S. A., Rodgers, A. M., O’Brien, S., Donnelly, R. F., & Gilmore, B. (2019) · Trends in biotechnology · doi:10.1016/j.tibtech.2019.10.008 · Cited by 57
Relative Abundance ofBacteroidesspp. in Stools and Wastewaters as Determined by Hierarchical Oligonucleotide Primer Extension
Hong, P., Wu, J., & Liu, W. (2008) · Applied and Environmental Microbiology · doi:10.1128/aem.02568-07 · Cited by 57
“cultivation and the use of conventional molecular tools (2, 4, 10, 19, 21, 33).”
Method
Resistant starch from high amylose maize (HAM‐RS2) reduces body fat and increases gut bacteria in ovariectomized (OVX) rats
Keenan, M. J., Janes, M. E., Robert, J., Martin, R. J., Raggio, A. M., McCutcheon, K. L., Pelkman, C., Tulley, R. T., Goita, M., Durham, H. A., et al. (2013) · Obesity · doi:10.1002/oby.20109 · Cited by 56
“Quantitative real-time PCR Primers for quantitative PCR (qPCR) from previous reports were used for estimation of Lactobacillus species, (5), Bifidobacterium species (6), Clostridium cluster IV (7), Clostridium cluster XIVaþb (8), and the total bacterial domain (9).”
Method
Enhanced preservation of the human intestinal microbiota by ridinilazole, a novel Clostridium difficile-targeting antibacterial, compared to vancomycin
Thorpe, C. M., Kane, A. V., Chang, J. H., Tai, A., Vickers, R. J., & Snydman, D. R. (2018) · PLoS ONE · doi:10.1371/journal.pone.0199810 · Cited by 56
Preventing subclinical necrotic enteritis through Lactobacillus johnsonii BS15 by ameliorating lipid metabolism and intestinal microflora in broiler chickens
Qing, X., Zeng, D., Wang, H., Ni, X., Lin, L., Lai, J., Khalique, A., Pan, K., & Jing, B. (2017) · AMB Express · doi:10.1186/s13568-017-0439-5 · Cited by 54
“…F: TCGCGTCYGGTGTGAAAG R: CCACATCCAGCRTCCAC 56.9 243 Rinttilä et al. (2004) Enterobacteriaceae F: CATTGACGTTACCCGCAGAAGAAGC R: CTCTACGAGACTCAAGCTTGC 62.5 195 Bartosch et al. (2004) Means in the same row with no superscripts or with a common superscript letter do not differ significantly (P < 0.05).”
Influential
Transplant of microbiota from long-living people to mice reduces aging-related indices and transfers beneficial bacteria
Chen, Y., Zhang, S., Zeng, B., Zhao, J., Yang, M., Zhang, M., Li, Y., Ni, Q., Wu, D., & Li, Y. (2020) · Aging · doi:10.18632/aging.102872 · Cited by 54
Influence of Bifidobacterium longum BB536 intake on faecal microbiota in individuals with Japanese cedar pollinosis during the pollen season
Odamaki, T., Xiao, J.-Z., Iwabuchi, N., Sakamoto, M., Takahashi, N., Kondo, S., Miyaji, K., Iwatsuki, K., Togashi, H., Enomoto, T., et al. (2007) · Journal of Medical Microbiology · doi:10.1099/jmm.0.47306-0 · Cited by 53
“Faecalibacterium prausnitzii Fprau223F GATGGCCTCGCGTCCGATTAG 199 58 Bartosch et al. (2004)”
MethodInfluential
Quantification of enterococci and bifidobacteria in Georgia estuaries using conventional and molecular methods
Morrison, C. R., Bachoon, D. S., & Gates, K. W. (2008) · Water Research · doi:10.1016/j.watres.2008.07.021 · Cited by 53
Acquisition, Evolution and Maintenance of the Normal Gut Microbiota
Macfarlane, G. T., & Macfarlane, L. E. (2009) · Digestive Diseases · doi:10.1159/000268127 · Cited by 57
“who found reduced species diversity in older people and lower numbers of beneficial organisms, such as bifidobacteria (table 3 ). The investigation also demonstrated functional differences in the microbiota, with older people having less amylolytic, and more proteolytic, profiles. Short-chain fatty acid production was…”
BackgroundSelf-citation
Protective effect of Lactobacillus reuteri KUB-AC5 against Salmonella Enteritidis challenge in chickens
Nakphaichit, M., Sobanbua, S., Siemuang, S., Vongsangnak, W., Nakayama, J., & Nitisinprasert, S. (2018) · Beneficial Microbes · doi:10.3920/bm2018.0034 · Cited by 53
Effect of Selenium Sources on Laying Performance, Egg Quality Characteristics, Intestinal Morphology, Microbial Population and Digesta Volatile Fatty Acids in Laying Hens
Muhammad, A. I., Mohamed, D. A., Loh, T. C., Akit, H., & Samsudin, A. A. (2021) · Animals · doi:10.3390/ani11061681 · Cited by 61
“F: GGGTGGTAATGCCGGATG 440 [66,68,69] R: TAAGCCATGGACTTTCACACC Enterococcus spp.”
Molecular point-of-care testing technologies: Current status and challenges
Zu, Y., Chang, H., & Cui, Z. (2025) · Nexus · doi:10.1016/j.ynexs.2025.100059 · Cited by 53
Effect of Lactobacillus rhamnosus hsryfm 1301 on the Gut Microbiota and Lipid Metabolism in Rats Fed a High-Fat Diet
Chen, D., Yang, Z., Chen, X., Huang, Y., Yin, B., Guo, F., Zhao, H., Huang, J., Yun, W., & Gu, R. (2015) · Journal of Microbiology and Biotechnology · doi:10.4014/jmb.1409.09085 · Cited by 52
Modulation of the Intestinal Microbiota Is Associated with Lower Plasma Cholesterol and Weight Gain in Hamsters Fed Chardonnay Grape Seed Flour
Kim, H., Kim, D., Seo, K., Chon, J., Nah, S.-Y., Bartley, G. E., Arvik, T. J., Lipson, R. S., & YOKOYAMA, W. H. (2015) · Journal of Agricultural and Food Chemistry · doi:10.1021/jf5026373 · Cited by 52
Prebiotics, synbiotics and inflammatory bowel disease
Steed, H., Macfarlane, G. T., & Macfarlane, S. (2008) · Molecular Nutrition & Food Research · doi:10.1002/mnfr.200700139 · Cited by 52
Self-citation
DNA of Helicobacter spp. and common gut bacteria in primary liver carcinoma
Al‐Soud, W. A., Stenram, U., Ljungh, Å., Tranberg, K. ‐., Nilsson, H., & Wadström, T. (2007) · Digestive and Liver Disease · doi:10.1016/j.dld.2007.09.011 · Cited by 52
Age-associated gut microbiota impairs hippocampus-dependent memory in a vagus-dependent manner
Rei, D., Saha, S., Haddad, M., Rubio, A. H., Perlaza, B. L., Berard, M., Ungeheuer, M., Sokol, H., & Lledo, P. (2022) · JCI Insight · doi:10.1172/jci.insight.147700 · Cited by 51
Does canine inflammatory bowel disease influence gut microbial profile and host metabolism?
Xu, J., Verbrugghe, A., Lourenço, M. R. A., Janssens, G. P. J., Liu, D. J. X., de Wiele, T. V., Eeckhaut, V., Immerseel, F. V., de Maele, I. V., Niu, Y., et al. (2016) · BMC Veterinary Research · doi:10.1186/s12917-016-0736-2 · Cited by 53
Dysbiosis and Alzheimer’s Disease: Cause or Treatment Opportunity?
Janeiro, M. H., Ramírez, M. J., & Solas, M. (2021) · Cellular and Molecular Neurobiology · doi:10.1007/s10571-020-01024-9 · Cited by 51
Liposomal encapsulated oregano, cinnamon, and clove oils enhanced the performance, bacterial metabolites antioxidant potential, and intestinal microbiota of broiler chickens
Meligy, A. M. A., El-Hamid, M. I. A., Yonis, A. E., Elhaddad, G. Y., Abdel-Raheem, S. M., El‐Ghareeb, W. R., Mohamed, M. H. A., Ismail, H. A.-M. A., & Ibrahim, D. (2023) · Poultry Science · doi:10.1016/j.psj.2023.102683 · Cited by 57
Differences in Developing Intestinal Microbiota between Allergic and Non-Allergic Infants: A Pilot Study in Japan
Songjinda, P., Nakayama, J., Tateyama, A., TANAKA, S., TSUBOUCHI, M., Kiyohara, C., Shirakawa, T., & Sonomoto, K. (2007) · Bioscience Biotechnology and Biochemistry · doi:10.1271/bbb.70154 · Cited by 50
Effects of Antibiotics on Bacterial Species Composition and Metabolic Activities in Chemostats Containing Defined Populations of Human Gut Microorganisms
Newton, D. F., Macfarlane, S., & Macfarlane, G. T. (2013) · Antimicrobial Agents and Chemotherapy · doi:10.1128/aac.00079-13 · Cited by 50
“Of particular interest are the effects of antimicrobial agents and the mechanisms whereby antibiotic-associated breakdown of the normal colonic microbiota can affect host health (14).”
BackgroundSelf-citation
Oligomannan Prebiotic Attenuates Immunological, Clinical and Behavioral Symptoms in Mouse Model of Inflammatory Bowel Disease
Ferenczi, S., Szegi, K., Winkler, Z., Barna, T., & Kovács, K. (2016) · Scientific Reports · doi:10.1038/srep34132 · Cited by 50
Healthy Gut, Healthy Brain: The Gut Microbiome in Neurodegenerative Disorders
Chandra, S., Alam, M. T., Dey, J., Sasidharan, B. C. P., Ray, U., Srivastava, A. K., Gandhi, S., & Tripathi, P. P. (2020) · Current Topics in Medicinal Chemistry · doi:10.2174/1568026620666200413091101 · Cited by 50
Influence of whole-wheat consumption on fecal microbial community structure of obese diabetic mice
García-Mazcorro, J. F., Ivanov, I. V., Mills, D. A., & Noratto, G. D. (2016) · PeerJ · doi:10.7717/peerj.1702 · Cited by 49
Monitoring horizontal antibiotic resistance gene transfer in a colonic fermentation model
Haug, M. C., Tanner, S. A., Lacroix, C., Stevens, M. J. A., & Meile, L. (2011) · FEMS Microbiology Ecology · doi:10.1111/j.1574-6941.2011.01149.x · Cited by 53
Enhanced vaccination effect against influenza by prebiotics in elderly patients receiving enteral nutrition
Akatsu, H., Nagafuchi, S., Kurihara, R., Okuda, K., Kanesaka, T., Ogawa, N., Kanematsu, T., Takasugi, S., Yamaji, T., Takami, M., et al. (2015) · Geriatrics and gerontology international/Geriatrics & gerontology international · doi:10.1111/ggi.12454 · Cited by 50
Changes in human gut flora with age: an Indian familial study
Marathe, N. P., Shetty, S. A., Lanjekar, V. B., Ranade, D. R., & Shouche, Y. S. (2012) · BMC Microbiology · doi:10.1186/1471-2180-12-222 · Cited by 51
Colon Cancer Prevention through Probiotics: An Overview
Korada, S. K. (2015) · Journal of Cancer Science & Therapy · doi:10.4172/1948-5956.1000329 · Cited by 50
“The modifications that occur among microflora are thought about the result of dietary and activity changes as a results of age [45,46].”
Background
Compartmentalized PGRP expression along the dipteran Bactrocera dorsalis gut forms a zone of protection for symbiotic bacteria
Yao, Z., Cai, Z., Ma, Q., Bai, S., Wang, Y., Zhang, P., Guo, Q., Gu, J., Lemaître, B., & Zhang, H. (2022) · Cell Reports · doi:10.1016/j.celrep.2022.111523 · Cited by 49
Modulation of intestinal microbiota in mice by kefir administration
Kim, D.-H., Chon, J.-W., Kim, H., & Seo, K.-H. (2015) · Food Science and Biotechnology · doi:10.1007/s10068-015-0179-8 · Cited by 48
Antihyperglycemic effect of rice husk derived xylooligosaccharides in high‐fat diet and low‐dose streptozotocin‐induced type 2 diabetic rat model
Khat‐udomkiri, N., Toejing, P., Sirilun, S., Chaiyasut, C., & Lailerd, N. (2019) · Food Science & Nutrition · doi:10.1002/fsn3.1327 · Cited by 48
Effects of Tributyrin Supplementation on Growth Performance, Insulin, Blood Metabolites and Gut Microbiota in Weaned Piglets
Sotira, S., Dell’Anno, M., Caprarulo, V., Hejna, M., Pirrone, F., Callegari, M. L., Tucci, T. V., & Rossi, L. (2020) · Animals · doi:10.3390/ani10040726 · Cited by 48
Multi-Strain-Probiotic-Loaded Nanoparticles Reduced Colon Inflammation and Orchestrated the Expressions of Tight Junction, NLRP3 Inflammasome and Caspase-1 Genes in DSS-Induced Colitis Model
Al-Kushi, A. G., Elazab, S. T., Abdelfattah‐Hassan, A., Mahfouz, H., Salem, G. A., Sheraiba, N. I., Mohamed, E., Attia, M. S., El‐Shetry, E. S., Saleh, A. A., et al. (2022) · Pharmaceutics · doi:10.3390/pharmaceutics14061183 · Cited by 47
“Enterobacteriaceae F-CATTGACGTTACCCGCAGAAGAAGC R-CTCTACGAGACTCAAGCTTGC Bartosch, Fite, Macfarlane and McMurdo [25]”
Background
Microbiome diversity of A phis glycines with extensive superinfection in native and invasive populations
Bansal, R., Mian, M. A. R., & Michel, A. P. (2013) · Environmental Microbiology Reports · doi:10.1111/1758-2229.12108 · Cited by 47
The effects of pure nucleotides on performance, humoral immunity, gut structure and numbers of intestinal bacteria of newly weaned pigs1
Sauer, N., Eklund, M., Bauer, E., Gänzle, M. G., Field, C. J., Zijlstra, R. T., & Mosenthin, R. (2012) · Journal of Animal Science · doi:10.2527/jas.2011-4417 · Cited by 47
Fortification of dried distillers grains plus solubles with grape seed meal in the diet modulates methane mitigation and rumen microbiota in Rusitec
Khiaosa‐ard, R., Metzler-Zebeli, B. U., Ahmed, S., Muro‐Reyes, A., Deckardt, K., Chizzola, R., Böhm, J., & Zebeli, Q. (2015) · Journal of Dairy Science · doi:10.3168/jds.2014-8751 · Cited by 47
Critical Evaluation of Diagnosing Bacterial Overgrowth in the Proximal Small Intestine
Kerckhoffs, A. P. M., Visser, M. R., Samsom, M., van der Rest, M. E., de Vogel, J., Amerongen, W. C. M. H.-V., & Akkermans, L. M. A. (2008) · Journal of Clinical Gastroenterology · doi:10.1097/mcg.0b013e31818474d7 · Cited by 48
“Primers used were previously described by Malinen et al and Bartosch et al.16,17”
Method
The Presystemic Interplay between Gut Microbiota and Orally Administered Calycosin-7-O-β-d-Glucoside
Ruan, J., Li, S., Li, Y., Wu, W., Lee, S. M., & Yan, R. (2015) · Drug Metabolism and Disposition · doi:10.1124/dmd.115.065094 · Cited by 47
Bifidogenic effect of whole-grain wheat during a 12-week energy-restricted dietary intervention in postmenopausal women
Christensen, E. G., Licht, T. R., Kristensen, M., & Bahl, M. I. (2013) · European Journal of Clinical Nutrition · doi:10.1038/ejcn.2013.207 · Cited by 44
Enterohemorrhagic Escherichia coli O157:H7 Survival in an In Vitro Model of the Human Large Intestine and Interactions with Probiotic Yeasts and Resident Microbiota
Thévenot, J., Etienne‐Mesmin, L., Denis, S., Chalançon, S., Alric, M., Livrelli, V., & Blanquet‐Diot, S. (2012) · Applied and Environmental Microbiology · doi:10.1128/aem.03303-12 · Cited by 48
Impacts of supplementing chemical fertilizers with organic fertilizers manufactured using pig manure as a substrate on the spread of tetracycline resistance genes in soil
Kang, Y., Hao, Y., Shen, M., Qingxin, Z., Li, Q., & Hu, J. (2016) · Ecotoxicology and Environmental Safety · doi:10.1016/j.ecoenv.2016.04.028 · Cited by 48
Dietary sugarcane bagasse and coarse particle size of corn are beneficial to performance and gizzard development in broilers fed normal and high sodium diets
Kheravii, S. K., Swick, R. A., Choct, M., & Wu, S. (2017) · Poultry Science · doi:10.3382/ps/pex225 · Cited by 47
Counting the Countless: Bacterial Quantification by Targeting rRNA Molecules to Explore the Human Gut Microbiota in Health and Disease
Tsuji, H., Matsuda, K., & Nomoto, K. (2018) · Frontiers in Microbiology · doi:10.3389/fmicb.2018.01417 · Cited by 48
“Also, as reported in previous studies (Hayashi et al., 2003; Bartosch et al., 2004; Woodmansey et al., 2004; Mitsuoka, 2005; Mueller et al., 2006; Tiihonen et al., 2008; Enck et al., 2009; Mariat et al., 2009), in elderly people the levels of Bifidobacterium are decreased, whereas those of Lactobacillus and Enterobact…”
Result

Authors: Bartosch, S., Fite, A., Macfarlane, G. T., & McMurdo, M. E. T.
Affiliations: University of Dundee (GB)
MRC Microbiology and Gut Biology Group
Venue: Applied and Environmental Microbiology
Publisher: American Society for Microbiology
Published: 2004-06
Volume: 70
Issue: 6
Pages: 3575-3581
ISSN: 0099-2240 (ISSN-L)
1098-5336
DOI: 10.1128/aem.70.6.3575-3581.2004
PMC: PMC427772
OpenAlex: W2109744701
Cited by: 762
References: 51
Citations by year: 2026: 15 · 2025: 29 · 2024: 12 · 2023: 31 · 2022: 36 · 2021: 51 · 2020: 49 · 2019: 36 · 2018: 38 · 2017: 63 · 2016: 59 · 2015: 65 · 2014: 44 · 2013: 46 · 2012: 46
FWCI: 4.63
Type: journal article
Language: en
Open access: green
europepmc.org
Licence: journals.asm.org/non-commercial-tdm-license (tdm)
Locations: Applied and Environmental Microbiology (publishedVersion)
Europe PMC (PubMed Central) (publishedVersion)
PubMed Central (publishedVersion)
PubMed (publishedVersion)
Discovery Research Portal (University of Dundee) (submittedVersion)
Funders: Medical Research Council
Topics: Life Sciences › Biochemistry, Genetics and Molecular Biology › Molecular Biology › Gut microbiota and health
Health Sciences › Medicine › Infectious Diseases › Clostridium difficile and Clostridium perfringens research
Physical Sciences › Environmental Science › Ecology › Microbial Community Ecology and Physiology
Keywords: fecal microbiota, older adults, hospitalized patients, antibiotic therapy, Bifidobacterium, Desulfovibrio, Faecalibacterium prausnitzii, 16S rRNA gene quantification, Enterobacteriaceae, Enterococcus faecalis, intestinal bacteria, community-acquired infections
MeSH terms: Aged, Aged, 80 and over, Anti-Bacterial Agents, Bacteria, Bacterial Infections, DNA, Bacterial, DNA, Ribosomal, Feces, Hospitalization, Humans, RNA, Ribosomal, 16S, Species Specificity, Polymerase Chain Reaction, Ecosystem, DNA Primers, Gene Dosage, Genes, rRNA

About these checks

Registry, retraction, Cites and statistics results are computed, not judged, with one exception: a printed reference that no index lists is read once by a model before it counts as a citation error. Claims are extracted by a model and kept only when their quote appears verbatim in the text; each cited source is then checked, with a model’s help, for whether it says what the claim relies on. Those verdicts can be wrong — read the claim’s quote and the cited source before relying on one.

Statistics and arithmetic are recomputed, not judged.

Confidence bands are shown only for fields calibrated on our annotated test set. None is calibrated yet, so no band is shown.

What counts as a claim ›How we measure confidence ›How we check this ›

Are you an author, or do you see a problem with this page? Request a review

Characterization of Bacterial Communities in Feces from Healthy Elderly Volunteers and Hospitalized Elderly Patients by Using Real-Time PCR and Effects of Antibiotic Treatment on the Fecal Microbiota

Abstract

Overview

Integrity signals

Verification

Claims the paper makes

Claims other papers make about this one

Self-check

Citations

Cites

Cited by

Related

Metadata

Record

About these checks