Cited by 762Gut microbiota and healthClostridium difficile and Clostridium perfringens researchMicrobial Community Ecology and Physiology

The DOI matches its Crossref record; 51 of the 51 references it cites were found in a registry or an index.

Characterization of Bacterial Communities in Feces from Healthy Elderly Volunteers and Hospitalized Elderly Patients by Using Real-Time PCR and Effects of Antibiotic Treatment on the Fecal Microbiota

Open access

Bartosch, Sabine, Fite, Alemu, Macfarlane, George T., McMurdo, Marion E. T.·2004·Applied and Environmental Microbiology

DOI 10.1128/aem.70.6.3575-3581.2004PMC PMC427772

Open this paper in CoChat — free account

Abstract

Fecal bacteria were studied in healthy elderly volunteers (age, 63 to 90 years;n= 35) living in the local community, elderly hospitalized patients (age, 66 to 103;n= 38), and elderly hospitalized patients receiving antibiotic treatment (age, 65 to 100;n= 21). Group- and species-specific primer sets targeting 16S rRNA genes were used to quantitate intestinal bacteria by using DNA extracted from feces and real-time PCR. The principal difference between healthy elderly volunteers and both patient cohorts was a marked reduction in the Bacteroides-Prevotella group following hospitalization. Reductions in bifidobacteria,Desulfovibrio spp.,Clostridium clostridiiforme, and Faecalibacterium prausnitzii were also found in the hospitalized patients. However, total 16S rRNA gene copy numbers (per gram of wet weight of feces) were generally lower in the stool samples of the two groups of hospitalized patients compared to the number in the stool samples of elderly volunteers living in the community, so the relative abundance (percentage of the group- and species-specific rRNA gene copies in relation to total bacterial rRNA gene copies) of bifidobacteria,Desulfovibrio spp.,C. clostridiiforme, and F. prausnitzii did not change. Antibiotic treatment resulted in further reductions in the numbers of bacteria and their prevalence and, in some patients, complete elimination of certain bacterial communities. Conversely, the numbers of enterobacteria increased in the hospitalized patients who did not receive antibiotics, and due to profound changes in fecal microbiotas during antibiotic treatment, the opportunistic species Enterococcus faecalis proliferated.

The claims and statistics of this paper haven’t been checked yet.

Run the check — free, no account needed. It reads the open-access text and checks the sources it cites.

Integrity signals

Registry

Crossref · 10.1128/aem.70.6.3575-3581.2004

Cites

51 of 51 references verified0 citation errors · 0 not checkable

Statistics

Claims the paper makes

The claims and statistics of this paper haven’t been checked yet.

Run the check — free, no account needed. It reads the open-access text and checks the sources it cites.

Claims other papers make about this one

Each is checked against this paper’s own text: does it say what the citing paper says it does?

Self-check

Percentages, sums and reported differences re-computed from the paper’s own numbers.

The self-check needs the paper’s full text.

Bergey's Manual of Systematic Bacteriology
(1990) · Annals of Internal Medicine · doi:10.7326/0003-4819-112-5-391_3 · Cited by 15,633
Determination of bacterial load by real-time PCR using a broad-range (universal) probe and primers set
Nadkarni, M. A., Martin, F. E., Jacques, N. A., & Hunter, N. (2002) · Microbiology · doi:10.1099/00221287-148-1-257 · Cited by 1,931
Direct analysis of genes encoding 16S rRNA from complex communities reveals many novel molecular species within the human gut
Suau, A., Bonnet, R., Sutren, M., Godon, J.-J., Gibson, G. R., Collins, M. D., & Doré, J. (1999) · Applied and Environmental Microbiology · doi:10.1128/aem.65.11.4799-4807.1999 · Cited by 1,490
The Ribosomal Database Project (RDP-II): previewing a new autoaligner that allows regular updates and the new prokaryotic taxonomy
Cole, J. R. (2003) · Nucleic Acids Research · doi:10.1093/nar/gkg039 · Cited by 1,435
Temperature Gradient Gel Electrophoresis Analysis of 16S rRNA from Human Fecal Samples Reveals Stable and Host-Specific Communities of Active Bacteria
Zoetendal, E. G., Akkermans, A. D. L., & de Vos, W. M. (1998) · Applied and Environmental Microbiology · doi:10.1128/aem.64.10.3854-3859.1998 · Cited by 1,360
rrndb: the Ribosomal RNA Operon Copy Number Database
Klappenbach, J., Saxman, P., Cole, J., & Schmidt, T. M. (2001) · Nucleic Acids Res. · doi:10.1093/nar/29.1.181 · Cited by 1,140
Quantitative fluorescence in situ hybridization of Bifidobacterium spp. with genus-specific 16S rRNA-targeted probes and its application in fecal samples
Langendijk-Genevaux, P. S., Schut, F., Jansen, G. J., Raangs, G. C., Kamphuis, G. R., Wilkinson, M. H. F., & Welling, G. W. (1995) · Applied and Environmental Microbiology · doi:10.1128/aem.61.8.3069-3075.1995 · Cited by 974
Effect of antimicrobial agents on the ecological balance of human microflora
Sullivan, Å., Edlund, C., & Nord, C. E. (2001) · The Lancet Infectious Diseases · doi:10.1016/s1473-3099(01)00066-4 · Cited by 816
Growth requirements and fermentation products of Fusobacterium prausnitzii, and a proposal to reclassify it as Faecalibacterium prausnitzii gen. nov., comb. nov
Duncan, S. H., Hold, G. L., Harmsen, H. J. M., Stewart, C. S., & Flint, H. J. (2002) · INTERNATIONAL JOURNAL OF SYSTEMATIC AND EVOLUTIONARY MICROBIOLOGY · doi:10.1099/00207713-52-6-2141 · Cited by 753
Development of 16S rRNA-Gene-Targeted Group-Specific Primers for the Detection and Identification of Predominant Bacteria in Human Feces
Matsuki, T., Watanabe, K., Fujimoto, J., Miyamoto, Y., Takada, T., Matsumoto, K., Oyaizu, H., & Tanaka, R. (2002) · Applied and Environmental Microbiology · doi:10.1128/aem.68.11.5445-5451.2002 · Cited by 663

Flagged first, then by citations

Show all 51 references

Research works printed but not linked: 2

10.1111/j.1574-6968.1991.tb04588.x · DOI
Mitsuoka, T., K. Hayakawa, and N. Kimura. 1974. Die Faekalflora bei Menschen II. Mitteilung: Die Zusammensetzung der Bifidobakterienflora der verschiedenen Altersgruppen. Zentbl. Bakteriol. Hyg. Abt. 1 Orig. A226:469-478.

Sorted by citations

Items 601–700 of 761

Milk oligosaccharide-mediated cross-feeding between Enterococcus gallinarum and lactobacilli in the gut microbiota of infant rats
Matsui, S., AKAZAWA, H., TSUJIKAWA, Y., Fukuda, I., SUZUKI, Y., Yamamoto, Y., Mukai, T., Shirai, Y., & Osawa, R. (2021) · Bioscience of Microbiota Food and Health · doi:10.12938/bmfh.2021-036 · Cited by 4
“gallinarum [14] R: TGAATTCTTCTTTGAAATCAG JCM 8728T Enterobacteriaceae F: CATTGACGTTACCCGCAGAAGAAGC 195 Escherichia coli [15] R: CTCTACGAGACTCAAGCTTGC ATCC 43888 All eubacteria F: ACTCCTACGGGAGGCAGCAGT 200 Escherichia coli [16] R: GTATTACCGCGGCTGCTGGCAC ATCC 43888”
Background
Investigation of supplementation with a combination of fermented bean dregs and wheat bran for improving the growth performance of the sow
Liu, J., Wang, K., Zhao, L., Li, Y., Li, Z., & Li, C. (2023) · Journal of Animal Science and Technology · doi:10.5187/jast.2023.e13 · Cited by 4
Amino acid digestibility of insect meals and effects on key bacterial groups in excreta of caecectomised laying hens
Kaewtapee, C., Wolfgang, S., Bunchasak, C., & Chungopast, S. (2023) · Archives of Animal Nutrition · doi:10.1080/1745039x.2023.2219178 · Cited by 4
Changes in Neonatal Microbiota Distribution Influenced by the Environment of the Neonatal Intensive Care Unit in the First Month of Life
Ohoka, M., & Ito, T. (2016) · Journal of Neonatal Biology · doi:10.4172/2167-0897.1000222 · Cited by 4
“Enterobacteriaceae Escherichia coli (JCM 1649T=ATCC 11775) Eco1457F CATTGACGTTACCCGCAGAAGAAGC 195 58 [12] Eco1652R CTCTACGAGACTCAAGCTTGC”
Method
Long-Term Implications of Antibiotic Use on Gut Health and Microbiota in Populations Including Patients With Cystic Fibrosis
Deane, J., Rea, M. C., Fouhy, F., Stanton, C., Ross, R. P., & Plant, B. J. (2016) · Elsevier eBooks · doi:10.1016/b978-0-12-802304-4.00011-6 · Cited by 6
“, 2008) and a decrease in Bifidobacteria, Clostridia, Desulfovibrio, Faecalibacterium and Bacteroides species (Adamsson et al., 1999; Bartosch et al., 2004; Jernberg et al., 2007; O’Sullivan et al., 2013) is expected.”
Quantitative real-time PCR analysis of the caecal bacteria population of broiler chickens fed with corn-soy diet containing 20% of palm kernel meal with or without enzyme supplementation.
Sharmila, A., Askar, K. A., Noor, H. M., Jahromi, M. F., & Samsudin, A. A. (2015) · Universiti Putra Malaysia Institutional Repository (Universiti Putra Malaysia) · Cited by 4
Evaluation the effect of subchronic feeding of transgenic cotton line (CKC1) on the faecal microbiota of albino rabbits
Salisu, I. B., Shahıd, A. A., Yaqoob, A., Gul, A., & Rao, A. Q. (2020) · Journal of Animal Physiology and Animal Nutrition · doi:10.1111/jpn.13471 · Cited by 4
The effect of maize silage as co-substrate for swine manure on the bacterial community structure in biogas plants
Fliegerova, K. O., Mrázek, J., Kajan, M., Podmirseg, S. M., & Insam, H. (2012) · Folia Microbiologica · doi:10.1007/s12223-012-0125-6 · Cited by 4
“The temperature program was used according to Bartosch et al. (2004).”
Method
Ruminal bacterial community changes during adaptation of goats to fresh alfalfa forage
Grilli, D., Mrázek, J., Fliegerova, K. O., Kopečný, J., Lama, S. P., Cerón‐Cucchi, M. E., Sosa, M. A., & Arenas, G. N. (2016) · Livestock Science · doi:10.1016/j.livsci.2016.08.001 · Cited by 4
Influence of whole-wheat consumption on fecal microbial ecology of obese diabetic micePreprint
García-Mazcorro, J. F., Ivanov, I. V., Mills, D. A., & Noratto, G. D. (2015) · doi:10.7287/peerj.preprints.1458v1 · Cited by 4
Emergence of antibiotic resistance in gut microbiota and its effect on human health
Kumar, M., Sharma, A., Verma, A., & Shrivastava, R. (2022) · Elsevier eBooks · doi:10.1016/b978-0-323-91313-3.00002-7 · Cited by 3
Wood vinegar as a natural alternative to antibiotics: Effects on cecal microbiota, antioxidant status, and nutrient digestibility in broiler chickens
Emmanuel, S. S., Loh, T. C., Foo, H. L., Akit, H., Aziz, M. F. A., & Chung, E. L. T. (2025) · Veterinary World · doi:10.14202/vetworld.2025.1911-1921 · Cited by 3
Impact of a defined bacterial community including and excluding Megamonas hypermegale on broiler cecal microbiota and resistance to Salmonella infection
Marcolla, C. S., Ju, T., Ten, K., Sharma, U. S., Moeun, L., & Willing, B. P. (2025) · Applied and Environmental Microbiology · doi:10.1128/aem.00948-25 · Cited by 3
A probiotic Brevibacillus laterosporus promotes chicken growth performance immunity and gut health
Lei, F., Cao, Y., Yang, Y., Yin, N., Zhang, M., Zeng, Y., Zhang, D., Ni, X., Pan, K., & Yang, J. (2025) · Scientific Reports · doi:10.1038/s41598-025-29309-3 · Cited by 3
Effects of Administration of Prebiotics Alone or in Combination with Probiotics on In Vitro Fermentation Kinetics, Malodor Compound Emission and Microbial Community Structure in Swine
Lee, M.-R., Choi, Y., Bayo, J., Bugenyi, A. W., Kim, Y., & Heo, J.-Y. (2023) · Fermentation · doi:10.3390/fermentation9080716 · Cited by 3
“Bacteroides Bac303 F GAAGGTCCCCCACATTG 103 60 [30]”
Development of a Chicken Gastrointestinal Tract (GIT) Simulation Model: Impact of Cecal Inoculum Storage Preservation Conditions
de Carvalho, N. M., Costa, C. M., Castro, C., Saleh, M. A. D., Pintado, M., Oliveira, D., & Madureira, A. R. (2023) · Applied Microbiology · doi:10.3390/applmicrobiol3030066 · Cited by 3
Dietary Replacement with Food Waste and Black Soldier Fly Larvae Supplementation Improved Growth Performance, Nutrient Digestibility and Intestinal Microbial Population in Broilers
Al-Qazzaz, M. F. A., Samsudin, A. A., Idris, L. H., Ismail, D., & Akit, H. (2020) · International Journal of Agriculture and Biology · doi:10.17957/ijab/15.1780 · Cited by 3
Trends in the plant-based anti-aging diet in different continents of the world
Banjerdpongchai, R., Suttajit, M., & Ratanavalachai, T. (2022) · Elsevier eBooks · doi:10.1016/b978-0-323-90581-7.00014-1 · Cited by 3
Molecular Tools for Investigating the Gut Microbiota
Lay, C. (2009) · Springer eBooks · doi:10.1007/978-0-387-79058-9_2 · Cited by 3
Metabonomics and Gut Microbial Paradigm in Healthy Aging
Biagi, E., Candela, M., Martin, F., Collino, S., Franceschi, C., & Brigidi, P. (2014) · Molecular and integrative toxicology · doi:10.1007/978-1-4471-6539-2_9 · Cited by 3
The changes of gut microbiota associated with age and lifestyle
Egshatyan, L. V., Tkacheva, O. N., Кафарская, Л. И., Shkoporov, A. N., & Tyakht, A. (2015) · Obesity and metabolism · doi:10.14341/omet201523-9 · Cited by 3
The Elderly Intestinal Microbiota: Opportunities for Probiotics
Forssten, S., & Ibrahim, F. (2011) · Journal of Microbial & Biochemical Technology · doi:10.4172/1948-5948.s1-002 · Cited by 3
Connection Between Fiber, Colonic Microbiota, and Health Across the Human Life Cycle
Dreher, M. L. (2017) · Springer eBooks · doi:10.1007/978-3-319-50557-2_4 · Cited by 3
Gut Microbiome in the Elderly Hospitalized Patient
Ticinesi, A., Milani, C., Lauretani, F., Nouvenne, A., Tana, C., Ventura, M., & Meschi, T. (2019) · Elsevier eBooks · doi:10.1016/b978-0-12-815249-2.00030-0 · Cited by 3
Microbiota: Current Research and Emerging Trends
Salazar, N., González Solares, S., Nogacka, A., Rios-Covián, D., Arboleya, S., Fernández, M. G., & González de los Reyes-Gavilán, C. (2018) · Caister Academic Press eBooks · doi:10.21775/9781910190937 · Cited by 3
Molecular Ecology of the Human Intestinal Microbiota
Amor, K. B. (2006) · CRC Press eBooks · doi:10.3109/9781420014952-2 · Cited by 3
Monovalent Copper Oxide in Broiler Nutrition: Effects on Performance, Intestinal Lesions, and Oocyst Shedding During Mild Eimeria Challenge
Akter, N., Dao, H. T., Kumar, A., Cadogan, D., Crowley, T. M., & Moss, A. F. (2025) · Veterinary Sciences · doi:10.3390/vetsci12050494 · Cited by 2
EFFECTS OF CLOSTRIDIUM BUTYRICUM SUPPLEMENTATION ON FECAL MICROBIOTA AND METABOLITES IN CAPTIVE RED KANGAROO (MACROPUS RUFUS)
Yoshimoto, Y., Ichinohe, N., Liu, H., Nagata, N., Inoüe, R., Yamamoto, Y., & Nagaoka, K. (2025) · Journal of Zoo and Wildlife Medicine · doi:10.1638/2024-0079 · Cited by 2
Faecal pharmacokinetics, microbiome, and bile acid changes in healthy subjects given intravenous followed by oral omadacycline; a Phase 1 clinical trial
Jo, J., Carlson, T. J., Hu, C., Williamson, J., Belin, Y. T., Horvath, T. D., Haidacher, S. J., Bassères, E., Begum, K., Alam, M. J., et al. (2025) · Journal of Antimicrobial Chemotherapy · doi:10.1093/jac/dkaf278 · Cited by 3
Nutritional strategies to mitigate sub-clinical coccidiosis in Eimeria-challenged broilers
Akter, N., Dao, H. T., Jahan, A. A., Kumar, A., Bedford, M. R., Crowley, T. M., & Moss, A. F. (2026) · Poultry Science · doi:10.1016/j.psj.2026.106586 · Cited by 3
Intestinal Microbiology and Ecology in Crohn’s Disease and Ulcerative Colitis
Buttó, L. F., & Haller, D. (2017) · Springer eBooks · doi:10.1007/978-3-319-33703-6_4 · Cited by 2
Molecular Characterization of Gut Microbiota in Obese and Lean Hypertensive Patients
Mushtaq, N., Hussain, S., & Xu, J. (2018) · Journal of Bacteriology & Parasitology · Cited by 2
Comparison of Overfeeding Influence on Slaughter Performance, Small Intestinal Physiology and Microbiota between Gang Goose and Tianfu Meat Goose
Wei, R., Ye, F., He, F., Song, Q., Xiong, X., Wenlan, Y., Xu, H., Li, L., Liu, H., Zeng, X., et al. (2020) · Journal of World s Poultry Research · doi:10.36380/jwpr.2020.40 · Cited by 2
Pantoprazole promotes sustained intestinal carriage of multidrug-resistant Escherichia coli in amoxicillin-treated mice
Moaligou, C., Dion, M., Ishnaiwer, M. M., Dailly, É., Batard, É., & Javaudin, F. (2023) · Journal of Applied Microbiology · doi:10.1093/jambio/lxad223 · Cited by 2
Gut Microbiota in a Viral Model of Multiple Sclerosis: Modulation and Pitfalls by Oral Antibiotic Treatment
Ahmad, I., Omura, S., Khadka, S., Sato, F., Park, A.-M., Rimal, S., & Tsunoda, I. (2025) · Cells · doi:10.3390/cells14120871 · Cited by 4
Intramuscular injection of tetracycline decreased gut microbial diversity in mouse
Liu, J., Deng, X., Li, X., Yang, Z.-B., Zhang, G., & Chen, T. (2020) · Mammalian Genome · doi:10.1007/s00335-020-09852-2 · Cited by 2
EDIBLE FRUITS EXTRACTS AFFECT INTESTINAL MICROBIOTA ISOLATED FROM PATIENTS WITH NONCOMMUNICABLE DISEASES ASSOCIATED WITH CHRONIC INFLAMMATION
Meleshko, T. (2020) · Biotechnologia Acta · doi:10.15407/biotech13.05.087 · Cited by 2
Micronized fibres affect in vitro fermentation under normal buffered and osmotic stress conditions using porcine inocula
Aumiller, T., Mosenthin, R., Rink, F., Hartung, K., & Weiss, E. (2015) · Journal of Animal Physiology and Animal Nutrition · doi:10.1111/jpn.12288 · Cited by 2
Indigenous Microbiota and Association with the Host
Thomas, J. G., & Percival, S. L. (2008) · Humana Press eBooks · doi:10.1007/978-1-59745-327-1_2 · Cited by 2
Nutritional Status and Gastrointestinal Health in the Elderly
Valentini, L., Kahl, A., & Lindenau, A.-C. (2016) · Elsevier eBooks · doi:10.1016/b978-0-12-801816-3.00027-3 · Cited by 2
Prebiotics and Probiotics in Aging Population
Magrone, T., & Jirillo, E. (2016) · Elsevier eBooks · doi:10.1016/b978-0-12-801816-3.00049-2 · Cited by 3
Gender Based Compositional Fluctuations in Gut Microbiota in Hypertension
Mushtaq, N., Hussain, S., Yuan, L., Zhang, S., Li, H., Ullah, S., & Xu, J. (2018) · Cardiovascular Pharmacology Open Access · doi:10.4172/2329-6607.1000248 · Cited by 2
Impact of a Synbiotic Food on the Gut Microbial Ecology and Metabolic Profiles
Vitali, B., Ndagijimana, M., Cruciani, F., Carnevali, P., Candela, M., Guerzoni, M. E., & Brigidi, P. (2014) · Apple Academic Press eBooks · doi:10.1201/b17254-14 · Cited by 2
Histo-Blood Group Antigen-Producing Bacterial Cocktail Reduces Rotavirus A, B, and C Infection and Disease in Gnotobiotic Piglets
Raev, S. A., Kick, M. K., Chellis, M., Amimo, J. O., Saif, L. J., & Vlasova, A. N. (2024) · Viruses · doi:10.3390/v16050660 · Cited by 2
Neurobiology of Sleep and Microbiomics in Aging
Larson‐Prior, L. J., Azhar, G., Davila, D., Jun, S., Kemp, A. S., Nookaew, I., Wei, J. Y., & Wassenaar, T. M. (2017) · OBM Neurobiology · doi:10.21926/obm.neurobiol.1702003 · Cited by 2
Gut Microbiota and Healthy Aging
Siegwald, L., & Brüssow, H. (2019) · Elsevier eBooks · doi:10.1016/b978-0-12-801238-3.62168-2 · Cited by 2
Are Sepsis Outcomes Predetermined? How the Road toward Sepsis May Predict Outcomes
Goodwin, A. J., IV (2018) · Annals of the American Thoracic Society · doi:10.1513/annalsats.201809-643ed · Cited by 2
Modulating the human intestinal microbiome in healthy adults and elderly through dietary supplements
An, R. (2020) · doi:10.18174/531631 · Cited by 2
WITHDRAWN: Vinpocetine and Lactobacillus improve fatty liver in rats via modulating the oxidative stress, inflammation, adiponectin and gut microbiome
Shaaban, A. A., Khalaf, E. M., Hazem, S. H., Shaker, M. E., Shata, A., Nouh, N. A. T., Jamil, L., Hafez, M. M., & El-Baz, A. M. (2023) · Life Sciences · doi:10.1016/j.lfs.2023.121931 · Cited by 2
Retracted
Species-level quantification of Faecalibacterium spp. in faeces of healthy Japanese adults
Hirasaki, M., Kadowaki, R., Ang, A., Harata, G., Miyazawa, K., Maeno, S., Gueimonde, M., & Endo, A. (2025) · Journal of Medical Microbiology · doi:10.1099/jmm.0.002019 · Cited by 1
“4.4.2).”
Influential
Emerging Roles of the Gut Microbiome in Musculoskeletal Injury and Repair
Roberts, J. L., & Park, C. (2025) · Microorganisms · doi:10.3390/microorganisms13092193 · Cited by 1
Engineering lactococci to reduce human lactose intolerance; biotechnology and risk/benefit assessment toward the gut microbiota of lactose-intolerants
Casciano, F., Nissen, L., Gianotti, A., & Yebra, M. J. (2026) · Food Research International · doi:10.1016/j.foodres.2026.118579 · Cited by 1
Antibiofilm Potential and Mechanisms of Lacticaseibacillus paracasei L475 Against Multidrug-Resistant Escherichia coli Isolated from Older Adults
Zhang, B., Guo, S., Li, M., Niu, Y., Liu, Y., Wu, N., Zhu, H., & Cui, Y. (2026) · Microorganisms · doi:10.3390/microorganisms14040888 · Cited by 1
“Previous reports of a higher relative abundance of E. coli and Enterobacteriaceae in frail [30] and hospitalized [31] older patients provide a relevant precedent, particularly given the established role of immune dysfunction in frailty [32].”
Alterations in the intestinal microbiota of subjects diagnosed with irritable bowel syndrome
Kassinen, A. (2009) · Cited by 1
Discrepancies in porcine microbiota composition between in vivo measurements and in vitro fermentation with the modified Hohenheim Gas Test
Weiss, E., Rist, V. T. S., Rink, F., & Mosenthin, R. (2015) · Livestock Science · doi:10.1016/j.livsci.2015.03.009 · Cited by 1
Bacteria A Benefit Cell
Al-Judaibi, A. A. (2017) · Biomedical Journal of Scientific & Technical Research · doi:10.26717/bjstr.2017.01.000427 · Cited by 1
“One of the most important factors is using the antibiotics; several studies investigate and determine the frequency and change of intestinal microbiota after a course of antibiotic treatment [19-21].”
Background
Focus on gut microbiota in age-associated body changes
Agafonova, E. V. (2021) · Medical alphabet · doi:10.33667/2078-5631-2021-9-44-51 · Cited by 1
Gut Microbiota in Elderly’s Health
Bäuerl, C., Selma‐Royo, M., Mera-Balseca, A. G., Collado, M. C., & Pérez‐Martínez, G. (2019) · Springer eBooks · doi:10.1007/978-3-319-99375-1_163 · Cited by 1
From Ptolemaus to Copernicus: The Evolving System of Gluten-Related Disorder
Catassi, C., & Fasano, A. (2018) · MDPI eBooks · doi:10.3390/books978-3-03842-732-2 · Cited by 1
Effects of Zinc Supplementation in the Elderly with Focus on Muscle Mass, Dry Skin, and Gut Microbiota
Nakagawa, N., Enokiya, T., Tochitani, S., Nakahigashi, M., Nishida, K., Ooi, K., Kawanishi, S., & Toyoda, N. (2023) · BPB Reports · doi:10.1248/bpbreports.6.6_217 · Cited by 1
The Microbiome in Aging
Neto, M. C., & O’Toole, P. W. (2016) · Elsevier eBooks · doi:10.1016/b978-0-12-802304-4.00010-4 · Cited by 1
Alterungsprozess im Orogastrointestinaltrakt: Auswirkungen auf Ernährungszustand
Valentini, L., & Ramminger, S. (2017) · Aktuelle Ernährungsmedizin · doi:10.1055/s-0043-119147 · Cited by 1
Gut Microbiota in Elderly’s Health
Bäuerl, C., Selma‐Royo, M., Mera-Balseca, A. G., Collado, M. C., & Pérez‐Martínez, G. (2017) · Springer eBooks · doi:10.1007/978-3-319-64597-1_163-1 · Cited by 1
Fiber-Rich Dietary Patterns and Colonic Microbiota in Aging and Disease
Dreher, M. L. (2018) · Springer eBooks · doi:10.1007/978-3-319-59180-3_4 · Cited by 1
Effects of an Enteral Formula Containing Fermented Dairy Products on Epithelial Ion Transport in Rat Intestines
Karaki, S.-I. (2019) · Journal of Nutritional Science and Vitaminology · doi:10.3177/jnsv.65.498 · Cited by 1
Early nutrition affects intestinal development and immune response in the neonatal piglet
Radlowski, E. C. (2012) · Illinois Digital Environment for Access to Learning and Scholarship (University of Illinois at Urbana-Champaign) · Cited by 1
Interplay between gut microbiota and antibiotics
Gonzalez, T. D. J. B. (2016) · doi:10.18174/394954 · Cited by 1
The role of nucleotides in the nutrition of newly weaned pigs
Waititu, S. M. (2016) · Mspace (University of Manitoba) · Cited by 1
The Efficacy of Probiotics in Modulating Clostridium difficile Spore Germination, Growth and Toxin Production in an in vitro Human Gut Model
Etifa, P. (2021) · University of Hertfordshire Research Archive (University of Hertfordshire) · doi:10.18745/th.23919 · Cited by 1
Characterization of the intestinal microbiome and lactobacilli community: influence of dietary and environmental factors
Chen, L. (2012) · Illinois Digital Environment for Access to Learning and Scholarship (University of Illinois at Urbana-Champaign)
Ampicillin-resistant Enterococcus faecium : ecology, transmission dynamics and intervention strategies
de Regt, M. J. A. (2010) · Utrecht University Repository (Utrecht University)
Gut microbiota and atopic manifestations in infancy
Penders, J. (2007) · doi:10.26481/dis.20070330jp
Nutrition and Gut Health in Older People
Ouwehand, A. C., Tiihonen, K., Mäkeläinen, H., Lahtinen, S. J., & Rautonen, N. (2009) · Elsevier eBooks · doi:10.1533/9781845695484.2.288
Visceral hypersensitivity in Irritable Bowel Syndrome:pathophysiological mechanisms
Kerckhoffs, A. P. M. (2009) · Utrecht University Repository (Utrecht University)
Edirne ilindeki çevresel sularda kirlilik indikatörü mikroorganizmaların ve yeni çıkan bakteriyel patojenlerin moleküler yöntemlerle saptanması
Özgür, M. (2013) · DSpace - Trakya (Trakya University)
Influencia del ambiente sobre la microbiota comensal del intestino de la rata: Implicaciones en la inflamación y en mecanismos sensoriales
Ventura, T., & Evangelina, D. (2009) · TDX (Tesis Doctorals en Xarxa)
Determinación y cuantificación de bacterias acidolácticas por PCR en tiempo real
Phandanouvong, V., Betancourt, L., & Rodríguez, F. (2010) · Revista Mvz Córdoba · doi:10.21897/rmvz.327
Probiotics for the elderly
Forssten, S. D., Lahtinen, S. J., & Ouwehand, A. C. (2009) · Food Science & Technology Bulletin Functional Foods · doi:10.1616/1476-2137.15746
The gut microbial composition in humans in hot occupational settings and the effects of drinking buttermilk
Song, D. (2015) · Lund University Publications Student Papers (Lund University)
MOLECULAR CHARACTERIZATION OF THE HUMAN GUT MICROBIOTA
Tesi, T. D. (2010)
GUT microbiota change and time of restore in intensive care therapy: a case report
Borgo, F., Borghi, E., Marzorati, S., Iapichino, G., & Morace, G. (2016) · International Journal of Medical Research & Health Sciences · doi:10.5958/2319-5886.2016.00024.2
“Prolonged and broadspectrum therapies are associated to deeper changes in the microbial ecology [6].”
Background
Factors Causing Disturbances of the Gut Microbiota
Malago, J. J., & Koninkx, J. F. J. G. (2011) · Springer eBooks · doi:10.1007/978-94-007-0386-5_4
“Absolute deficiency of Bifidobacterium, Lactobacillus, and E. coli has been observed ( Bartosch et al . 2004; Tiihonen et al . 2008).”
Background
Development of an integrated psychological and biological assessment protocol: the role of the brain-gut axis in irritable bowel syndrome
Nelson, E. (2012) · Swinburne figshare (Swinburne University of Technology) · doi:10.25916/sut.26271883
Influence of intestinal microbiota in celiac disease pathogenesis and risk
SEVILLA, M. O. (2015) · RiuNet (Universitat Politècnica de València) · doi:10.4995/thesis/10251/58768
Effect of Antibiotic Therapy on Human Fecal Microbiota and the Relation to the Development of Clostridium difficile
Ea, U. (2008)
Molekulare Analyse der Darmflora von Patienten mit hämatologischen Krebserkrankungen
Goldenberg, O. (2007) · DepositOnce · doi:10.14279/depositonce-1605
UNIVERSIDADE ESTADUAL PAULISTA "JÚLIO DE MESQUITA FILHO" FACULDADE DE CIÊNCIAS AGRÁRIAS E VETERINÁRIAS CÂMPUS DE JABOTICABAL AVALIAÇÃO DA MICROBIOTA PRESENTE NA MUCOSA INTESTINAL DE FRANGOS DE CORTE ALIMENTADOS COM RAÇÃO A BASE DE MILHO OU SORGO ATRAVÉS DE PCR EM TEMPO REAL
Lunedo, R. (2012)
Desenvolvimento de sorvete simbiótico de graviola (Annona muricata L.) com teor reduzido de gordura e avaliação da resistência gastrointestinal dos probióticos in vitro
Sousa, G. L. (2013) · doi:10.11606/t.9.2013.tde-19032014-114952
Replacing Natural Gas by Biogas — Determining the Bacterial Contamination of Biogas by PCR
Čermáková, J., Mrázek, J., Fliegerova, K. O., & Tenkrát, D. (2012) · Acta Polytechnica · doi:10.14311/1582
“[8] The total DNA was purified using a PowerSoil DNA Isolation Kit (MoBio) according to the manufacturer’s protocol.”
Method
Are Weight and Diet Related to the Gut Microbiome in Healthy College Students Living in the Dorms? : A Cross-Sectional Observational Analysis
Hotz, R. (2016) · Arizona State University Library Digital Repository (Arizona State University)
A Review on Bifidobacteria for Human Health
Song, M., Park, W. S., Yoo, J., & Ham, J.-S. (2017) · Journal of Dairy Science and Biotechnology · doi:10.22424/jmsb.2017.35.2.73
Fermentable Non-Digestible Dietary Fiber and Bioactive Compounds Affect Aging and Fat Deposition in Caenorhabditis elegans
Gao, C. (2015) · Louisiana State University · doi:10.31390/gradschool_dissertations.2424
Prebiotic activity of isomalto-oligosaccharides
Ketabi, A. (2011) · ERA: Education and Research Archive (University of Alberta) · doi:10.7939/r3tk52
The role of gut microbiota in forming a response to immunotherapy of malignant neoplasms: problem state
Semiglazova, Т. Y., Бриш, Н. А., Galunova, T. Y., Бернацкий, А. С., & Семиглазов, В. В. (2018) · Meditsinskiy sovet = Medical Council · doi:10.21518/2079-701x-2018-10-128-133
The role of starch and fiber composition on nutrient flow, site and extent of nutrient digestion, and microbial profiles in pigs
Fouhse, J. M. (2016) · ERA: Education and Research Archive (University of Alberta) · doi:10.7939/r33f4m10p
In vitro investigation of antibacterial activity against fecal bacteria infecting wounds
Hirashima, H., Komori, Y., Kohinata, Y., Komai, M., & Fukushima, K. (2019) · Wound Medicine · doi:10.1016/j.wndm.2019.100169
BREEDING PROBIOTIC STRAINS OF MICROORGANISMS
Tsugkiev, B. G., Ramonova, E. V., Kabisov, R. G., Petrukovich, A. G., Hoziev, A. M., & Tsugkieva, I. B. T. (2018) · Journal of Experimental Biology and Agricultural Sciences · doi:10.18006/2018.6(2).335.341
“Bartosch et al. (2004) have reported that the microbial population in the intestines undergoes certain changes in the process of human development.”
Background
The Aging Gut Microbiota
Keebaugh, E. S., Williams, L. D., & Ja, W. W. (2019) · Springer eBooks · doi:10.1007/978-3-030-28737-5_12
Identifikace mikrobiální populace v bioplynu
Čermáková, J. (2011) · Paliva · doi:10.35933/paliva.2011.02.03
Optimizing the use of canola meal in swine diets for lifetime performance
Mejicanos, G. A. (2019) · Mspace (University of Manitoba)

Authors: Bartosch, S., Fite, A., Macfarlane, G. T., & McMurdo, M. E. T.
Affiliations: University of Dundee (GB)
MRC Microbiology and Gut Biology Group
Venue: Applied and Environmental Microbiology
Publisher: American Society for Microbiology
Published: 2004-06
Volume: 70
Issue: 6
Pages: 3575-3581
ISSN: 0099-2240 (ISSN-L)
1098-5336
DOI: 10.1128/aem.70.6.3575-3581.2004
PMC: PMC427772
OpenAlex: W2109744701
Cited by: 762
References: 51
Citations by year: 2026: 15 · 2025: 29 · 2024: 12 · 2023: 31 · 2022: 36 · 2021: 51 · 2020: 49 · 2019: 36 · 2018: 38 · 2017: 63 · 2016: 59 · 2015: 65 · 2014: 44 · 2013: 46 · 2012: 46
FWCI: 4.63
Type: journal article
Language: en
Open access: green
europepmc.org
Licence: journals.asm.org/non-commercial-tdm-license (tdm)
Locations: Applied and Environmental Microbiology (publishedVersion)
Europe PMC (PubMed Central) (publishedVersion)
PubMed Central (publishedVersion)
PubMed (publishedVersion)
Discovery Research Portal (University of Dundee) (submittedVersion)
Funders: Medical Research Council
Topics: Life Sciences › Biochemistry, Genetics and Molecular Biology › Molecular Biology › Gut microbiota and health
Health Sciences › Medicine › Infectious Diseases › Clostridium difficile and Clostridium perfringens research
Physical Sciences › Environmental Science › Ecology › Microbial Community Ecology and Physiology
Keywords: fecal microbiota, older adults, hospitalized patients, antibiotic therapy, Bifidobacterium, Desulfovibrio, Faecalibacterium prausnitzii, 16S rRNA gene quantification, Enterobacteriaceae, Enterococcus faecalis, intestinal bacteria, community-acquired infections
MeSH terms: Aged, Aged, 80 and over, Anti-Bacterial Agents, Bacteria, Bacterial Infections, DNA, Bacterial, DNA, Ribosomal, Feces, Hospitalization, Humans, RNA, Ribosomal, 16S, Species Specificity, Polymerase Chain Reaction, Ecosystem, DNA Primers, Gene Dosage, Genes, rRNA

About these checks

Registry, retraction, Cites and statistics results are computed, not judged, with one exception: a printed reference that no index lists is read once by a model before it counts as a citation error. Claims are extracted by a model and kept only when their quote appears verbatim in the text; each cited source is then checked, with a model’s help, for whether it says what the claim relies on. Those verdicts can be wrong — read the claim’s quote and the cited source before relying on one.

Statistics and arithmetic are recomputed, not judged.

Confidence bands are shown only for fields calibrated on our annotated test set. None is calibrated yet, so no band is shown.

What counts as a claim ›How we measure confidence ›How we check this ›

Are you an author, or do you see a problem with this page? Request a review

Characterization of Bacterial Communities in Feces from Healthy Elderly Volunteers and Hospitalized Elderly Patients by Using Real-Time PCR and Effects of Antibiotic Treatment on the Fecal Microbiota

Abstract

Overview

Integrity signals

Verification

Claims the paper makes

Claims other papers make about this one

Self-check

Citations

Cites

Cited by

Related

Metadata

Record

About these checks