Cited by 762Gut microbiota and healthClostridium difficile and Clostridium perfringens researchMicrobial Community Ecology and Physiology

The DOI matches its Crossref record; 51 of the 51 references it cites were found in a registry or an index.

Characterization of Bacterial Communities in Feces from Healthy Elderly Volunteers and Hospitalized Elderly Patients by Using Real-Time PCR and Effects of Antibiotic Treatment on the Fecal Microbiota

Open access

Bartosch, Sabine, Fite, Alemu, Macfarlane, George T., McMurdo, Marion E. T.·2004·Applied and Environmental Microbiology

DOI 10.1128/aem.70.6.3575-3581.2004PMC PMC427772

Open this paper in CoChat — free account

Abstract

Fecal bacteria were studied in healthy elderly volunteers (age, 63 to 90 years;n= 35) living in the local community, elderly hospitalized patients (age, 66 to 103;n= 38), and elderly hospitalized patients receiving antibiotic treatment (age, 65 to 100;n= 21). Group- and species-specific primer sets targeting 16S rRNA genes were used to quantitate intestinal bacteria by using DNA extracted from feces and real-time PCR. The principal difference between healthy elderly volunteers and both patient cohorts was a marked reduction in the Bacteroides-Prevotella group following hospitalization. Reductions in bifidobacteria,Desulfovibrio spp.,Clostridium clostridiiforme, and Faecalibacterium prausnitzii were also found in the hospitalized patients. However, total 16S rRNA gene copy numbers (per gram of wet weight of feces) were generally lower in the stool samples of the two groups of hospitalized patients compared to the number in the stool samples of elderly volunteers living in the community, so the relative abundance (percentage of the group- and species-specific rRNA gene copies in relation to total bacterial rRNA gene copies) of bifidobacteria,Desulfovibrio spp.,C. clostridiiforme, and F. prausnitzii did not change. Antibiotic treatment resulted in further reductions in the numbers of bacteria and their prevalence and, in some patients, complete elimination of certain bacterial communities. Conversely, the numbers of enterobacteria increased in the hospitalized patients who did not receive antibiotics, and due to profound changes in fecal microbiotas during antibiotic treatment, the opportunistic species Enterococcus faecalis proliferated.

The claims and statistics of this paper haven’t been checked yet.

Run the check — free, no account needed. It reads the open-access text and checks the sources it cites.

Integrity signals

Registry

Crossref · 10.1128/aem.70.6.3575-3581.2004

Cites

51 of 51 references verified0 citation errors · 0 not checkable

Statistics

Claims the paper makes

The claims and statistics of this paper haven’t been checked yet.

Run the check — free, no account needed. It reads the open-access text and checks the sources it cites.

Claims other papers make about this one

Each is checked against this paper’s own text: does it say what the citing paper says it does?

Self-check

Percentages, sums and reported differences re-computed from the paper’s own numbers.

The self-check needs the paper’s full text.

Bergey's Manual of Systematic Bacteriology
(1990) · Annals of Internal Medicine · doi:10.7326/0003-4819-112-5-391_3 · Cited by 15,633
Determination of bacterial load by real-time PCR using a broad-range (universal) probe and primers set
Nadkarni, M. A., Martin, F. E., Jacques, N. A., & Hunter, N. (2002) · Microbiology · doi:10.1099/00221287-148-1-257 · Cited by 1,931
Direct analysis of genes encoding 16S rRNA from complex communities reveals many novel molecular species within the human gut
Suau, A., Bonnet, R., Sutren, M., Godon, J.-J., Gibson, G. R., Collins, M. D., & Doré, J. (1999) · Applied and Environmental Microbiology · doi:10.1128/aem.65.11.4799-4807.1999 · Cited by 1,490
The Ribosomal Database Project (RDP-II): previewing a new autoaligner that allows regular updates and the new prokaryotic taxonomy
Cole, J. R. (2003) · Nucleic Acids Research · doi:10.1093/nar/gkg039 · Cited by 1,435
Temperature Gradient Gel Electrophoresis Analysis of 16S rRNA from Human Fecal Samples Reveals Stable and Host-Specific Communities of Active Bacteria
Zoetendal, E. G., Akkermans, A. D. L., & de Vos, W. M. (1998) · Applied and Environmental Microbiology · doi:10.1128/aem.64.10.3854-3859.1998 · Cited by 1,360
rrndb: the Ribosomal RNA Operon Copy Number Database
Klappenbach, J., Saxman, P., Cole, J., & Schmidt, T. M. (2001) · Nucleic Acids Res. · doi:10.1093/nar/29.1.181 · Cited by 1,140
Quantitative fluorescence in situ hybridization of Bifidobacterium spp. with genus-specific 16S rRNA-targeted probes and its application in fecal samples
Langendijk-Genevaux, P. S., Schut, F., Jansen, G. J., Raangs, G. C., Kamphuis, G. R., Wilkinson, M. H. F., & Welling, G. W. (1995) · Applied and Environmental Microbiology · doi:10.1128/aem.61.8.3069-3075.1995 · Cited by 974
Effect of antimicrobial agents on the ecological balance of human microflora
Sullivan, Å., Edlund, C., & Nord, C. E. (2001) · The Lancet Infectious Diseases · doi:10.1016/s1473-3099(01)00066-4 · Cited by 816
Growth requirements and fermentation products of Fusobacterium prausnitzii, and a proposal to reclassify it as Faecalibacterium prausnitzii gen. nov., comb. nov
Duncan, S. H., Hold, G. L., Harmsen, H. J. M., Stewart, C. S., & Flint, H. J. (2002) · INTERNATIONAL JOURNAL OF SYSTEMATIC AND EVOLUTIONARY MICROBIOLOGY · doi:10.1099/00207713-52-6-2141 · Cited by 753
Development of 16S rRNA-Gene-Targeted Group-Specific Primers for the Detection and Identification of Predominant Bacteria in Human Feces
Matsuki, T., Watanabe, K., Fujimoto, J., Miyamoto, Y., Takada, T., Matsumoto, K., Oyaizu, H., & Tanaka, R. (2002) · Applied and Environmental Microbiology · doi:10.1128/aem.68.11.5445-5451.2002 · Cited by 663

Flagged first, then by citations

Show all 51 references

Research works printed but not linked: 2

10.1111/j.1574-6968.1991.tb04588.x · DOI
Mitsuoka, T., K. Hayakawa, and N. Kimura. 1974. Die Faekalflora bei Menschen II. Mitteilung: Die Zusammensetzung der Bifidobakterienflora der verschiedenen Altersgruppen. Zentbl. Bakteriol. Hyg. Abt. 1 Orig. A226:469-478.

Sorted by citations

Items 101–200 of 761

Synbiotic consumption changes the metabolism and composition of the gut microbiota in older people and modifies inflammatory processes: a randomised, double-blind, placebo-controlled crossover study
Macfarlane, S., Cleary, S., Bahrami, B., Reynolds, N., & Macfarlane, G. T. (2013) · Alimentary Pharmacology & Therapeutics · doi:10.1111/apt.12453 · Cited by 148
Self-citation
The microbiome: An emerging key player in aging and longevity
Kim, M., & Benayoun, B. A. (2020) · Translational Medicine of Aging · doi:10.1016/j.tma.2020.07.004 · Cited by 144
“dysbiosis is reduced microbiota diversity, which is suggested to lead to an expansion of distinct groups of bacteria [39,100,101].”
Background
Small Intestinal Nematode Infection of Mice Is Associated with Increased Enterobacterial Loads alongside the Intestinal Tract
Rausch, S., Held, J., Fischer, A., Heimesaat, M. M., Kühl, A. A., Bereswill, S., & Hartmann, S. (2013) · PLoS ONE · doi:10.1371/journal.pone.0074026 · Cited by 147
“Bacteroides group Bacteroides ovatus DSMZ 1896 F: GAAGGTCCCCCACATTG, R: CAATCGGAGTTCTTCGTG [53]”
Background
Gut Microbiota during Dietary Restrictions: New Insights in Non-Communicable Diseases
Rinninella, E., Cintoni, M., Raoul, P. C., Ianiro, G., Laterza, L., Lopetuso, L. R., Ponziani, F. R., Gasbarrini, A., & Mele, M. C. (2020) · Microorganisms · doi:10.3390/microorganisms8081140 · Cited by 153
“Specifically, lower abundance of phylum Firmicutes and an overall lower microbial diversity were detected in older subjects compared with young subjects [89].”
Background
Effects of sc FOS on the composition of fecal microbiota and anxiety in patients with irritable bowel syndrome: a randomized, double blind, placebo controlled study
Azpiroz, F., Dubray, C., Bernalier‐Donadille, A., Cardot, J. ‐., Accarino, A. M., Serra, J., Wagner, A., Respondek, F., & Dapoigny, M. C. (2016) · Neurogastroenterology & Motility · doi:10.1111/nmo.12911 · Cited by 149
Gut Microbial Changes, Interactions, and Their Implications on Human Lifecycle: An Ageing Perspective
Vemuri, R., Gundamaraju, R., Shastri, M. D., Shukla, S. D., Kalpurath, K., Ball, M. A. Z., Tristram, S. G., Shankar, E. M., Ahuja, K., & Eri, R. D. (2018) · BioMed Research International · doi:10.1155/2018/4178607 · Cited by 142
“A study on the faecal bacteria in healthy old volunteers (age range 63 to 90 years; n = 35) living in the local community, old, hospitalized patients (age range 66 to 103 years; n = 38), and old, hospitalized patients receiving antibiotic treatment (age range 65 to 100 years; n = 21) [47] exhibited a decrease in Bacte…”
Background
Nonstarch Polysaccharides Modulate Bacterial Microbiota, Pathways for Butyrate Production, and Abundance of Pathogenic Escherichia coli in the Pig Gastrointestinal Tract
Metzler-Zebeli, B. U., Hooda, S., Pieper, R., Zijlstra, R. T., Kessel, A. G. V., Mosenthin, R., & Gänzle, M. G. (2010) · Applied and Environmental Microbiology · doi:10.1128/aem.00257-10 · Cited by 139
Irritable Bowel Syndrome, Particularly the Constipation-Predominant Form, Involves an Increase inMethanobrevibacter smithii, Which Is Associated with Higher Methane Production
Ghoshal, U., Shukla, R., Srivastava, D., & Ghoshal, U. C. (2016) · Gut and Liver · doi:10.5009/gnl15588 · Cited by 137
“Genomic DNA from ATCC bacterial strain was extracted using heat extraction method and quantified by NanoDrop spectrophotometer.(20) Standard graph was used to calculate the copy number of 16S rRNA gene for M.”
Method
Selected microbial groups and short-chain fatty acids profile in a simulated chicken cecum supplemented with two strains of Lactobacillus
Meimandipour, A., Shuhaimi, M., Farjam, A. S., Azhar, K., Bejo, M. H., Kabeir, B. M., Javanmard, A., Anas, O. M., & Manap, M. Y. A. (2010) · Poultry Science · doi:10.3382/ps.2009-00495 · Cited by 136
“, 2003) Bifi R GGTGTTCTTCCCGATATCTACA Faecalibacterium prausnitzii Fprau223F GATGGCCTCGCGTCCGATTAG 198 58 (Bartosch et al., 2004) Fprau420R CCGAAGACCTTCTTCCTCC Clostridium butyricum Cbut825F GTGCCGCCGCTAACGCATTAAGTAT 208 72 (Bartosch et al.”
BackgroundMethodInfluential
Metagenomic evidence for taxonomic dysbiosis and functional imbalance in the gastrointestinal tracts of children with cystic fibrosis
Manor, O., Levy, R., Pope, C. E., Hayden, H. S., Brittnacher, M., Carr, R., Radey, M. C., Hager, K. R., Heltshe, S. L., Ramsey, B. W., et al. (2016) · Scientific Reports · doi:10.1038/srep22493 · Cited by 133
Correlation between gastrointestinal fungi and varying degrees of chronic hepatitis B virus infection
Chen, Y., Chen, Z., Guo, R., Chen, N., Lu, H., Huang, S., Wang, J., & Li, L. (2010) · Diagnostic Microbiology and Infectious Disease · doi:10.1016/j.diagmicrobio.2010.04.005 · Cited by 135
“DNA was extracted using the QIAampDNA Stool Mini Kit (QIAGEN Company, Germany) with slight modification (Bartosch et al., 2004).”
BackgroundMethod
Diet, the intestinal microbiota, and immune health in aging
Clements, S. J., & Carding, S. R. (2016) · Critical Reviews in Food Science and Nutrition · doi:10.1080/10408398.2016.1211086 · Cited by 163
“A loss of carbohydrate fermenting bacteria or reduction in dietary intake of plant-based polysaccharides often seen in the elderly (Bartosch et al., 2004; Woodmansey et al., 2004) can lead to the microbiota switching to other substrates, notably protein or amino acids.”
Background
The pleiotropic effects of prebiotic galacto-oligosaccharides on the aging gut
Arnold, J. W., Roach, J. M., Fabela, S., Moorfield, E., Ding, S., Blue, E., Dagher, S. F., Magness, S. T., Tamayo, R., Bruno-Bárcena, J. M., et al. (2021) · Microbiome · doi:10.1186/s40168-020-00980-0 · Cited by 140
Effects of stocking density on the growth performance and digestive microbiota of broiler chickens
Guardia, S. S., Konsak, B. M., Combes, S., Levenez, F., Cauquil, L., Guillot, J. F., Moreau-Vauzelle, C., Lessire, M., Juin, H., & Gabriel, I. (2011) · Poultry Science · doi:10.3382/ps.2010-01311 · Cited by 133
Oral imazalil exposure induces gut microbiota dysbiosis and colonic inflammation in mice
Jin, C., Zeng, Z., Fu, Z., & Jin, Y. (2016) · Chemosphere · doi:10.1016/j.chemosphere.2016.06.105 · Cited by 132
Effects of bacterial communities on biofuel-producing microalgae: Stimulation, inhibition and harvesting
Wang, H., Hill, R. T., Zheng, T., Hu, X., & Wang, B. (2016) · Critical Reviews in Biotechnology · doi:10.3109/07388551.2014.961402 · Cited by 131
“This technique has been applied in many different samples to monitor shifts in bacterial communities, including human feces (Bartosch et al., 2004), deep sea sponges (Cassler et al.”
Method
Reduced mucin sulfonation and impaired intestinal barrier function in the hyposulfataemic NaS1 null mouse
Dawson, P. A., Huxley, S., Gardiner, B., Tran, T., McAuley, J., Grimmond, S. M., McGuckin, M. A., & Markovich, D. (2009) · Gut · doi:10.1136/gut.2007.147595 · Cited by 127
Starch with High Amylose Content and Low In Vitro Digestibility Increases Intestinal Nutrient Flow and Microbial Fermentation and Selectively Promotes Bifidobacteria in Pigs
Regmi, P. R., Metzler-Zebeli, B. U., Gänzle, M. G., Kempen, T. A. T. G. V., & Zijlstra, R. T. (2011) · Journal of Nutrition · doi:10.3945/jn.111.140509 · Cited by 130
Effect of Bifidobacterium breve on the Intestinal Microbiota of Coeliac Children on a Gluten Free Diet: A Pilot Study
Quagliariello, A., Aloisio, I., Cionci, N. B., Luiselli, D., D’Auria, G., Martinez-Priego, L., Pérez-Villaroya, D., Langerholc, T., Primec, M., Mičetić‐Turk, D., et al. (2016) · Nutrients · doi:10.3390/nu8100660 · Cited by 130
“Enterobacteria 195 [35] 63 ◦C Eco 1457F CATTGACGTTACCCGCAGAAGAAGC Eco 1652R CTCTACGAGACTCAAGCTGC”
Background
Colonic Transit Time Is a Driven Force of the Gut Microbiota Composition and Metabolism: In Vitro Evidence
Tottey, W., Feria-Gervasio, D., Gaci, N., Laillet, B., Pujos, E., Martin, J.-F., Sebedio, J.-L., Sion, B., Jarrige, J.-F., Alric, M., et al. (2017) · Journal of Neurogastroenterology and Motility · doi:10.5056/jnm16042 · Cited by 125
“We observed that the increase of retention time induced a decrease of total bacteria in the compartments of the system simulating the transversal and distal colon (data not shown), which is also frequently associated with the gut microbiota of elderly people.(11,35,36) Furthermore, increasing the retention time decrea…”
Background
Isolation and Quantification of Uremic Toxin Precursor-Generating Gut Bacteria in Chronic Kidney Disease Patients
Gryp, T., Huys, G. R. B., Joossens, M., Biesen, W. V., Glorieux, G., & Vaneechoutte, M. (2020) · International Journal of Molecular Sciences · doi:10.3390/ijms21061986 · Cited by 124
Inulin and fructo-oligosaccharides have divergent effects on colitis and commensal microbiota in HLA-B27 transgenic rats
Koleva, P. T., Valcheva, R. S., Sun, X., Gänzle, M. G., & Dieleman, L. A. (2012) · British Journal Of Nutrition · doi:10.1017/s0007114511007203 · Cited by 121
Dynamics of Vaginal Bacterial Communities in Women Developing Bacterial Vaginosis, Candidiasis, or No Infection, Analyzed by PCR-Denaturing Gradient Gel Electrophoresis and Real-Time PCR
Vitali, B., Pugliese, C., Biagi, E., Candela, M., Turroni, S., Bellen, G., Donders, G. G. G., & Brigidi, P. (2007) · Applied and Environmental Microbiology · doi:10.1128/aem.01251-07 · Cited by 119
“Real-time PCR with genus- and species-specific primers can provide a quantification of selected bacteria present in complex microbial communities by measuring the amount of PCR products in each cycle as fluorescence ( 6 , 11, 26, 27, 31).”
BackgroundMethodInfluential
Gut Microbiota, Antibiotic Therapy and Antimicrobial Resistance: A Narrative Review
Pilmis, B., Monnier, A. L., & Zahar, J. (2020) · Microorganisms · doi:10.3390/microorganisms8020269 · Cited by 129
Fecal Microbiota Transplantation for Ulcerative Colitis: A Systematic Review and Meta-Analysis
Shi, Y., Dong, Y., Huang, W., Zhu, D., Mao, H., & Su, P. (2016) · PLoS ONE · doi:10.1371/journal.pone.0157259 · Cited by 121
A Single-Batch Fermentation System to Simulate Human Colonic Microbiota for High-Throughput Evaluation of Prebiotics
Takagi, R., Sasaki, K., Sasaki, D., Fukuda, I., Tanaka, K., Yoshida, K., Kondo, A., & Osawa, R. (2016) · PLoS ONE · doi:10.1371/journal.pone.0160533 · Cited by 120
Gut microbiota and old age: Modulating factors and interventions for healthy longevity
Coman, V., & Vodnar, D. C. (2020) · Experimental Gerontology · doi:10.1016/j.exger.2020.111095 · Cited by 129
Microbiome-health interactions in older people
O’Toole, P. W., & Jeffery, I. B. (2018) · Cellular and Molecular Life Sciences · doi:10.1007/s00018-017-2673-z · Cited by 117
Cross-Sectional and Longitudinal Comparisons of the Predominant Fecal Microbiota Compositions of a Group of Pediatric Patients with Cystic Fibrosis and Their Healthy Siblings
Duytschaever, G., Huys, G., Bekaert, M., Boulanger, L., De Boeck, K., & Vandamme, P. (2011) · Applied and Environmental Microbiology · doi:10.1128/aem.05933-11 · Cited by 114
“In IBD patients (19, 36), as well as in patients undergoing antibiotic treatment (2, 3, 41, 46), an underrepresentation of fecal Bacteroidetes and Firmicutes has been reported.”
Background
Microbial ecology of the equine hindgut during oligofructose-induced laminitis
Milinovich, G. J., Burrell, P. C., Pollitt, C. C., Klieve, A. V., Blackall, L. L., Ouwerkerk, D., Woodland, E., & Trott, D. J. (2008) · The ISME Journal · doi:10.1038/ismej.2008.67 · Cited by 117
“Enterobacteriaceae.”
MethodInfluential
Nucleic Acid-based Detection of Bacterial Pathogens Using Integrated Microfluidic Platform Systems
Lui, C. S., Cady, N. C., & Batt, C. A. (2009) · Sensors · doi:10.3390/s90503713 · Cited by 117
Review on microbiota and effectiveness of probiotics use in older
Rondanelli, M. (2015) · World Journal of Clinical Cases · doi:10.12998/wjcc.v3.i2.156 · Cited by 118
Safety and efficacy of inulin and oligofructose supplementation in infant formula: Results from a randomized clinical trial
Closa‐Monasterolo, R., Gispert‐Llauradó, M., Luque, V., Ferré, N., Rubio-Torrents, C., Zaragoza-Jordana, M., & Escribano, J. (2013) · Clinical Nutrition · doi:10.1016/j.clnu.2013.02.009 · Cited by 117
“5 (20, 80) 30 (15, 60) MONTH 2 (n 1⁄4 83) (n 1⁄4 89) (n 1⁄4 79) Formula intake (ml/Kg$day) (Mean (SD)) 165.”
Rapid Antibiotic Susceptibility Testing in a Microfluidic pH Sensor
Tang, Y., Li, Z., Liu, J., & Wu, J. (2013) · Analytical Chemistry · doi:10.1021/ac303282j · Cited by 117
Changes of gut bacteria and immune parameters in liver transplant recipients
Wu, Z., Ling, Z., Lu, H., Zuo, J., Sheng, J., Zheng, S., & Li, L. (2012) · Hepatobiliary & pancreatic diseases international · doi:10.1016/s1499-3872(11)60124-0 · Cited by 112
Side-stream smoking reduces intestinal inflammation and increases expression of tight junction proteins
Wang, H. (2012) · World Journal of Gastroenterology · doi:10.3748/wjg.v18.i18.2180 · Cited by 113
Genomics as a means to understand bacterial phylogeny and ecological adaptation: the case of bifidobacteria
Ventura, M., Canchaya, C. A., Fitzgerald, G. F., Gupta, R. S., & van Sinderen, D. (2006) · Antonie van Leeuwenhoek · doi:10.1007/s10482-006-9122-6 · Cited by 112
“These findings were also corroborated by a combined real-time PCR with Bifidobacterium genus- and species-specific primers (Bartosch et al. 2004; Gueimonde et al. 2004; Matsuki et al. 2004).”
Background
Longitudinal Analyses of Gut Mucosal Microbiotas in Ulcerative Colitis in Relation to Patient Age and Disease Severity and Duration
Fite, A., Macfarlane, S., Furrie, E., Bahrami, B., Cummings, J. H., Steinke, D. T., & Macfarlane, G. T. (2012) · Journal of Clinical Microbiology · doi:10.1128/jcm.02574-12 · Cited by 110
“A range of intestinal isolates and type strains were used as controls for testing specificities of the PCR primers, as described previously (16, 24).”
MethodSelf-citation
This Gut Ain’t Big Enough for Both of Us. Or Is It? Helminth–Microbiota Interactions in Veterinary Species
Peachey, L., Jenkins, T. P., & Cantacessi, C. (2017) · Trends in Parasitology · doi:10.1016/j.pt.2017.04.004 · Cited by 107
Fecal and Mucosa-Associated Intestinal Microbiota in Patients with Diarrhea-Predominant Irritable Bowel Syndrome
Maharshak, N., Ringel, Y., Katibian, D., Lundqvist, A., Sartor, R. B., Carroll, I. M., & Ringel‐Kulka, T. (2018) · Digestive Diseases and Sciences · doi:10.1007/s10620-018-5086-4 · Cited by 109
“,[29] primers from Maeda et al.”
Effects of vitamin E, inorganic selenium, bacterial organic selenium, and their combinations on immunity response in broiler chickens
Dalia, A. M., Loh, T. C., Sazili, A. Q., Jahromi, M. F., & Samsudin, A. A. (2018) · BMC Veterinary Research · doi:10.1186/s12917-018-1578-x · Cited by 108
Antimicrobial resistance and the mechanisms implicated in faecal enterococci from healthy humans, poultry and pets in Portugal
Poeta, P. A. C. Q. D., Costa, D., Rodrigues, J., & Torres, C. (2006) · International Journal of Antimicrobial Agents · doi:10.1016/j.ijantimicag.2005.09.018 · Cited by 108
Grain-rich diets differently alter ruminal and colonic abundance of microbial populations and lipopolysaccharide in goats
Metzler-Zebeli, B. U., Schmitz‐Esser, S., Klevenhusen, F., Podstatzky, L., Wagner, M., & Zebeli, Q. (2013) · Anaerobe · doi:10.1016/j.anaerobe.2013.02.005 · Cited by 107
Fermented Yupingfeng polysaccharides enhance immunity by improving the foregut microflora and intestinal barrier in weaning rex rabbits
Sun, H., Ni, X., Song, X., Wen, B., Zhou, Y., Zou, F., Yang, M., Peng, Z., Zhu, H., Zeng, Y., et al. (2016) · Applied Microbiology and Biotechnology · doi:10.1007/s00253-016-7619-0 · Cited by 105
“…cluster XIVa F: AAATGACGGTACCTGACTAA R: CTTTGAGTTTCATTCTTGCGAA y = 14.748–0.2615X R2 = 0.997 Tm = 60 °C 440 bp Matsuki et al. (2002) Enterobacteriaceae F: CATTGACGTTACCCGCAGAAGAAGC R: CTCTACGAGACTCAAGCTTGC y = 13.870–0.1927X R2 = 0.995 Tm = 52 °C 195 bp Bartosch et al. (2004) Streptococcus spp.”
Influential
Effect of Antibiotic Therapy on Human Fecal Microbiota and the Relation to the Development of Clostridium difficile
三浦, 智., Durand, T., Lalande, V., Petit, J., Potel, G., & Beaugerie, L. (2008) · Microbial Ecology · doi:10.1007/s00248-007-9356-5 · Cited by 105
“Molecular analyses of the bacterial microbiota based on 16S rDNA have attracted attention as reliable methods for detection and identification of bacterial species [ 1 , 12, 17].”
Method
Impact of antibiotics on the gut microbiota of critically ill patients
Iapichino, G., Callegari, M. L., Marzorati, S., Cigada, M., Corbella, D., Ferrari, S., & Morelli, L. (2008) · Journal of Medical Microbiology · doi:10.1099/jmm.0.47387-0 · Cited by 105
“, 2000; Hebuterne & Schneider, 2001) and antibiotic treatment (Sullivan et al., 2001; Bartosch et al., 2004).”
Background
Gut Bacterial Microbiota and its Resistome Rapidly Recover to Basal State Levels after Short-term Amoxicillin-Clavulanic Acid Treatment in Healthy Adults
MacPherson, C. W., Mathieu, O., Tremblay, J., Champagne, J., Nantel, A., Girard, S., & Tompkins, T. A. (2018) · Scientific Reports · doi:10.1038/s41598-018-29229-5 · Cited by 110
Gut Microbiota Interaction with the Central Nervous System throughout Life
Ojeda, J., Ávila, A., & Vidal, P. M. (2021) · Journal of Clinical Medicine · doi:10.3390/jcm10061299 · Cited by 112
Specific amplification of bacterial DNA by optimized so-called universal bacterial primers in samples rich of plant DNA
Dorn‐In, S., Bassitta, R., Schwaiger, K., Bauer, J., & Hölzel, C. S. (2015) · Journal of Microbiological Methods · doi:10.1016/j.mimet.2015.04.001 · Cited by 103
Islamic fasting leads to an increased abundance of Akkermansia muciniphila and Bacteroides fragilis group: A preliminary study on intermittent fasting
Özkul, C., Yalınay, M., & Karakan, T. (2019) · The Turkish Journal of Gastroenterology · doi:10.5152/tjg.2019.19185 · Cited by 105
“), group-specific (Bacteroides fragilis group), and family-specific (Enterobacteriaceae) primers were also selected to target multiple species as previously used in the literature (16-18).”
Method
In Vitro Continuous Fermentation Model (PolyFermS) of the Swine Proximal Colon for Simultaneous Testing on the Same Gut Microbiota
Tanner, S. A., Zihler, A., Rigozzi, E., Grattepanche, F., Chassard, C., & Lacroix, C. (2014) · PLoS ONE · doi:10.1371/journal.pone.0094123 · Cited by 109
“Enterobacteriaceae Eco1457F CAT TGA CGT TAC CCG CAG AAG AAG C [51]”
Background
Assessment of Fecal Microbiota and Fecal Metabolome in Symptomatic Uncomplicated Diverticular Disease of the Colon
Tursi, A., Mastromarino, P., Capobianco, D., Elisei, W., Miccheli, A., Capuani, G., Tomassini, A., Campagna, G., Picchio, M., Giorgetti, G., et al. (2016) · Journal of Clinical Gastroenterology · doi:10.1097/mcg.0000000000000626 · Cited by 103
Curcumin as Prospective Anti-Aging Natural Compound: Focus on Brain
Benameur, T., Soleti, R., Panaro, M. A., Torre, M. E. L., Monda, V., Messina, G., & Porro, C. (2021) · Molecules · doi:10.3390/molecules26164794 · Cited by 105
“In addition to the development of various degenerative disorders including AD, PD, multiple system atrophy (MSA), neuromyelitis optica (NMO), and amyotrophic lateral sclerosis (ALS) [79] as we age, these perturbations might also be triggered indirectly by health status, increasing need for medications such as: NSAIDs,…”
Background
Quantification of butyryl CoA:acetate CoA-transferase genes reveals different butyrate production capacity in individuals according to diet and age
Hippe, B., Zwielehner, J., Liszt, K. I., Laßl, C., Unger, F. M., & Haslberger, A. G. (2010) · FEMS Microbiology Letters · doi:10.1111/j.1574-6968.2010.02197.x · Cited by 103
Abnormal Weight Gain and Gut Microbiota Modifications Are Side Effects of Long-Term Doxycycline and Hydroxychloroquine Treatment
Angelakis, E., Million, M., Sallah, K., Lagier, J., Armougom, F., Giorgi, R., & Raoult, D. (2014) · Antimicrobial Agents and Chemotherapy · doi:10.1128/aac.02437-14 · Cited by 100
“Antibiotics significantly reduce gut bacteria, and in certain patients, these medicines completely eliminate specific bacterial communities (3).”
Background
Retracted
Coarse particle inclusion and lignocellulose-rich fiber addition in feed benefit performance and health of broiler chickens
Kheravii, S. K., Swick, R. A., Choct, M., & Wu, S. (2017) · Poultry Science · doi:10.3382/ps/pex123 · Cited by 108
Rectal Administration of Lactobacillus casei DG Modifies Flora Composition and Toll-Like Receptor Expression in Colonic Mucosa of Patients with Mild Ulcerative Colitis
Renata D'Incà, Barollo, M., Scarpa, M., Grillo, A. R., Brun, P., Vettorato, M. G., Castagliuolo, I., & Sturniolo, G. C. (2010) · Digestive Diseases and Sciences · doi:10.1007/s10620-010-1384-1 · Cited by 101
“Cultivation-independent molecular genetic techniques based on 16S rRNA gene analysis were, thus, employed to offer a broader picture of the complex gut microbial community [ 36 , 37].”
BackgroundMethod
Identification of changes in the composition of ileal bacterial microbiota of broiler chickens infected with Clostridium perfringens
Feng, Y., Gong, J., Yu, H., Jin, Y., Zhu, J., & Han, Y. (2009) · Veterinary Microbiology · doi:10.1016/j.vetmic.2009.07.001 · Cited by 99
Intestinal bacteria and inflammatory bowel disease
Macfarlane, S., Steed, H., & Macfarlane, G. T. (2009) · Critical Reviews in Clinical Laboratory Sciences · doi:10.1080/10408360802485792 · Cited by 99
Self-citation
Probiotic cheese containing Lactobacillus rhamnosus HN001 and Lactobacillus acidophilus NCFM® modifies subpopulations of fecal lactobacilli and Clostridium difficile in the elderly
Lahtinen, S. J., Forssten, S. D., Aakko, J., Granlund, L., Rautonen, N., Salminen, S., Viitanen, M. H., & Ouwehand, A. C. (2011) · AGE · doi:10.1007/s11357-011-9208-6 · Cited by 101
“In addition, increasing evidence suggests that aging is associated with alterations in the gut microbiota (Bartosch et al. 2004; Biagi et al. 2010; Gavini et al. 2001; Hopkins et al. 2001; Hopkins and Macfarlane 2002; Mueller et al. 2006; Woodmansey et al. 2004).”
Effects of dietary fats rich in lauric and myristic acid on performance, intestinal morphology, gut microbes, and meat quality in broilers
Zeitz, J. O., Fennhoff, J., Kluge, H., Stangl, G. I., & Eder, K. (2015) · Poultry Science · doi:10.3382/ps/pev191 · Cited by 101
Introducing GUt Low-Density Array (GULDA) - a validated approach for qPCR-based intestinal microbial community analysis
Bergström, A., Licht, T. R., Wilcks, A., Andersen, J. B., Schmidt, L. R., Grønlund, H. A., Vigsnæs, L. K., Michaelsen, K. F., & Bahl, M. I. (2012) · FEMS Microbiology Letters · doi:10.1111/1574-6968.12004 · Cited by 103
“Real-time qPCR analysis has these properties and is a relatively simple and affordable technique, which offers a high degree of reproducibility and specificity and has thus found extensive use in the quantitative analysis of gut bacterial populations (Huijsdens et al., 2002; Bartosch et al., 2004; Gueimonde et al., 20…”
Method
Modulation of the gut microbiota composition by rifaximin in non-constipated irritable bowel syndrome patients: a molecular approach
Soldi, S., Vasileiadis, S., Uggeri, F., Campanale, M. C., Morelli, L., Calanni, F., Grimaldi, M., Gasbarrini, A., & Fogli, M. V. (2015) · Clinical and Experimental Gastroenterology · doi:10.2147/ceg.s89999 · Cited by 98
Probiotics modulate the Bifidobacterium microbiota of elderly nursing home residents
Lahtinen, S. J., Tammela, L. I., Korpela, J., Parhiala, R., Ahokoski, H., Mykkänen, H. M., & Salminen, S. (2008) · AGE · doi:10.1007/s11357-008-9081-0 · Cited by 96
Dynamic In Vitro Models of the Human Gastrointestinal Tract as Relevant Tools to Assess the Survival of Probiotic Strains and Their Interactions with Gut Microbiota
Cordonnier, C., Thévenot, J., Etienne‐Mesmin, L., Denis, S., Alric, M., Livrelli, V., & Blanquet‐Diot, S. (2015) · Microorganisms · doi:10.3390/microorganisms3040725 · Cited by 94
Probiotics and clinical effects: is the number what counts?
Bertazzoni, E. M., Donelli, G., Midtvedt, T., Nicoli, J. R., & Sanz, Y. (2013) · Journal of Chemotherapy · doi:10.1179/1973947813y.0000000078 · Cited by 98
Altered Gut Microbiota Promotes Colitis-Associated Cancer in IL-1 Receptor–Associated Kinase M–Deficient Mice
Kostovcikova, K., Kverka, M., Zakostelska, Z. J., Hudcovic, T., Hrnčíř, T., Štëpánková, R., Rossmann, P., Rídl, J., Kostovčík, M., Mrázek, J., et al. (2013) · Inflammatory Bowel Diseases · doi:10.1097/mib.0b013e318281330a · Cited by 95
Cultivable and Pyrosequenced Fecal Microflora in Centenarians and Young Subjects
Drago, L., Toscano, M., Rodighiero, V., De Vecchi, E., & Mogna, G. (2012) · Journal of Clinical Gastroenterology · doi:10.1097/mcg.0b013e3182693982 · Cited by 92
Metabolomics Analysis Identifies Intestinal Microbiota-Derived Biomarkers of Colonization Resistance in Clindamycin-Treated Mice
Jump, R., Polinkovsky, A., Hurless, K. N., Sitzlar, B. M., Eckart, K. E., Tomas, M. E., Deshpande, A., Nerandzic, M. M., & Donskey, C. J. (2014) · PLoS ONE · doi:10.1371/journal.pone.0101267 · Cited by 92
The matter of the reproductive microbiome
Schoenmakers, S., Steegers‐Theunissen, R. P. M., & Faas, M. M. (2018) · Obstetric Medicine · doi:10.1177/1753495x18775899 · Cited by 91
Characterisation of the bacterial microbiota of the vagina of dairy cows and isolation of pediocin-producing Pediococcus acidilactici
Wang, Y., Ametaj, B. N., Ambrose, D. J., & Gänzle, M. G. (2013) · BMC Microbiology · doi:10.1186/1471-2180-13-19 · Cited by 92
Relative Abundance in Bacterial and Fungal Gut Microbes in Obese Children: A Case Control Study
Borgo, F., Verduci, E., Riva, A., Lassandro, C., Riva, E., Morace, G., & Borghi, E. (2016) · Childhood Obesity · doi:10.1089/chi.2015.0194 · Cited by 98
Effect of dietary protein supply originating from soybean meal or casein on the intestinal microbiota of piglets
Rist, V. T. S., Weiss, E., Sauer, N., Mosenthin, R., & Eklund, M. (2013) · Anaerobe · doi:10.1016/j.anaerobe.2013.10.003 · Cited by 91
Compositional dynamics of the human intestinal microbiota with aging: Implications for health
Lakshminarayanan, B., Stanton, C., O’Toole, P. W., & Ross, R. P. (2014) · The journal of nutrition health & aging · doi:10.1007/s12603-014-0549-6 · Cited by 93
“…prolonged intestinal transit times, lack of physical activity, recurrent infections and frequent use of antibiotics and other medications (31, 35-38). the most dramatic changes in the composition of the intestinal microbiota in the elderly include reduction in numbers and species diversity…”
Influential
Bacillus coagulans GBI-30, 6086 Modulates Faecalibacterium prausnitzii in Older Men and Women
Nyangale, E. P., Farmer, S., Cash, H. A., Keller, D., Chernoff, D., & Gibson, G. R. (2015) · Journal of Nutrition · doi:10.3945/jn.114.199802 · Cited by 89
“Studies that involve probiotics were also reported (20, 21), although the issue of strain survivability through the upper GI tract occurs.”
Background
Effect of zinc on growth performance, gut morphometry, and cecal microbial community in broilers challenged with Salmonella enterica serovar typhimurium
Shao, Y., Lei, Z., Yuan, J., Yang, Y., Guo, Y., & Zhang, B. (2014) · The Journal of Microbiology · doi:10.1007/s12275-014-4347-y · Cited by 88
Influence of isomalto-oligosaccharides on intestinal microbiota in rats
Ketabi, A., Dieleman, L. A., & Gänzle, M. G. (2011) · Journal of Applied Microbiology · doi:10.1111/j.1365-2672.2011.04984.x · Cited by 86
Effect of prebiotics on the human gut microbiota of elderly persons
Toward, R. E., Montandon, S., Walton, G., & Gibson, G. R. (2012) · Gut Microbes · doi:10.4161/gmic.19411 · Cited by 86
Molecular detection of microbial colonization in cervical mucus of women with and without endometriosis
Akiyama, K., Nishioka, K., Khan, K. N., Tanaka, Y., Mori, T., Nakaya, T., & Kitawaki, J. (2019) · American Journal of Reproductive Immunology · doi:10.1111/aji.13147 · Cited by 84
Metabolomics Signatures of Aging: Recent Advances
Adav, S. S., & Wang, Y. (2021) · Aging and Disease · doi:10.14336/ad.2020.0909 · Cited by 95
“Lactobacilli, and Bacteroides have been linked to old age frailty and aging [128, 129].”
Background
Changes on fecal microbiota in rats exposed to permethrin during postnatal development
Nasuti, C., Coman, M. M., Olek, R. A., Fiorini, D., Verdenelli, M. C., Cecchini, C., Silvi, S., Fedeli, D., & Gabbianelli, R. (2016) · Environmental Science and Pollution Research · doi:10.1007/s11356-016-6297-x · Cited by 85
“A Real-Time quantitative PCR (QPCR) procedure was used for the quantification of the main bacterial groups of rats’ intestinal microbiota by using specific primers, chosen from literature (Rinttila et al. 2004; Fang and Hedin 2003; Byun et al. 2004; Langendijk et al. 1995; Bartosch et al., 2004) as shown in the Table…”
Maintenance of a healthy trajectory of the intestinal microbiome during aging: A dietary approach
Candela, M., Biagi, E., Brigidi, P., O’Toole, P. W., & de Vos, W. M. (2013) · Mechanisms of Ageing and Development · doi:10.1016/j.mad.2013.12.004 · Cited by 87
“Indeed, the decrease of Bacteroidetes seems to be more strictly related to frailty conditions, antibiotic treatment, hospitalization, rather than to the aging process itself (Bartosch et al., 2004; Hopkins et al., 2001; van Tongeren et al., 2005).”
Background
Diversity and metabolic impact of intestinalLactobacillusspecies in healthy adults and the elderly
Štšepetova, J., Sepp, E., Kolk, H., Lõivukene, K., Songisepp, E., & Mikelsaar, M. (2011) · British Journal Of Nutrition · doi:10.1017/s0007114510004770 · Cited by 86
“The purified plasmids were quantified by spectrophotometry (Quibite; Invitrogen, Carlsbad, CA, USA) of multiple dilutions((27)).”
Contribution of the Intestinal Microbiota to Human Health: From Birth to 100 Years of Age
Cheng, J., Palva, A., de Vos, W. M., & Satokari, R. M. (2011) · Current topics in microbiology and immunology · doi:10.1007/82_2011_189 · Cited by 101
“In the elderly, antibiotics seem to fortify the age-related microbiota changes (Bartosch et al. 2004; Woodmansey et al. 2004; Claesson et al. 2010) and increase the risk of GI tract infections including Clostridium difficile infection.”
Background
Mode of Delivery and Early Nutrition Modulate Microbial Colonization and Fermentation Products in Neonatal Piglets
Wang, M., Radlowski, E. C., Monaco, M. H., Fahey, G. C., Jr., Gaskins, H. R., & Donovan, S. M. (2013) · Journal of Nutrition · doi:10.3945/jn.112.173096 · Cited by 80
Dietary Red Meat Aggravates Dextran Sulfate Sodium-Induced Colitis in Mice Whereas Resistant Starch Attenuates Inflammation
Leu, R. K. L., Young, G. P., Hu, Y. C., Winter, J. M., & Conlon, M. A. (2013) · Digestive Diseases and Sciences · doi:10.1007/s10620-013-2844-1 · Cited by 82
“gnavus except 45 s annealing and 700 nM primer) [30].”
Background
Assessment of Microbiome Variation During the Perioperative Period in Liver Transplant Patients: a Retrospective Analysis
Lu, H., He, J.-Q., Wu, Z., Xu, W., Zhang, H., Ye, P., Yang, J., Zhen, S., & Li, L. (2013) · Microbial Ecology · doi:10.1007/s00248-013-0211-6 · Cited by 81
“DNAwas extracted from the feces and bacterial precipitates were made using a Qiagen Stool Kit (Qiagen, Hilden, Germany) with a modified protocol for cell lysis [3].”
Effect of Age on Treatment Outcomes in C lostridium difficile Infection
Louie, T., Miller, M. A., Crook, D. W., Lentnek, A. L., Bernard, L., High, K. P., Shue, Y., & Gorbach, S. L. (2013) · Journal of the American Geriatrics Society · doi:10.1111/jgs.12090 · Cited by 81
Microbiologic factors affecting Clostridium difficile recurrence
Chilton, C. H., Pickering, D. S., & Freeman, J. (2017) · Clinical Microbiology and Infection · doi:10.1016/j.cmi.2017.11.017 · Cited by 81
Gut Microbiota in Bipolar Depression and Its Relationship to Brain Function: An Advanced Exploration
Lu, Q., Lai, J., Lu, H., Ng, C. H., Huang, T., Zhang, H., Ding, K., Wang, Z., Jiang, J., Hu, J., et al. (2019) · Frontiers in Psychiatry · doi:10.3389/fpsyt.2019.00784 · Cited by 83
“DNA was extracted from the feces and precipitates with the Qiagen Stool Kit (Qiagen, Hilden, Germany), according to a modified protocol for cell lysis (41).”
Method
High-throughput analysis of the impact of antibiotics on the human intestinal microbiota composition
Ladirat, S. E., Schols, H. A., Nauta, A., Schoterman, M. H. C., Keijser, B. J. F., Montijn, R. C., Gruppen, H., & Schuren, F. H. J. (2012) · Journal of Microbiological Methods · doi:10.1016/j.mimet.2012.12.011 · Cited by 82
Influence of postbiotic RG14 and inulin combination on cecal microbiota, organic acid concentration, and cytokine expression in broiler chickens
Kareem, K. Y., Loh, T. C., Foo, H. L., Samsudin, A. A., & Akit, H. (2016) · Poultry Science · doi:10.3382/ps/pew362 · Cited by 80
Microbial Targets for the Development of Functional Foods Accordingly with Nutritional and Immune Parameters Altered in the Elderly
Salazar, N., López, P., Valdés, L., Margolles, A., Suárez, A., Patterson, Á. M., Cuervo, A., Reyes-Gavilán, C. G. D. L., Ruas-Madiedo, P., Gonzalez, S., et al. (2013) · Journal of the American College of Nutrition · doi:10.1080/07315724.2013.827047 · Cited by 80
Chronic Liver Diseases and the Microbiome—Translating Our Knowledge of Gut Microbiota to Management of Chronic Liver Disease
Acharya, C., & Bajaj, J. S. (2020) · Gastroenterology · doi:10.1053/j.gastro.2020.10.056 · Cited by 79
The Pioneer Gut Microbiota in Human Neonates Vaginally Born at Term—A Pilot Study
Karlsson, C., Molin, G., Cilio, C., & Ahrné, S. (2011) · Pediatric Research · doi:10.1203/pdr.0b013e318225f765 · Cited by 83
Alterations in intestinal microbiota of elderly Irish subjects post-antibiotic therapy
O’Sullivan, Ó., Coakley, M., Lakshminarayanan, B., Conde, S., Claesson, M. J., Cusack, S., Fitzgerald, A. J., O’Toole, P. W., Stanton, C., & Ross, R. P. (2012) · Journal of Antimicrobial Chemotherapy · doi:10.1093/jac/dks348 · Cited by 77
Organic acid blends improve intestinal integrity, modulate short-chain fatty acids profiles and alter microbiota of broilers under necrotic enteritis challenge
Kumar, A., Toghyani, M., Kheravii, S. K., Pineda, L., Han, Y., Swick, R. A., & Wu, S. (2021) · Animal nutrition · doi:10.1016/j.aninu.2021.04.003 · Cited by 84
Anti-tumour Necrosis Factor Treatment with Adalimumab Induces Changes in the Microbiota of Crohn’s Disease
Busquets, D., Mas-De-Xaxars, T., López‐Siles, M., Martínez-Medina, M., Bahí, A., Sàbat, M., Louvriex, R., Miquel-Cusachs, J. O., Garcia-Gil, L. J., & Aldeguer, X. (2015) · Journal of Crohn s and Colitis · doi:10.1093/ecco-jcc/jjv119 · Cited by 77
Effects of synbiotic fermented milk containing Lactobacillus acidophilus La-5 and Bifidobacterium animalis ssp. lactis BB-12 on the fecal microbiota of adults with irritable bowel syndrome: A randomized double-blind, placebo-controlled trial
Matijašić, B. B., Obermajer, T., Lipoglavšek, L., Sernel, T., Locatelli, I., Kos, M., Šmid, A., & Rogelj, I. (2016) · Journal of Dairy Science · doi:10.3168/jds.2015-10743 · Cited by 81
“…MA), 0.2 μM of each of the 2 oligonucleotide primers listed in Supplementary Table S1 (http://dx.doi.org/10.3168/jds.2015-10743; Malinen et al., 2003; Bartosch et al., 2004; Rinttilä et al., 2004; Fierer et al., 2005; Songjinda et al., 2007; Savard et al., 2011), and 1 μL of the isolated fecal…”
BackgroundInfluential
Dietary supplementation with soybean oligosaccharides increases short-chain fatty acids but decreases protein-derived catabolites in the intestinal luminal content of weaned Huanjiang mini-piglets
Zhou, X., Kong, X., Lian, G., Blachier, F., Geng, M., & Yin, Y. (2014) · Nutrition Research · doi:10.1016/j.nutres.2014.08.008 · Cited by 75

Authors: Bartosch, S., Fite, A., Macfarlane, G. T., & McMurdo, M. E. T.
Affiliations: University of Dundee (GB)
MRC Microbiology and Gut Biology Group
Venue: Applied and Environmental Microbiology
Publisher: American Society for Microbiology
Published: 2004-06
Volume: 70
Issue: 6
Pages: 3575-3581
ISSN: 0099-2240 (ISSN-L)
1098-5336
DOI: 10.1128/aem.70.6.3575-3581.2004
PMC: PMC427772
OpenAlex: W2109744701
Cited by: 762
References: 51
Citations by year: 2026: 15 · 2025: 29 · 2024: 12 · 2023: 31 · 2022: 36 · 2021: 51 · 2020: 49 · 2019: 36 · 2018: 38 · 2017: 63 · 2016: 59 · 2015: 65 · 2014: 44 · 2013: 46 · 2012: 46
FWCI: 4.63
Type: journal article
Language: en
Open access: green
europepmc.org
Licence: journals.asm.org/non-commercial-tdm-license (tdm)
Locations: Applied and Environmental Microbiology (publishedVersion)
Europe PMC (PubMed Central) (publishedVersion)
PubMed Central (publishedVersion)
PubMed (publishedVersion)
Discovery Research Portal (University of Dundee) (submittedVersion)
Funders: Medical Research Council
Topics: Life Sciences › Biochemistry, Genetics and Molecular Biology › Molecular Biology › Gut microbiota and health
Health Sciences › Medicine › Infectious Diseases › Clostridium difficile and Clostridium perfringens research
Physical Sciences › Environmental Science › Ecology › Microbial Community Ecology and Physiology
Keywords: fecal microbiota, older adults, hospitalized patients, antibiotic therapy, Bifidobacterium, Desulfovibrio, Faecalibacterium prausnitzii, 16S rRNA gene quantification, Enterobacteriaceae, Enterococcus faecalis, intestinal bacteria, community-acquired infections
MeSH terms: Aged, Aged, 80 and over, Anti-Bacterial Agents, Bacteria, Bacterial Infections, DNA, Bacterial, DNA, Ribosomal, Feces, Hospitalization, Humans, RNA, Ribosomal, 16S, Species Specificity, Polymerase Chain Reaction, Ecosystem, DNA Primers, Gene Dosage, Genes, rRNA

About these checks

Registry, retraction, Cites and statistics results are computed, not judged, with one exception: a printed reference that no index lists is read once by a model before it counts as a citation error. Claims are extracted by a model and kept only when their quote appears verbatim in the text; each cited source is then checked, with a model’s help, for whether it says what the claim relies on. Those verdicts can be wrong — read the claim’s quote and the cited source before relying on one.

Statistics and arithmetic are recomputed, not judged.

Confidence bands are shown only for fields calibrated on our annotated test set. None is calibrated yet, so no band is shown.

What counts as a claim ›How we measure confidence ›How we check this ›

Are you an author, or do you see a problem with this page? Request a review

Characterization of Bacterial Communities in Feces from Healthy Elderly Volunteers and Hospitalized Elderly Patients by Using Real-Time PCR and Effects of Antibiotic Treatment on the Fecal Microbiota

Abstract

Overview

Integrity signals

Verification

Claims the paper makes

Claims other papers make about this one

Self-check

Citations

Cites

Cited by

Related

Metadata

Record

About these checks