Cited by 762Gut microbiota and healthClostridium difficile and Clostridium perfringens researchMicrobial Community Ecology and Physiology

The DOI matches its Crossref record; 51 of the 51 references it cites were found in a registry or an index.

Characterization of Bacterial Communities in Feces from Healthy Elderly Volunteers and Hospitalized Elderly Patients by Using Real-Time PCR and Effects of Antibiotic Treatment on the Fecal Microbiota

Open access

Bartosch, Sabine, Fite, Alemu, Macfarlane, George T., McMurdo, Marion E. T.·2004·Applied and Environmental Microbiology

DOI 10.1128/aem.70.6.3575-3581.2004PMC PMC427772

Open this paper in CoChat — free account

Abstract

Fecal bacteria were studied in healthy elderly volunteers (age, 63 to 90 years;n= 35) living in the local community, elderly hospitalized patients (age, 66 to 103;n= 38), and elderly hospitalized patients receiving antibiotic treatment (age, 65 to 100;n= 21). Group- and species-specific primer sets targeting 16S rRNA genes were used to quantitate intestinal bacteria by using DNA extracted from feces and real-time PCR. The principal difference between healthy elderly volunteers and both patient cohorts was a marked reduction in the Bacteroides-Prevotella group following hospitalization. Reductions in bifidobacteria,Desulfovibrio spp.,Clostridium clostridiiforme, and Faecalibacterium prausnitzii were also found in the hospitalized patients. However, total 16S rRNA gene copy numbers (per gram of wet weight of feces) were generally lower in the stool samples of the two groups of hospitalized patients compared to the number in the stool samples of elderly volunteers living in the community, so the relative abundance (percentage of the group- and species-specific rRNA gene copies in relation to total bacterial rRNA gene copies) of bifidobacteria,Desulfovibrio spp.,C. clostridiiforme, and F. prausnitzii did not change. Antibiotic treatment resulted in further reductions in the numbers of bacteria and their prevalence and, in some patients, complete elimination of certain bacterial communities. Conversely, the numbers of enterobacteria increased in the hospitalized patients who did not receive antibiotics, and due to profound changes in fecal microbiotas during antibiotic treatment, the opportunistic species Enterococcus faecalis proliferated.

The claims and statistics of this paper haven’t been checked yet.

Run the check — free, no account needed. It reads the open-access text and checks the sources it cites.

Integrity signals

Registry

Crossref · 10.1128/aem.70.6.3575-3581.2004

Cites

51 of 51 references verified0 citation errors · 0 not checkable

Statistics

Claims the paper makes

The claims and statistics of this paper haven’t been checked yet.

Run the check — free, no account needed. It reads the open-access text and checks the sources it cites.

Claims other papers make about this one

Each is checked against this paper’s own text: does it say what the citing paper says it does?

Self-check

Percentages, sums and reported differences re-computed from the paper’s own numbers.

The self-check needs the paper’s full text.

Bergey's Manual of Systematic Bacteriology
(1990) · Annals of Internal Medicine · doi:10.7326/0003-4819-112-5-391_3 · Cited by 15,633
Determination of bacterial load by real-time PCR using a broad-range (universal) probe and primers set
Nadkarni, M. A., Martin, F. E., Jacques, N. A., & Hunter, N. (2002) · Microbiology · doi:10.1099/00221287-148-1-257 · Cited by 1,931
Direct analysis of genes encoding 16S rRNA from complex communities reveals many novel molecular species within the human gut
Suau, A., Bonnet, R., Sutren, M., Godon, J.-J., Gibson, G. R., Collins, M. D., & Doré, J. (1999) · Applied and Environmental Microbiology · doi:10.1128/aem.65.11.4799-4807.1999 · Cited by 1,490
The Ribosomal Database Project (RDP-II): previewing a new autoaligner that allows regular updates and the new prokaryotic taxonomy
Cole, J. R. (2003) · Nucleic Acids Research · doi:10.1093/nar/gkg039 · Cited by 1,435
Temperature Gradient Gel Electrophoresis Analysis of 16S rRNA from Human Fecal Samples Reveals Stable and Host-Specific Communities of Active Bacteria
Zoetendal, E. G., Akkermans, A. D. L., & de Vos, W. M. (1998) · Applied and Environmental Microbiology · doi:10.1128/aem.64.10.3854-3859.1998 · Cited by 1,360
rrndb: the Ribosomal RNA Operon Copy Number Database
Klappenbach, J., Saxman, P., Cole, J., & Schmidt, T. M. (2001) · Nucleic Acids Res. · doi:10.1093/nar/29.1.181 · Cited by 1,140
Quantitative fluorescence in situ hybridization of Bifidobacterium spp. with genus-specific 16S rRNA-targeted probes and its application in fecal samples
Langendijk-Genevaux, P. S., Schut, F., Jansen, G. J., Raangs, G. C., Kamphuis, G. R., Wilkinson, M. H. F., & Welling, G. W. (1995) · Applied and Environmental Microbiology · doi:10.1128/aem.61.8.3069-3075.1995 · Cited by 974
Effect of antimicrobial agents on the ecological balance of human microflora
Sullivan, Å., Edlund, C., & Nord, C. E. (2001) · The Lancet Infectious Diseases · doi:10.1016/s1473-3099(01)00066-4 · Cited by 816
Growth requirements and fermentation products of Fusobacterium prausnitzii, and a proposal to reclassify it as Faecalibacterium prausnitzii gen. nov., comb. nov
Duncan, S. H., Hold, G. L., Harmsen, H. J. M., Stewart, C. S., & Flint, H. J. (2002) · INTERNATIONAL JOURNAL OF SYSTEMATIC AND EVOLUTIONARY MICROBIOLOGY · doi:10.1099/00207713-52-6-2141 · Cited by 753
Development of 16S rRNA-Gene-Targeted Group-Specific Primers for the Detection and Identification of Predominant Bacteria in Human Feces
Matsuki, T., Watanabe, K., Fujimoto, J., Miyamoto, Y., Takada, T., Matsumoto, K., Oyaizu, H., & Tanaka, R. (2002) · Applied and Environmental Microbiology · doi:10.1128/aem.68.11.5445-5451.2002 · Cited by 663

Flagged first, then by citations

Show all 51 references

Research works printed but not linked: 2

10.1111/j.1574-6968.1991.tb04588.x · DOI
Mitsuoka, T., K. Hayakawa, and N. Kimura. 1974. Die Faekalflora bei Menschen II. Mitteilung: Die Zusammensetzung der Bifidobakterienflora der verschiedenen Altersgruppen. Zentbl. Bakteriol. Hyg. Abt. 1 Orig. A226:469-478.

Sorted by citations

Items 401–500 of 761

Assay for estimating total bacterial load: relative qPCR normalisation of bacterial load with associated clinical implications
Brukner, I. B., Longtin, Y., Oughton, M., Forgetta, V., & Dascal, A. (2015) · Diagnostic Microbiology and Infectious Disease · doi:10.1016/j.diagmicrobio.2015.04.005 · Cited by 28
Lactobacillus Pentosus Ita23 and L. Acidipiscis Ita44 Enhance Feed Conversion Efficiency and Beneficial Gut Microbiota in Broiler Chickens
Altaher, Y., Jahromi, M. F., Ebrahim, R. A., ZULKIFLI, I., & Liang, J. (2015) · Brazilian Journal of Poultry Science · doi:10.1590/1516-635x1702159-164 · Cited by 28
“…GGT TAA TCA GGA-3’ (Frahm & Obst, 2003), For Enterococcus genus F-5’- CCC TTA TTG TTA GTT GCC ATC ATT-3’ and R-5’-ACT CGT TGT ACT TCC CAT TGT-3’ (Rinttila et al., 2004) and for Enterobacter : F- 5’-CAT TGA CGT TAC CCG CAG AAG AAG C-3’ and R-5’-CTC TAC GAG ACT CAA GCT TGC-3’ (Bartosch et al., 2004).”
Background
Overview of the Microbiome Among Nurses study (Micro-N) as an example of prospective characterization of the microbiome within cohort studies
Everett, C., Li, C., Wilkinson, J. E., Nguyen, L. H., McIver, L. J., Ivey, K. L., Izard, J., Palacios, N., Eliassen, A. H., Willett, W. C., et al. (2021) · Nature Protocols · doi:10.1038/s41596-021-00519-z · Cited by 28
Colonization of Clostridium butyricum in Rats and Its Effect on Intestinal Microbial Composition
Luo, X., Kong, Q., Wang, Y., Duan, X., Wang, P., Li, C., & Huan, Y. (2021) · Microorganisms · doi:10.3390/microorganisms9081573 · Cited by 28
“1 Cbtu-1F GTGCCGCCGCTAACGCATTAAGTAT 72 213 [17] Cbtu-1R ACCATGCACCACCTGTCTTCCTGCC”
Sources and levels of copper affect liver copper profile, intestinal morphology and cecal microbiota population of broiler chickens fed wheat-soybean meal diets
Nguyen, H. T. T., Kheravii, S. K., Wu, S., Roberts, J. R., Swick, R. A., & Toghyani, M. (2022) · Scientific Reports · doi:10.1038/s41598-022-06204-9 · Cited by 31
Short-term modifications in the distal gut microbiota of weaning mice induced by a high-fat diet
Patrone, V., Ferrari, S., Lizier, M., Lucchini, F., Minuti, A., Tondelli, B., Trevisi, E., Rossi, F., & Callegari, M. L. (2012) · Microbiology · doi:10.1099/mic.0.054247-0 · Cited by 28
“Specifically, a 418 bp fragment was first amplified with Bacteroides–Prevotella groupspecific primers Bac303F/708R as described by Bartosch et al. (2004). Two microlitres of the 1 : 100-diluted first PCR product was used as template in the second PCR with Hda1-GC/Hda2 primers to generate products suitable for DGGE.”
MethodInfluential
Geriatric Respondents and Non-Respondents to Probiotic Intervention Can be Differentiated by Inherent Gut Microbiome Composition
Suja Rani, S., Prajapati, J. B., Joshi, C. G., Sreeja, V., Gohel, M. K., Trivedi, S. S., Patel, R., Pandya, H. V., Singh, U. S., Phatak, A. G., et al. (2015) · Frontiers in Microbiology · doi:10.3389/fmicb.2015.00944 · Cited by 29
“The gut microbiota composition changes with age due to physiological reasons and increased use of medications (Bartosch et al., 2004; Mueller et al., 2006;Mariat et al., 2009; Zwielehner et al., 2009).”
Background
Characterization of Enterococcus Isolates Colonizing the Intestinal Tract of Intensive Care Unit Patients Receiving Selective Digestive Decontamination
Gonzalez, T. D. J. B., Pham, P., Top, J., Willems, R. J. L., van Schaik, W., van Passel, M. W. J., & Smidt, H. (2017) · Frontiers in Microbiology · doi:10.3389/fmicb.2017.01596 · Cited by 27
“This is in line with previous studies based on qPCR analyses that showed that the enterococcal population increased in hospitalized patients receiving antibiotics compared to hospitalized patients without antibiotics and healthy volunteers (Bartosch et al., 2004).”
Potential of Fructooligosaccharides and Xylooligosaccharides as Substrates To Counteract the Undesirable Effects of Several Antibiotics on Elder Fecal Microbiota: A First in Vitro Approach
Míguez, B., Gómez, B., Parajó, J. C., & Alonsó, J. L. (2018) · Journal of Agricultural and Food Chemistry · doi:10.1021/acs.jafc.8b02940 · Cited by 28
Safety and probiotic evaluation of two Bacillus strains producing antioxidant compounds
Kotowicz, N. K., Bhardwaj, R. K., Ferreira, W. T., Hong, H. A., Olender, A., Ramirez, J., & Cutting, S. M. (2019) · Beneficial Microbes · doi:10.3920/bm2019.0040 · Cited by 28
Antioxidant activity of selenium-enriched Chrysomyia megacephala (Fabricius) larvae powder and its impact on intestinal microflora in D-galactose induced aging mice
Xie, D., Jiang, L., Lin, Y., & Liu, Z. (2020) · BMC Complementary Medicine and Therapies · doi:10.1186/s12906-020-03058-4 · Cited by 28
“Gut microbes do not age per se, but the incidences of comorbidities associated with gut microbiota tend to increase as the host grows older [40, 41]; even though it remains unclear whether microbiota alterations are cause or consequence of host aging.”
Background
Chlorination effects on DNA based characterization of water microbiomes and implications for the interpretation of data from disinfected systems
Acharya, K., Halla, F. F., Massawa, S. M., Mgana, S. M., Komar, T., Davenport, R. J., & Werner, D. (2020) · Journal of Environmental Management · doi:10.1016/j.jenvman.2020.111319 · Cited by 27
Florfenicol Enhances Colonization of a Salmonella enterica Serovar Enteritidis floR Mutant with Major Alterations to the Intestinal Microbiota and Metabolome in Neonatal Chickens
Mei, X., Ma, B., Zhai, X., Zhang, A., Lei, C., Zuo, L., Yang, X., Zhou, C., & Wang, H. (2021) · Applied and Environmental Microbiology · doi:10.1128/aem.01681-21 · Cited by 27
Intestinal bacterial population of healthy rats during the administration of chitosan and chitooligosaccharides
Koppova, I., Bureš, M., & Šimůnek, J. (2012) · Folia Microbiologica · doi:10.1007/s12223-012-0129-2 · Cited by 27
“Quantification of selected microbiota by real-time PCR Real-time PCR was used for the quantification of the population of total bacteria, Bacteroides (changes were observed in the DGGE profile), for Lactobacillus and Bifidobacterium (because of their beneficial effect on human and animal gastrointestinal tracts), the…”
BackgroundMethodInfluential
Human microbiome versus food-borne pathogens: friend or foe
Josephs‐Spaulding, J., Beeler, E., & Singh, O. V. (2016) · Applied Microbiology and Biotechnology · doi:10.1007/s00253-016-7523-7 · Cited by 27
“…was isolated from fecal slurry and amplified utilizing real-time PCR to quantify amounts, revealing that microorganism Bifidobacterium was only detected in 71 % of hospitalized patients receiving some sort of antibiotic treatment (n = 21) corresponding to healthy subjects (Bartosch et al. 2004).”
An early feeding regime and a high-density amino acid diet on growth performance of broilers under subclinical necrotic enteritis challenge
Keerqin, C., Wu, S., Svihus, B., Swick, R. A., Morgan, N. K., & Choct, M. (2017) · Animal nutrition · doi:10.1016/j.aninu.2017.01.002 · Cited by 27
“The annealing primers involved were maintained at a concentration of 300 nm (total bacteria: 50-CGG YCC AGA CTC CTA CGG G-30 and 50- TTA CCG CGG CTG CTG GCA C-30; Lactobacillus: 50-CAC CGC TAC ACA TGG AG-30 and 50-AGC AGT AGG GAA TCT TCC A-30; Enterobacteria: 50-CAT TGA CGT TAC CCG CAG AAG-30 and 50-CTC TAC GAG ACT CA…”
BackgroundInfluential
Differences in the digestive enzyme activity, intestinal mucosa and microbial community in loach cultivated in two separate environments
Yang, S. Y., Du, J., Duan, Y., Xiao, Q., Li, N., Lin, Q., Zhao, L.-L., Du, Z., Zhou, J. T., & Du, J. C. (2018) · BMC Microbiology · doi:10.1186/s12866-018-1237-1 · Cited by 27
Infant Gut Microbiota: Developmental Influences and Health Outcomes
Martin, M. A., & Sela, D. A. (2012) · Springer eBooks · doi:10.1007/978-1-4614-4060-4_11 · Cited by 27
A randomized, double-blind, placebo-controlled, single and multiple ascending dose Phase 1 study to determine the safety, pharmacokinetics and food and faecal microbiome effects of ibezapolstat administered orally to healthy subjects
Garey, K. W., Begum, K., Lancaster, C. K., Gonzales-Luna, A. J., Bui, D., Mercier, J., Yue, C. S., Ducharme, M. P., Hu, M., Vince, B. D., et al. (2020) · Journal of Antimicrobial Chemotherapy · doi:10.1093/jac/dkaa364 · Cited by 26
Intractable Constipation in the Elderly
Baffy, N. J., Foxx–Orenstein, A. E., Harris, L. A., & Sterler, S. M. (2017) · Current Treatment Options in Gastroenterology · doi:10.1007/s11938-017-0142-2 · Cited by 25
Review on the Alteration of Gut Microbiota: The Role of HIV Infection and Old Age
Ashuro, A. A., Lobie, T. A., Ye, D., Leng, R., Li, B., Pan, H., & Fan, Y. (2020) · AIDS Research and Human Retroviruses · doi:10.1089/aid.2019.0282 · Cited by 26
Human milk and mucosa-associated disaccharides impact on cultured infant fecal microbiota
Rubio‐del‐Campo, A., Alcántara, C., Collado, M. C., Rodríguez‐Díaz, J., & Yebra, M. J. (2020) · Scientific Reports · doi:10.1038/s41598-020-68718-4 · Cited by 26
Protective Effects and Mechanism of a Novel Probiotic Strain Ligilactobacillus salivarius YL20 against Cronobacter sakazakii-Induced Necrotizing Enterocolitis In Vitro and In Vivo
Wang, W., Geng, M., Zhu, C., Huang, L., Zhang, Y., Zhang, T., Zhao, C., Zhang, T., Du, X., & Wang, N. (2022) · Nutrients · doi:10.3390/nu14183827 · Cited by 27
“Enterobacteriaceae F ′-CATTGACGTTACCCGCAGAAGAAG R′-CTCTACGAGACTCAAGCTTGC [27]”
Rapid differentiation of bacterial species by high resolution melting curve analysis
Šimenc, J., & Potočnik, U. (2011) · Applied Biochemistry and Microbiology · doi:10.1134/s0003683811030136 · Cited by 25
Probiotic therapy alleviates hyperuricemia in C57BL/6 mouse model
Cao, T., Li, X., Mao, T., Liu, H., Zhao, Q.-X., Ding, X., Li, C., Zhang, L., & Tian, Z. (2017) · Biomedical Research-tokyo · Cited by 25
Lactobacillus plantarum BS 22 promotes gut microbial homeostasis in broiler chickens exposed to aflatoxin B1
Zeng, Y., Zeng, D., Zhang, Y., Ni, X., Wang, J., Jian, P., Zhou, Y., Li, Y., Yin, Z., Pan, K., et al. (2017) · Journal of Animal Physiology and Animal Nutrition · doi:10.1111/jpn.12766 · Cited by 25
Intake of Blueberry Fermented byLactobacillus plantarumAffects the Gut Microbiota of L-NAME Treated Rats
Xu, J., Ahrén, I. L., Prykhodko, O., Olsson, C., Ahrné, S., & Molin, G. (2013) · Evidence-based Complementary and Alternative Medicine · doi:10.1155/2013/809128 · Cited by 25
“Eco1457-F Eco1652-R CATTGACGTTACCCGCAGAAGAAGC CTCTACGAGACTCAAGCTTGC Enterobacteriaceae 195 60 [17]”
The art of targeting gut microbiota for tackling human obesity
Aguirre, M., & Venema, K. (2015) · Genes & Nutrition · doi:10.1007/s12263-015-0472-4 · Cited by 25
Potential vaginal probiotics: safety, tolerability and preliminary effectiveness
Rostok, M., Hütt, P., Rööp, T., Smidt, I., Štšepetova, J., Salumets, A., & Mändar, R. (2019) · Beneficial Microbes · doi:10.3920/bm2016.0123 · Cited by 24
Evaluation of leonardite as a feed additive on lipid metabolism and growth of weaned piglets
Dell’Anno, M., Hejna, M., Sotira, S., Caprarulo, V., Reggi, S., Pilu, R., Miragoli, F., Callegari, M. L., Panseri, S., & Rossi, L. (2020) · Animal Feed Science and Technology · doi:10.1016/j.anifeedsci.2020.114519 · Cited by 24
“The increased A/G ratio was a consequence of the higher albumin value, however no significant difference was observed for the globulin content, whose increase is often related to an inflammatory process (Bertoni et al., 2008).”
Background
Buffered formic acid and a monoglyceride blend coordinately alleviate subclinical necrotic enteritis impact in broiler chickens
Gharib-Naseri, K., Kheravii, S. K., Li, L., & Wu, S. (2021) · Poultry Science · doi:10.1016/j.psj.2021.101214 · Cited by 25
The Neonatal Intestinal Microbial Flora, Immunity, and Infections
Townsend, S. M., & Forsythe, S. J. (2014) · ASM Press eBooks · doi:10.1128/9781555815608.ch3 · Cited by 24
Wheat and barley differently affect porcine intestinal microbiota
Weiss, E., Aumiller, T., Spindler, H. K., Rosenfelder, P., Eklund, M., Witzig, M., Jørgensen, H. J. H., Knudsen, K. E. B., & Mosenthin, R. (2015) · Journal of the Science of Food and Agriculture · doi:10.1002/jsfa.7340 · Cited by 24
The Effect of Probiotic Treatment on Patients Infected with the H7N9 Influenza Virus
Hu, X., Zhang, H., Lu, H., Qian, G., Lv, L., Zhang, C., Guo, J., Jiang, H., Zheng, B., Yang, F., et al. (2016) · PLoS ONE · doi:10.1371/journal.pone.0151976 · Cited by 24
“Following fecal sampling, DNA was extracted using a DNA extraction stool kit (Qiagen, Hilden, Germany) with a modified protocol for cell lysis [17].”
Method
High level bacterial contamination of secondary school students’ mobile phones
Kõljalg, S., Mändar, R., Sõber, T., Rööp, T., & Mändar, R. (2017) · GERMS · doi:10.18683/germs.2017.1111 · Cited by 26
Bacterial translocation in cirrhosis is not caused by an abnormal small bowel gut microbiota
Steed, H., Macfarlane, G. T., Blackett, K. L., Macfarlane, S., Miller, M. H., Bahrami, B., & Dillon, J. F. (2011) · FEMS Immunology & Medical Microbiology · doi:10.1111/j.1574-695x.2011.00857.x · Cited by 24
Self-citation
Development and Assessment of a Real-Time PCR Assay for Rapid and Sensitive Detection of a Novel Thermotolerant Bacterium, Lactobacillus thermotolerans , in Chicken Feces
Selim, A., Boonkumklao, P., Sone, T., Assavanig, A., Wada, M., & Yokota, A. (2005) · Applied and Environmental Microbiology · doi:10.1128/aem.71.8.4214-4219.2005 · Cited by 24
“Real-time PCR has already been established as a promising tool for studies of the composition of microbial communities in the gastrointestinal tract or feces of humans (1, 4, 5, 12), as well as chickens (13).”
Method
Consumption of an acid protease derived from Aspergillus oryzae causes bifidogenic effect in rats
Yang, Y., Iwamoto, A., Kumrungsee, T., Okazaki, Y., Kuroda, M., Yamaguchi, S., & Katô, N. (2017) · Nutrition Research · doi:10.1016/j.nutres.2017.06.004 · Cited by 23
Effects of Antibiotic Treatment with Piperacillin/Tazobactam versus Ceftriaxone on the Composition of the Murine Gut Microbiota
Venturini, C., Bowring, B. G., Fajardo-Lubian, A., Devine, C., & Iredell, J. R. (2020) · Antimicrobial Agents and Chemotherapy · doi:10.1128/aac.01504-20 · Cited by 23
“The effects of antibiotic treatment vary in terms of both antibiotic resistance transfer and collateral damage to bystander gut microflora depending on the drug used (14, 25, 26).”
Method
Guar gum as galactomannan source induces dysbiosis and reduces performance in broiler chickens and dietary β-mannanase restores the gut homeostasis
de Souza, M., Eeckhaut, V., Goossens, E., Ducatelle, R., Nieuwerburgh, F. V., Poulsen, K., Baptista, A. A. S., Bracarense, A. P. F. R. L., & Immerseel, F. V. (2023) · Poultry Science · doi:10.1016/j.psj.2023.102810 · Cited by 23
Selection of potential probiotic bifidobacteria and prebiotics for elderly by using in vitro faecal batch cultures
Valdés, L., Salazar, N., González, S., Arboleya, S., Ríos-Covián, D., Genovés, S., Ramón, D., Reyes‐Gavilán, C. G. D. L., Ruas‐Madiedo, P., & Gueimonde, M. (2016) · European Food Research and Technology · doi:10.1007/s00217-016-2732-y · Cited by 23
Intestinal microbiota of broilers submitted to feeding restriction and its relationship to hepatic metabolism and fat mass: Fast‐growing strain
Lunedo, R., Furlan, L. R., Alarcon, M. F. F., Squassoni, G. H., Campos, D. M. B., Perondi, D., & Macari, M. (2019) · Journal of Animal Physiology and Animal Nutrition · doi:10.1111/jpn.13093 · Cited by 23
Maternal Fucosyltransferase 2 Status Associates with the Profiles of Human Milk Oligosaccharides and the Fecal Microbiota Composition of Breastfed Infants
Fan, L., Yan, J., Wang, X., Wang, C., Chen, L., Li, Y., Chen, J., & Guo, H. (2021) · Journal of Agricultural and Food Chemistry · doi:10.1021/acs.jafc.0c04575 · Cited by 22
Are Fecal Metabolome and Microbiota Profiles Correlated with Autism Severity? A Cross-Sectional Study on ASD Preschoolers
Laghi, L., Mastromarino, P., Prosperi, M., Morales, M. A., Calderoni, S., Santocchi, E., Muratori, F., & Guiducci, L. (2021) · Metabolites · doi:10.3390/metabo11100654 · Cited by 22
Mechanistic Study of Coffee Effects on Gut Microbiota and Motility in Rats
Hegde, S., Shi, D. W., Johnson, J. C., Geesala, R., Zhang, K., Lin, Y.-M., & Shi, X.-Z. P. (2022) · Nutrients · doi:10.3390/nu14224877 · Cited by 22
“Enterobacteriaceae: Eco1457F–CATTGACGTTACCCG CAGAAGAAGC, Eco1652R–CTCTACGAGACTCAAGCTTGC (Tm = 61 ◦C) [33]; Gamma proteobacteria: Gamma395f–CCATGCCGCGTGTGTGAA, Gamma871r-ACTCCCCAGGCG GTCTACTTA (Tm = 56 ◦C) [34]; Lactobacillus: F_alllact_IS–TGGATGCCTTGGCACTAGGA, R_alllact_IS–AAATCTCCGGATCAAAGCTTACTTAT (Tm = 58 ◦C) [35];…”
In vitro anaerobic biofilms of human colonic microbiota
Sproule-Willoughby, K. M., Stanton, M. M., Rioux, K. P., McKay, D. M., Buret, A. G., & Ceri, H. (2010) · Journal of Microbiological Methods · doi:10.1016/j.mimet.2010.09.020 · Cited by 22
Efficient methods for prediction of velocity fields in open channel junctions based on the artifical neural network
Zaji, A. H., & Bonakdari, H. (2015) · Engineering Applications of Computational Fluid Mechanics · doi:10.1080/19942060.2015.1004821 · Cited by 22
Mast cell deficiency exacerbates inflammatory bowel symptoms in interleukin-10-deficient mice.
Zhang, H., Xue, Y., Wang, H., Huang, Y., Du, ‬., Yang, Q., & Zhu, M. J. (2014) · PubMed Central · doi:10.3748/wjg.v20.i27.9106 · Cited by 22
In vitro fermentation of copra meal hydrolysate by chicken microbiota
Prayoonthien, P., Nitisinprasert, S., & Keawsompong, S. (2017) · 3 Biotech · doi:10.1007/s13205-017-1058-1 · Cited by 23
Ileum terminal antibiotic infusion affects jejunal and colonic specific microbial population and immune status in growing pigs
Zhang, C., Peng, Y., Mu, C., & Zhu, W. (2018) · Journal of Animal Science and Biotechnology/Journal of animal science and biotechnology · doi:10.1186/s40104-018-0265-x · Cited by 22
Supplementary Materials and Methods
Groenendijk, F. H., Zwart, W. T., Floore, A. N., Akbari, S., & Bernards, R. (2013) · Cited by 22
The Role of Gut Microbiota in Modulating Cancer Therapy Efficacy
Madkour, M. A., Altaf, R. A., Sayed, Z. S., Yasen, N. S., Elbary, H. A., Elsayed, R. A., Mohamed, E. N., Toema, M., Wadan, A.-H. S., Nafady, M. H., et al. (2024) · Advanced Gut & Microbiome Research · doi:10.1155/2024/9919868 · Cited by 24
Impact of Surotomycin on the Gut Microbiota of Healthy Volunteers in a Phase 1 Clinical Trial
Citron, D. M., Tyrrell, K. L., Dale, S. E., Chesnel, L., & Goldstein, E. J. C. (2016) · Antimicrobial Agents and Chemotherapy · doi:10.1128/aac.02531-15 · Cited by 22
Regulation of plasma lipid profile by lactobacillus fermentum (probiotic strain ME-3 DSM14241) in a randomised controlled trial of clinically healthy adults
Mikelsaar, M., Sepp, E., Štšepetova, J., Hütt, P., Zilmer, K., Kullisaar, T., & Zilmer, M. (2015) · BMC Nutrition · doi:10.1186/s40795-015-0020-z · Cited by 21
“Plasmids were purified with a MaxiPrep kit (Qiagen), and then, serially diluted, and finally, measured in a spectrophotometric analysis (QuibitTM, Invitrogen) [28].”
Method
Diversity and temporal stability of fecal bacterial populations in elderly subjects consuming galacto-oligosaccharide containing probiotic yoghurt
Maukonen, J., Mättö, J., Kajander, K., Mattila, T., & Saarela, M. (2007) · International Dairy Journal · doi:10.1016/j.idairyj.2007.10.003 · Cited by 21
Beneficial effects of protease preparations derived from Aspergillus on the colonic luminal environment in rats consuming a high-fat diet
Yang, Y., Sitanggang, N. V., Katô, N., Inoue, J., Murakami, T., Watanabe, T., Iguchi, T., & Okazaki, Y. (2015) · Biomedical Reports · doi:10.3892/br.2015.490 · Cited by 21
Oral Administration of Live Exopolysaccharide-Producing Pediococcus parvulus, but Not Purified Exopolysaccharide, Suppressed Enterobacteriaceae without Affecting Bacterial Diversity in Ceca of Mice
Lindström, C., Xu, J., Öste, R., Holst, O., & Molin, G. (2013) · Applied and Environmental Microbiology · doi:10.1128/aem.01456-13 · Cited by 21
Fecal microbiome alterations in pediatric patients with short bowel syndrome receiving a rotating cycle of gastrointestinal prophylactic antibiotics
Phyo, L. Y., Singkhamanan, K., Laochareonsuk, W., Surachat, K., Phutong, N., Boonsanit, K., Chiengkriwate, P., & Sangkhathat, S. (2021) · Pediatric Surgery International · doi:10.1007/s00383-021-04948-5 · Cited by 20
Alteration of indicator gut microbiota in patients with chronic sinusitis
Michalik, M., Podbielska‐Kubera, A., Basińska-Szafrańska, A., Szewc, M., Gałęcka, M., & Schwiertz, A. (2023) · Immunity Inflammation and Disease · doi:10.1002/iid3.996 · Cited by 19
Effects of ewe’s milk yogurt (whole and semi-skimmed) and cow’s milk yogurt on inflammation markers and gut microbiota of subjects with borderline-high plasma cholesterol levels: a crossover study
Redondo, N., García-González, N., Díaz, L. E., Olmedilla‐Alonso, B., Martín‐Diana, A. B., Asensio‐Vegas, C., & Nova, E. (2018) · European Journal of Nutrition · doi:10.1007/s00394-018-1626-0 · Cited by 20
Non-starch polysaccharide-degrading enzymes may improve performance when included in wheat- but not maize-based diets fed to broiler chickens under subclinical necrotic enteritis challenge
Kim, E., Moss, A. F., Morgan, N. K., Gharib-Naseri, K., Ader, P., & Choct, M. (2022) · Animal nutrition · doi:10.1016/j.aninu.2022.01.009 · Cited by 19
Abundance of the species Clostridium butyricum in the gut microbiota contributes to differences in obesity phenotype in outbred Sprague-Dawley CD rats
Obanda, D. N., Husseneder, C., Raggio, A. M., Page, R. C., Marx, B. D., Stout, R. W., Guice, J. L., Coulon, D. B., & Keenan, M. J. (2020) · Nutrition · doi:10.1016/j.nut.2020.110893 · Cited by 19
Levels of Predominant Intestinal Microorganisms in 1 Month-Old Full-Term Babies and Weight Gain during the First Year of Life
González, S., Selma‐Royo, M., Arboleya, S., Martínez‐Costa, C., Sánchez, G. S., Suárez, M., Fernández, N., Reyes‐Gavilán, C. G. D. L., Coto, S. D., Martínez‐Camblor, P., et al. (2021) · Nutrients · doi:10.3390/nu13072412 · Cited by 19
“Enterobacteriaceae family F-CATTGACGTTACCCGCAGAAGAAGC R-CTCTACGAGACTCAAGCTTGC 63 ◦C [28]”
The Use of Gut Microbial Modulation Strategies as Interventional Strategies for Ageing
Siddiqui, R., Mungroo, M. R., Alharbi, A. M., Alfahemi, H. H., & Khan, N. A. (2022) · Microorganisms · doi:10.3390/microorganisms10091869 · Cited by 19
Increasing fat content from 20 to 45 wt% in a complex diet induces lower endotoxemia in parallel with an increased number of intestinal goblet cells in mice
Benoit, B., Laugerette, F., Plaisancié, P., Géloën, A., Bodennec, J., Estienne, M., Pineau, G., Bernalier‐Donadille, A., Vidal, H., & Michalski, M. (2015) · Nutrition Research · doi:10.1016/j.nutres.2015.01.005 · Cited by 21
“[28] Bartosch S, Fite A, Macfarlane GT, McMurdo ME.”
BackgroundMethod
Animals and Humans as Sources of Fecal Indicator Bacteria
Yost, C. K., Diarra, M. S., & Topp, E. (2014) · ASM Press eBooks · doi:10.1128/9781555816865.ch4 · Cited by 18
Assessing the gut microbiota composition in older adults: connections to physical activity and healthy ageing
Ramos, C., Magistro, D., Walton, G., Whitham, A., Camp, N., Poveda, C. G., Gibson, G. R., Hough, J., Kinnear, W., & Hunter, K. A. (2025) · GeroScience · doi:10.1007/s11357-025-01605-w · Cited by 21
A Microencapsulated Mixture of Eugenol and Garlic Tincture Supplementation Mitigates the Effect of Necrotic Enteritis on Intestinal Integrity and Increases Goblet Cells in Broilers
Kumar, A., Kheravii, S. K., Ionescu, C., Blanchard, A., Barekatain, R., Bajagai, Y. S., & Wu, S. (2021) · Microorganisms · doi:10.3390/microorganisms9071451 · Cited by 18
Microbiota intestinal y enfermedades inflamatorias del intestino
Guarner, F. (2011) · Gastroenterología y Hepatología · doi:10.1016/j.gastrohep.2010.11.009 · Cited by 18
Immunoprotective Effects of Probiotics in the Elderly
Marx, T. K. (2015) · Elsevier eBooks · doi:10.1016/b978-0-12-418680-4.00035-x · Cited by 18
The effect of Lactobacillus fermentum ME-3 on the intestinal microbiota and urine polyamines content: A double-blind placebo-controlled pilot trial
Sepp, E., Smidt, I., Štšepetova, J., Rööp, T., Hütt, P., Rätsep, M., & Mikelsaar, M. (2018) · Journal of Functional Foods · doi:10.1016/j.jff.2018.04.053 · Cited by 18
Characterization of gut dominant microbiota in obese patients with nonalcoholic fatty liver disease
Jin, L.-T., & Xu, M.-Z. (2023) · Frontiers in Cellular and Infection Microbiology · doi:10.3389/fcimb.2023.1113643 · Cited by 18
“, 2013), Bac-F (5’-GAAGGTCCCCCACATTG-3’), Bac-R (5’CAATCGGAGTTCTTCGTG-3’), Enco-F (5’-AACCTACCC ATCAGAGGG-3’), Enco-R (5’-GACGTTCAGTTACTAACG-3’), PfraF (5’-GATGGCCTCGCGTCCGATTAG-3’), Pfra-R (5’-CCGAAGACC TTCTTCCTCC-3’), Bif-F (5’-GGGTGGTATGCCGGATGTAA-3’), BifR (5’-GCCATGGACTTTCACACC-3’) (Bartosch et al., 2004), Clos-F…”
A short-oligonucleotide microarray that allows improved detection of gastrointestinal tract microbial communities
Harrington, C. R., Lucchini, S., Ridgway, K. P., Wegmann, U., Eaton, T. J., Hinton, J. C. D., Gasson, M. J., & Narbad, A. (2008) · BMC Microbiology · doi:10.1186/1471-2180-8-195 · Cited by 18
“One area where the coverage could be improved is in the detection of bacteria such as Porphyromonas and Prevotella, which were barely recorded in this study compared to previous findings [ 43 ].”
Rearing conditions affected responses of weaned pigs to organic acids showing a positive effect on digestibility, microflora and immunity
Wang, Y., Kuang, Y., Zhang, Y., Song, Y., Zhang, X., Lin, Y., Che, L., Xu, S., Wu, D., Xue, B., et al. (2016) · Animal Science Journal · doi:10.1111/asj.12544 · Cited by 18
Fecal Bifidobacterium Levels in Elderly Nursing Home Patients: Are Levels as Expected?
Gueimonde, M., Ouwehand, A., Pitkälä, K., Strandberg, T., Finne-Soveri, H., & Salminen, S. (2010) · Bioscience and Microflora · doi:10.12938/bifidus.29.111 · Cited by 17
The gut microbiome: an emerging epicenter of antimicrobial resistance?
Deshpande, S. V., Sujith, S., Jobby, R., Rajasekharan, S. K., Ravichandran, V., & Solomon, A. P. (2025) · Frontiers in Microbiology · doi:10.3389/fmicb.2025.1593065 · Cited by 19
Association between diet and fecal microbiota along the first year of life
Gómez‐Martín, M., Saturio, S., Arboleya, S., Herrero-Morín, D., Calzón, M., López, T., González, S., & Gueimonde, M. (2022) · Food Research International · doi:10.1016/j.foodres.2022.111994 · Cited by 20
Exploratory studies of oral and fecal microbiome in healthy human aging
Zhou, X., Wang, B., Demkowicz, P. C., Johnson, J. S., Chen, Y., Spakowicz, D. J., Zhou, Y., Dorsett, Y., Chen, L., Sodergren, E. J., et al. (2022) · Frontiers in Aging · doi:10.3389/fragi.2022.1002405 · Cited by 18
“Additionally, the genus Bacteroides is dominant among the young cohort-related to the microbiome of stool samples, which is consistent with several previous reports (Bartosch et al., 2004; Woodmansey et al., 2004; van Tongeren et al., 2005).”
BackgroundResultInfluential
Valuable effects of lactobacillus and citicoline on steatohepatitis: role of Nrf2/HO-1 and gut microbiota
El-Baz, A. M., El-Ganiny, A. M., Hellal, D., Anwer, H. M., El-Aziz, H. A. A., Tharwat, I. E., El-Adawy, M. A., Helal, S. E.-D. M., Mohamed, M. T. A., Azb, T. M., et al. (2023) · AMB Express · doi:10.1186/s13568-023-01561-8 · Cited by 17
“F CGGTACCTGACTAAGAAGC 50 429 (Bartosch et al. 2004)R AGTTTGATTCTTGCGAACG Lactobacillus spp.”
Analysis of the intestinal bacterial microbiota in maize- or sorghum-fed broiler chickens using real-time PCR
Lunedo, R., Alarcon, M. F. F., Carvalho, F. M. S., Furlan, L. R., & Macari, M. (2014) · British Poultry Science · doi:10.1080/00071668.2014.975781 · Cited by 17
“…in a given group can drastically affect the average number of gene copies: (i) the relatively constant 16 S gene copy number in each bacteria group; and (ii) the existing primer validation for several taxa (Walter et al., 2001; Heilig et al., 2002; Bartosch et al., 2004; Rinttila et al., 2004).”
Background
A comparison of microbial profiles of different regions of the equine hindgut
Fliegerova, K. O., Mura, E., Mrázek, J., & Moniello, G. (2016) · Livestock Science · doi:10.1016/j.livsci.2016.05.015 · Cited by 19
Effects of enzymatic treatment and shell content of palm kernel expeller meal on performance, nutrient digestibility, and ileal bacterial population in broiler chickens
Navidshad, B., Liang, J. B., Jahromi, M. F., Akhlaghi, A., & Abdullah, N. (2016) · The Journal of Applied Poultry Research · doi:10.3382/japr/pfw029 · Cited by 17
Removal of faecal indicator pathogens from waters and wastewaters by photoelectrocatalytic oxidation on TiO2/Ti films under simulated solar radiation
Venieri, D., Chatzisymeon, E., Sofianos, S. S., Politi, E., Xekoukoulotakis, N. P., Katsaounis, A. D., & Mantzavinos, D. (2012) · Environmental Science and Pollution Research · doi:10.1007/s11356-012-0768-5 · Cited by 17
“2.5 Real-time PCR method The primer set for E. faecalis detection and quantification was designed on the basis of 16S rRNA gene sequences available from the GenBank database and according to Bartosch et al. (2004).”
Influential
Effect of Bifidobacterium thermophilum RBL67 and fructo-oligosaccharides on the gut microbiota in Göttingen minipigs
Tanner, S. A., Lacroix, C., Del’Homme, C., Jans, C., Zihler, A., Bernalier‐Donadille, A., & Chassard, C. (2015) · British Journal Of Nutrition · doi:10.1017/s0007114515002263 · Cited by 19
Effect of feeding level on the composition of the intestinal microbiota in weaned piglets1
Rist, V. T. S., Eklund, M., Bauer, E., Sauer, N., & Mosenthin, R. (2012) · Journal of Animal Science · doi:10.2527/jas.52642 · Cited by 17
“2Corresponding author: rainer.mosenthin@uni-hohenheim.de Enterobacteriaceae, and Bacteroides–Prevotella– Porphyromonas group (Bacteroides group) of feces and ileal digesta were determined by use of real-time PCR.”
BackgroundInfluential
Effect of canola meal inclusion as a major protein source in gestation and lactation sow diets with or without enzymes on reproductive performance, milk composition, fecal bacterial profile and nutrient digestibility
Velayudhan, D. E., Hossain, M. M., Regassa, A., & Nyachoti, C. M. (2018) · Animal Feed Science and Technology · doi:10.1016/j.anifeedsci.2018.05.001 · Cited by 16
Effect of nanoemulsion loading finger citron (Citrus medica L. var. Sarcodactylis) essential oil on human gut microbiota
Liu, W., Li, Z., Yang, K., Sun, P., & Cai, M. (2021) · Journal of Functional Foods · doi:10.1016/j.jff.2020.104336 · Cited by 16
Short-Chain Fatty Acids Alleviate Vancomycin-Caused Humoral Immunity Attenuation in Rabies-Vaccinated Mice by Promoting the Generation of Plasma Cells via Akt-mTOR Pathway
Wu, Q. D., Zhang, Y., Wang, C., Hou, Y., He, W., Wang, L., Xiong, J., Ren, Z., Wang, H., Sui, B., et al. (2023) · Journal of Virology · doi:10.1128/jvi.00656-23 · Cited by 16
“butyricum (79) in stools were performed by quantitative real-time (qPCR).”
Antibiotic-associated changes in Akkermansia muciniphila alter its effects on host metabolic health
Han, Y., Teng, T. M., Han, J., & Kim, H. S. (2025) · Microbiome · doi:10.1186/s40168-024-02023-4 · Cited by 22
Effects of genetically modified T2A‐1 rice on faecal microflora of rats during 90 day supplementation
Yuan, Y., Xu, W., Luo, Y., Liu, H., Lü, J., Su, C., & Huang, K. (2011) · Journal of the Science of Food and Agriculture · doi:10.1002/jsfa.4421 · Cited by 16
Antioxidative Effects of Phenolic Compounds of Mushroom Mycelia in Simulated Regions of the Human Colon, In Vitro Study
Vamanu, E., Pelinescu, D. R., & Avram, I. (2017) · Polish Journal of Food and Nutrition Sciences · doi:10.1515/pjfns-2017-0010 · Cited by 16
Bacterial species to be considered in quality assurance of mice and rats
Hansen, A. K., Nielsen, D. S., Krych, Ł., & Hansen, C. H. F. (2019) · Laboratory Animals · doi:10.1177/0023677219834324 · Cited by 16
Influence of Trans-anethole on the nutrient digestibility and intestinal barrier function in broilers
Yu, C., Zhang, J., Zhang, H., Chen, Y., Wang, C., Zhang, L., Ding, L., Wang, T. Z., & Yang, Z. (2021) · Poultry Science · doi:10.1016/j.psj.2021.101489 · Cited by 16
Quantitative Polymerase Chain Reaction-based Analyses of Murine Intestinal Microbiota After Oral Antibiotic Treatment
Jimeno, R., Brailey, P. M., & Barral, P. (2018) · Journal of Visualized Experiments · doi:10.3791/58481-v · Cited by 16
The Intestinal Microbiota and Probiotics
Forssten, S. D., Lahtinen, S. J., & Ouwehand, A. C. (2011) · Springer eBooks · doi:10.1007/978-94-007-0386-5_2 · Cited by 16
“The microbiota responds to physiological, dietary, and environmental factors (Bartosch et al. 2004), and the response has an effect on the diversity and the individuality of the intestinal microbiota.”
Background
Effect of the corn silage to grass silage ratio and feed particle size of diets for ruminants on the ruminal Bacteroides-Prevotella community in vitro
Witzig, M., Boguhn, J., Kleinsteuber, S., Fetzer, I., & Rodehutscord, M. (2010) · Anaerobe · doi:10.1016/j.anaerobe.2010.05.002 · Cited by 16
Examination of hydrogen cross-feeders using a colonic microbiota model
Smith, N. W., Shorten, P. R., Altermann, E., Roy, N. C., & McNabb, W. C. (2021) · BMC Bioinformatics · doi:10.1186/s12859-020-03923-6 · Cited by 18
Xylanase and beta-glucanase improve performance parameters and footpad dermatitis and modulate intestinal microbiota in broilers under an Eimeria challenge
Daneshmand, A., Kumar, A., Kheravii, S. K., Pasquali, G. A. M., & Wu, S. (2023) · Poultry Science · doi:10.1016/j.psj.2023.103055 · Cited by 17
Systemic inflammatory and gut microbiota responses to fracture in young and middle-aged mice
Roberts, J. L., Chiedo, B., & Drissi, H. (2023) · GeroScience · doi:10.1007/s11357-023-00963-7 · Cited by 15
Fecal Pharmacokinetics and Gut Microbiome Effects of Oral Omadacycline Versus Vancomycin in Healthy Volunteers
Jo, J., Hu, C., Begum, K., Wang, W., Le, T. M., Agyapong, S., Hanson, B., Ayele, H., Lancaster, C. K., Alam, M. J., et al. (2023) · The Journal of Infectious Diseases · doi:10.1093/infdis/jiad537 · Cited by 15
“The DNA levels of bacterial groups were assessed using specific PCR primers/ conditions as previously described [14–17].”
Method

Authors: Bartosch, S., Fite, A., Macfarlane, G. T., & McMurdo, M. E. T.
Affiliations: University of Dundee (GB)
MRC Microbiology and Gut Biology Group
Venue: Applied and Environmental Microbiology
Publisher: American Society for Microbiology
Published: 2004-06
Volume: 70
Issue: 6
Pages: 3575-3581
ISSN: 0099-2240 (ISSN-L)
1098-5336
DOI: 10.1128/aem.70.6.3575-3581.2004
PMC: PMC427772
OpenAlex: W2109744701
Cited by: 762
References: 51
Citations by year: 2026: 15 · 2025: 29 · 2024: 12 · 2023: 31 · 2022: 36 · 2021: 51 · 2020: 49 · 2019: 36 · 2018: 38 · 2017: 63 · 2016: 59 · 2015: 65 · 2014: 44 · 2013: 46 · 2012: 46
FWCI: 4.63
Type: journal article
Language: en
Open access: green
europepmc.org
Licence: journals.asm.org/non-commercial-tdm-license (tdm)
Locations: Applied and Environmental Microbiology (publishedVersion)
Europe PMC (PubMed Central) (publishedVersion)
PubMed Central (publishedVersion)
PubMed (publishedVersion)
Discovery Research Portal (University of Dundee) (submittedVersion)
Funders: Medical Research Council
Topics: Life Sciences › Biochemistry, Genetics and Molecular Biology › Molecular Biology › Gut microbiota and health
Health Sciences › Medicine › Infectious Diseases › Clostridium difficile and Clostridium perfringens research
Physical Sciences › Environmental Science › Ecology › Microbial Community Ecology and Physiology
Keywords: fecal microbiota, older adults, hospitalized patients, antibiotic therapy, Bifidobacterium, Desulfovibrio, Faecalibacterium prausnitzii, 16S rRNA gene quantification, Enterobacteriaceae, Enterococcus faecalis, intestinal bacteria, community-acquired infections
MeSH terms: Aged, Aged, 80 and over, Anti-Bacterial Agents, Bacteria, Bacterial Infections, DNA, Bacterial, DNA, Ribosomal, Feces, Hospitalization, Humans, RNA, Ribosomal, 16S, Species Specificity, Polymerase Chain Reaction, Ecosystem, DNA Primers, Gene Dosage, Genes, rRNA

About these checks

Registry, retraction, Cites and statistics results are computed, not judged, with one exception: a printed reference that no index lists is read once by a model before it counts as a citation error. Claims are extracted by a model and kept only when their quote appears verbatim in the text; each cited source is then checked, with a model’s help, for whether it says what the claim relies on. Those verdicts can be wrong — read the claim’s quote and the cited source before relying on one.

Statistics and arithmetic are recomputed, not judged.

Confidence bands are shown only for fields calibrated on our annotated test set. None is calibrated yet, so no band is shown.

What counts as a claim ›How we measure confidence ›How we check this ›

Are you an author, or do you see a problem with this page? Request a review

Characterization of Bacterial Communities in Feces from Healthy Elderly Volunteers and Hospitalized Elderly Patients by Using Real-Time PCR and Effects of Antibiotic Treatment on the Fecal Microbiota

Abstract

Overview

Integrity signals

Verification

Claims the paper makes

Claims other papers make about this one

Self-check

Citations

Cites

Cited by

Related

Metadata

Record

About these checks