Cited by 762Gut microbiota and healthClostridium difficile and Clostridium perfringens researchMicrobial Community Ecology and Physiology

The DOI matches its Crossref record; 51 of the 51 references it cites were found in a registry or an index.

Characterization of Bacterial Communities in Feces from Healthy Elderly Volunteers and Hospitalized Elderly Patients by Using Real-Time PCR and Effects of Antibiotic Treatment on the Fecal Microbiota

Open access

Bartosch, Sabine, Fite, Alemu, Macfarlane, George T., McMurdo, Marion E. T.·2004·Applied and Environmental Microbiology

DOI 10.1128/aem.70.6.3575-3581.2004PMC PMC427772

Open this paper in CoChat — free account

Abstract

Fecal bacteria were studied in healthy elderly volunteers (age, 63 to 90 years;n= 35) living in the local community, elderly hospitalized patients (age, 66 to 103;n= 38), and elderly hospitalized patients receiving antibiotic treatment (age, 65 to 100;n= 21). Group- and species-specific primer sets targeting 16S rRNA genes were used to quantitate intestinal bacteria by using DNA extracted from feces and real-time PCR. The principal difference between healthy elderly volunteers and both patient cohorts was a marked reduction in the Bacteroides-Prevotella group following hospitalization. Reductions in bifidobacteria,Desulfovibrio spp.,Clostridium clostridiiforme, and Faecalibacterium prausnitzii were also found in the hospitalized patients. However, total 16S rRNA gene copy numbers (per gram of wet weight of feces) were generally lower in the stool samples of the two groups of hospitalized patients compared to the number in the stool samples of elderly volunteers living in the community, so the relative abundance (percentage of the group- and species-specific rRNA gene copies in relation to total bacterial rRNA gene copies) of bifidobacteria,Desulfovibrio spp.,C. clostridiiforme, and F. prausnitzii did not change. Antibiotic treatment resulted in further reductions in the numbers of bacteria and their prevalence and, in some patients, complete elimination of certain bacterial communities. Conversely, the numbers of enterobacteria increased in the hospitalized patients who did not receive antibiotics, and due to profound changes in fecal microbiotas during antibiotic treatment, the opportunistic species Enterococcus faecalis proliferated.

The claims and statistics of this paper haven’t been checked yet.

Run the check — free, no account needed. It reads the open-access text and checks the sources it cites.

Integrity signals

Registry

Crossref · 10.1128/aem.70.6.3575-3581.2004

Cites

51 of 51 references verified0 citation errors · 0 not checkable

Statistics

Claims the paper makes

The claims and statistics of this paper haven’t been checked yet.

Run the check — free, no account needed. It reads the open-access text and checks the sources it cites.

Claims other papers make about this one

Each is checked against this paper’s own text: does it say what the citing paper says it does?

Self-check

Percentages, sums and reported differences re-computed from the paper’s own numbers.

The self-check needs the paper’s full text.

Bergey's Manual of Systematic Bacteriology
(1990) · Annals of Internal Medicine · doi:10.7326/0003-4819-112-5-391_3 · Cited by 15,633
Determination of bacterial load by real-time PCR using a broad-range (universal) probe and primers set
Nadkarni, M. A., Martin, F. E., Jacques, N. A., & Hunter, N. (2002) · Microbiology · doi:10.1099/00221287-148-1-257 · Cited by 1,931
Direct analysis of genes encoding 16S rRNA from complex communities reveals many novel molecular species within the human gut
Suau, A., Bonnet, R., Sutren, M., Godon, J.-J., Gibson, G. R., Collins, M. D., & Doré, J. (1999) · Applied and Environmental Microbiology · doi:10.1128/aem.65.11.4799-4807.1999 · Cited by 1,490
The Ribosomal Database Project (RDP-II): previewing a new autoaligner that allows regular updates and the new prokaryotic taxonomy
Cole, J. R. (2003) · Nucleic Acids Research · doi:10.1093/nar/gkg039 · Cited by 1,435
Temperature Gradient Gel Electrophoresis Analysis of 16S rRNA from Human Fecal Samples Reveals Stable and Host-Specific Communities of Active Bacteria
Zoetendal, E. G., Akkermans, A. D. L., & de Vos, W. M. (1998) · Applied and Environmental Microbiology · doi:10.1128/aem.64.10.3854-3859.1998 · Cited by 1,360
rrndb: the Ribosomal RNA Operon Copy Number Database
Klappenbach, J., Saxman, P., Cole, J., & Schmidt, T. M. (2001) · Nucleic Acids Res. · doi:10.1093/nar/29.1.181 · Cited by 1,140
Quantitative fluorescence in situ hybridization of Bifidobacterium spp. with genus-specific 16S rRNA-targeted probes and its application in fecal samples
Langendijk-Genevaux, P. S., Schut, F., Jansen, G. J., Raangs, G. C., Kamphuis, G. R., Wilkinson, M. H. F., & Welling, G. W. (1995) · Applied and Environmental Microbiology · doi:10.1128/aem.61.8.3069-3075.1995 · Cited by 974
Effect of antimicrobial agents on the ecological balance of human microflora
Sullivan, Å., Edlund, C., & Nord, C. E. (2001) · The Lancet Infectious Diseases · doi:10.1016/s1473-3099(01)00066-4 · Cited by 816
Growth requirements and fermentation products of Fusobacterium prausnitzii, and a proposal to reclassify it as Faecalibacterium prausnitzii gen. nov., comb. nov
Duncan, S. H., Hold, G. L., Harmsen, H. J. M., Stewart, C. S., & Flint, H. J. (2002) · INTERNATIONAL JOURNAL OF SYSTEMATIC AND EVOLUTIONARY MICROBIOLOGY · doi:10.1099/00207713-52-6-2141 · Cited by 753
Development of 16S rRNA-Gene-Targeted Group-Specific Primers for the Detection and Identification of Predominant Bacteria in Human Feces
Matsuki, T., Watanabe, K., Fujimoto, J., Miyamoto, Y., Takada, T., Matsumoto, K., Oyaizu, H., & Tanaka, R. (2002) · Applied and Environmental Microbiology · doi:10.1128/aem.68.11.5445-5451.2002 · Cited by 663

Show all 51 references

Research works printed but not linked: 2

10.1111/j.1574-6968.1991.tb04588.x · DOI
Mitsuoka, T., K. Hayakawa, and N. Kimura. 1974. Die Faekalflora bei Menschen II. Mitteilung: Die Zusammensetzung der Bifidobakterienflora der verschiedenen Altersgruppen. Zentbl. Bakteriol. Hyg. Abt. 1 Orig. A226:469-478.

Sorted by citations

Items 501–600 of 761

Long‐lasting microbial dysbiosis and altered enteric neurotransmitters in adult rats following adolescent binge ethanol exposure
Vetreno, R. P., Massey, V. L., & Crews, F. T. (2019) · Addiction Biology · doi:10.1111/adb.12869 · Cited by 15
Effect of silage juice feeding on pig production performance, meat quality and gut microbiome
Keto, L., Tsitko, I. V., Perttilä, S., Särkijärvi, S., Immonen, N., Kytölä, K., Alakomi, H., Hyytiäinen-Pabst, T., Saarela, M., & Rinne, M. (2021) · Livestock Science · doi:10.1016/j.livsci.2021.104728 · Cited by 15
Photoelectrocatalytic disinfection of water and wastewater: performance evaluation by qPCR and culture techniques
Venieri, D., Chatzisymeon, E., Politi, E., Sofianos, S. S., Katsaounis, A. D., & Mantzavinos, D. (2012) · Journal of Water and Health · doi:10.2166/wh.2012.208 · Cited by 15
Dietary soy, meat, and fish proteins modulate the effects of prebiotic raffinose on composition and fermentation of gut microbiota in rats
Bai, G., Tsuruta, T., & Nishino, N. (2017) · International Journal of Food Sciences and Nutrition · doi:10.1080/09637486.2017.1382454 · Cited by 15
“2004) and for the Enterobacteriaceae (Bartosch et al. 2004) were employed.”
BackgroundMethodInfluential
Advances in characterization of probiotics and challenges in industrial application
Ranjan, A., Arora, J., Chauhan, A. P. S., Basniwal, R. K., Kumari, A., Rajput, V. D., Prazdnova, E. V., Ghosh, A., Mukerjee, N., Манджиева, С. С., et al. (2022) · Biotechnology and Genetic Engineering Reviews · doi:10.1080/02648725.2022.2122287 · Cited by 15
“Real-time PCR is also one of the popularly used methods for the characterization of bacteria (Bartosch et al., 2004) and probiotics by amplifying the DNA in real-time (RT) using fluorescent reporter dye such e.g. SYBR® Green.”
New gene markers for classification and quantification ofFaecalibacteriumspp. in the human gut
Tanno, H., Chatel, J., Martín, R., Mariat, D., Sakamoto, M., Yamazaki, M., Salminen, S., Gueimonde, M., & Endo, A. (2023) · FEMS Microbiology Ecology · doi:10.1093/femsec/fiad035 · Cited by 16
Impact of endurance exercise and probiotic supplementation on the intestinal microbiota: a cross-over pilot study
Schmitz, L., Ferrari, N., Schwiertz, A., Rusch, K., Woestmann, U., Mahabir, E., & Gräf, C. (2019) · Pilot and Feasibility Studies · doi:10.1186/s40814-019-0459-9 · Cited by 15
Effects of Bacillus methylotrophicus SY200 Supplementation on Growth Performance, Antioxidant Status, Intestinal Morphology, and Immune Function in Broiler Chickens
Xiao, D., Wang, Z., Dai, X., Hu, Y., Zhong, M., Xiong, L., Jiang, C., Khalique, A., Ni, X., Zeng, D., et al. (2022) · Probiotics and Antimicrobial Proteins · doi:10.1007/s12602-022-09924-6 · Cited by 14
In vitro Activity on Human Gut Bacteria of Murta Leaf Extracts ( Ugni molinae turcz.), a Native Plant from Southern Chile
Shene, C., Canquil, N., Jorquera, M. A., Pinelo, M., Rubilar, M., Acevedo, F., Vergara, C., von Baer, D., & Mardones, C. (2012) · Journal of Food Science · doi:10.1111/j.1750-3841.2012.02692.x · Cited by 14
Human microbial ecology: Lactobacilli, probiotics, selective decontamination
Mikelsaar, M. (2011) · Anaerobe · doi:10.1016/j.anaerobe.2011.07.005 · Cited by 14
Quantitative Real-Time PCR Analysis of Intestinal Regular Fungal Species in Fecal Samples From Patients With Chronic Hepatitis B Virus Infection
Guo, R., Chen, Z., Chen, N., & Chen, Y. (2010) · Laboratory Medicine · doi:10.1309/lmmc0wvzxd13pujg · Cited by 14
Buserelin treatment to rats causes enteric neurodegeneration with moderate effects on CRF-immunoreactive neurons and Enterobacteriaceae in colon, and in acetylcholine-mediated permeability in ileum
Sand, E., Linninge, C., Lozinska, L. M., Egecioglu, E., Roth, B., Molin, G., Weström, B. R., Ekblad, E., & Ohlsson, B. (2015) · BMC Research Notes · doi:10.1186/s13104-015-1800-x · Cited by 14
Performance, intestinal microflora, and amino acid digestibility altered by exogenous enzymes in broilers fed wheat- or sorghum-based diets
Wu, D., Wu, S., Choct, M., & Swick, R. A. (2017) · Journal of Animal Science · doi:10.2527/jas.2016.0411 · Cited by 14
Effect of pyrroloquinoline quinone disodium in female rats during gestating and lactating on reproductive performance and the intestinal barrier functions in the progeny
Zhang, B., Yang, W., Zhang, H., He, S., Meng, Q., Chen, Z., & Shan, A. (2019) · British Journal Of Nutrition · doi:10.1017/s0007114519000047 · Cited by 14
“Primers for total eubacteria, Lactobacillus spp., Enterobacteriaceae and bi ﬁ do-bacteria spp. were designed according to previously published data (33,34) .”
A comparison between a yeast cell wall extract (Bio-Mos®) and palm kernel expeller as mannan-oligosac-charides sources on the performance and ileal microbial population of broiler chickens
Navidshad, B., Liang, J. B., Jahromi, M. F., Akhlaghi, A., & Abdullah, N. (2015) · Italian Journal of Animal Science · doi:10.4081/ijas.2015.3452 · Cited by 14
“…(Frahm and Obst, 2003) for Escherichia coli, F-5 - CCCTTATTGTTAGTTGCCATCATT-3 and R-5 - ACTCGTTGTACTTCCCATTGT-3 (Rinttila et al., 2004) for Enterococcus genus, F-5 - CATTGACGTTACCCGCAGAAGAAGC-3 and R5 -CTCTACGAGACTCAAGCTTGC-3 (Bartosch et al., 2004) for Enterobacteriaceae family.”
Potential health benefits of lowering gas production and bifidogenic effect of the blends of polydextrose with inulin in a human gut model
Zhu, L., Guo, F., Guo, Z., Chen, X., Qian, X., Li, X., Li, X., Li, J., Wang, X., & Jia, W. (2022) · Frontiers in Nutrition · doi:10.3389/fnut.2022.934621 · Cited by 13
“Total Bifidobacteria species were measured using specific primers Bifi601F: 5’-GGGTGGTAATGCCGGATG and Bifi601R: 5’-TAAGCCATGGACTTTCACACC-3’ (32).”
Method
Lactococcus lactis KA-FF 1-4 reduces vancomycin-resistant enterococci and impacts the human gut microbiome
Plupjeen, S.-N., Chawjiraphan, W., Charoensiddhi, S., Nitisinprasert, S., & Nakphaichit, M. (2020) · 3 Biotech · doi:10.1007/s13205-020-02282-6 · Cited by 13
A Comprehensive Evaluation of Enterobacteriaceae Primer Sets for Analysis of Host-Associated Microbiota
Resendiz-Nava, C. N., Silva‐Rojas, H. V., Rebollar‐Alviter, Á., Rivera-Pastrana, D. M., Mercado-Silva, E. M., & Nava, G. M. (2021) · Pathogens · doi:10.3390/pathogens11010017 · Cited by 13
“PS8 Eco1457F CATTGACGTTACCCGCAGAAGAAGC 170 476–645 [22] Eco1652R CTCTACGAGACTCAAGCTTGC”
Decreased microbial diversity and Lactobacillus group in the intestine of geriatric giant pandas (Ailuropoda melanoleuca)
Peng, Z., Zeng, D., Wang, Q., Niu, L., Ni, X., Zou, F., Yang, M., Sun, H., Zhou, Y., Liu, Q., et al. (2016) · World Journal of Microbiology and Biotechnology · doi:10.1007/s11274-016-2034-3 · Cited by 13
Microbiome analysis, the immune response and transplantation in the era of next generation sequencing
Kanangat, S., & Skaljic, I. (2021) · Human Immunology · doi:10.1016/j.humimm.2021.07.009 · Cited by 14
Characterization of the Inhabitancy of Mouse Intestinal Bacteria (MIB) in Rodents and Humans by Real‐Time PCR with Group‐Specific Primers
Kibe, R., Sakamoto, M., Yokota, H., & Benno, Y. (2007) · Microbiology and Immunology · doi:10.1111/j.1348-0421.2007.tb03916.x · Cited by 13
High frequency of false‐positive signals in a real‐time PCR‐based “Plus/Minus” assay
Nowrouzian, F. L., Adlerberth, I., & Wold, A. E. (2009) · Apmis · doi:10.1111/j.1600-0463.2008.00010.x · Cited by 13
“tion of bacterial and viral genes in biological samples (1, 2).”
Background
Analysis of Caecal Microbiota in Rats Fed with Genetically Modified Rice by Real‐Time Quantitative PCR
Xu, W., Li, L., Lu, J., Luo, Y., Shang, Y., & Huang, K. (2011) · Journal of Food Science · doi:10.1111/j.1750-3841.2010.01967.x · Cited by 13
Supplementation of reduced protein diets with l-arginine and l-citrulline for broilers challenged with subclinical necrotic enteritis. 2. Intestinal permeability, microbiota, and short-chain fatty acid production
Dao, H. T., Sharma, N. K., Barekatain, R., Kheravii, S. K., Bradbury, E. J., Wu, S., & Swick, R. A. (2022) · Animal Production Science · doi:10.1071/an21394 · Cited by 12
Gut microbial dysbiosis in the pathogenesis of leukemia: an immune-based perspective
Goswami, M., & Bose, P. D. (2024) · Experimental Hematology · doi:10.1016/j.exphem.2024.104211 · Cited by 13
Innovative unified impact of magnetite iron nanoparticles and quercetin on broiler chickens: performance, antioxidant and immune defense and controlling of Clostridium perfringens infection
Al-Nasser, A. Y., El-Demerdash, A. S., Ibrahim, D., El-Hamid, M. I. A., Al-Khalaifah, H. S., El‐Borady, O. M., Shukry, E., El-Azzouny, M. M., Ibrahim, M. S., Badr, S., et al. (2024) · Frontiers in Veterinary Science · doi:10.3389/fvets.2024.1474942 · Cited by 12
Interconnection of the Gut-Skin Axis in NC/Nga Mouse with Atopic Dermatitis: Effects of the Three Types of Bifidobacterium bifidum CBT-BF3 (Probiotics, Postbiotics, and Cytosine-Phosphate-Guanine Oligodeoxynucleotide) on T Cell Differentiation and Gut Microbiota
Kim, G. I., Jeong, H. Y., Kim, I. S., Lee, S. H., Kim, S.-H., Moon, Y. S., & Cho, K. K. (2024) · Food Science of Animal Resources · doi:10.5851/kosfa.2024.e100 · Cited by 13
Mitigating the impact of microbial pressure on great (Parus major) and blue (Cyanistes caeruleus) tit hatching success through maternal immune investment
Boonyarittichaikij, R., Verbrugghe, E., Dekeukeleire, D., Strubbe, D., Praet, S. V., Beelde, R. D., Rouffaer, L., Pasmans, F., Bonte, D., Verheyen, K., et al. (2018) · PLoS ONE · doi:10.1371/journal.pone.0204022 · Cited by 12
Effects of l -carnitine and/or maize distillers dried grains with solubles in diets of gestating and lactating sows on the intestinal barrier functions of their offspring
Wei, B., Nie, S., Meng, Q., Qu, Z., Shan, A., & Chen, Z. (2016) · British Journal Of Nutrition · doi:10.1017/s0007114516001951 · Cited by 12
Gut microbial balance and liver transplantation: alteration, management, and prediction
Tian, X., Yang, Z., Luo, F., & Zheng, S. (2017) · Frontiers of Medicine · doi:10.1007/s11684-017-0563-2 · Cited by 12
In vitro Interaction between Fumonisin B 1 and the Intestinal Microflora of Pigs
Dang, H. A., Zsolnai, A., Kovács, M., BORS, I., Bónai, A., Bóta, B., & Szabó‐Fodor, J. (2017) · Polish Journal of Microbiology · doi:10.5604/01.3001.0010.7858 · Cited by 12
Survey of Pathogen-Lowering and Immuno-Modulatory Effects Upon Treatment of Campylobacter coli-Infected Secondary Abiotic IL-10−/− Mice with the Probiotic Formulation Aviguard®
Weschka, D., Mousavi, S., Biesemeier, N., Bereswill, S., & Heimesaat, M. M. (2021) · Microorganisms · doi:10.3390/microorganisms9061127 · Cited by 11
“Bacteroides group e Bacteroides ovatus DSMZ 1896 F: GAAGGTCCCCCACATTG, R: CAATCGGAGTTCTTCGTG [44]”
Background
Gut microbiota diversity of hospitalized older adult patients with and without antibiotic-associated diarrhea
Zhao, L., Zhang, Y., Wang, Y., Qiao, H., Wang, Y., Ren, J., & Zhao, J. (2023) · Aging Clinical and Experimental Research · doi:10.1007/s40520-023-02436-5 · Cited by 12
“After antibiotic treatment in older adults, Lactobacillus [15], Bifidobacteria, and Vibrio desulfuricus decrease, but opportunistic gut bacteria proliferate [16].”
Background
Effects of γ-Polyglutamic Acid on the Cecal Microbiota and Visceral Fat in KK-Ay/TaJcl Male Mice
Tamura, M., Hoshi, C., Kimura, Y., Suzuki, T., & Maeda‐Yamamoto, M. (2018) · Food Science and Technology Research · doi:10.3136/fstr.24.151 · Cited by 11
The Novel Interplay between Commensal Gut Bacteria and Metabolites in Diet-Induced Hyperlipidemic Rats Treated with Simvastatin
Zhang, S., Lü, Y., Li, H., Han, L., Jing, W., Wu, X., Ullah, S., Liu, R., Wu, Y., & Xu, J. (2021) · Journal of Proteome Research · doi:10.1021/acs.jproteome.1c00252 · Cited by 12
Immunosenescence and the gut microbiota: The role of probiotics and prebiotics
Toward, R. E., Walton, G., & Gibson, G. R. (2012) · Nutrition and Aging · doi:10.3233/nua-130014 · Cited by 11
“lactis BL-01 (probiotics) together with an inulin-based prebiotic ⇑ bifidobacteria ⇑ lactobacilli [35]”
Background
Impact of Neonatal Antibiotic Treatment on the Biodiversity of the Murine Intestinal Lactobacillus Community
Yuan, J., Wei, H., Zeng, B., Tang, H., Li, W., & Zhang, Z. (2009) · Current Microbiology · doi:10.1007/s00284-009-9492-x · Cited by 11
“Plasmid standard for real-time PCR was prepared according to Bartosch et al. [ 2 ] and the DNA concentration was determined at 260 nm. The number of target copies was calculated by assuming that the average molecular mass for 1 bp of double-stranded DNA was 660 g/mol.”
Method
Microbiota and Mitochondrial Sex-Dependent Imbalance in Fibromyalgia: A Pilot Descriptive Study
Ramírez‐Tejero, J. A., Durán‐González, E., Martínez‐Lara, A., del Amo, L. L., Sepúlveda, I., Huancas-Díaz, A., Carvajal, M., & Cotán, D. (2023) · Neurology International · doi:10.3390/neurolint15030055 · Cited by 10
Can Supplemented Skim Milk (SKM) Boost Your Gut Health?
de Carvalho, N. M., Oliveira, D., Costa, C. M., Pintado, M., & Madureira, A. R. (2022) · Fermentation · doi:10.3390/fermentation8030126 · Cited by 10
From-Toilet-to-Freezer: A Review on Requirements for an Automatic Protocol to Collect and Store Human Fecal Samples for Research Purposes
Widjaja, F., & Rietjens, I. M. C. M. (2023) · Biomedicines · doi:10.3390/biomedicines11102658 · Cited by 12
Plasma quercetin metabolites are affected by intestinal microbiota of human microbiota-associated mice fed with a quercetin-containing diet
Tamura, M., Nakagawa, H., Hori, S., Suzuki, T., & Hirayama, K. (2019) · Journal of Clinical Biochemistry and Nutrition · doi:10.3164/jcbn.19-45 · Cited by 11
Maternal breast milk microbiota and immune markers in relation to subsequent development of celiac disease in offspring
Štšepetova, J., Simre, K., Tagoma, A., Uibo, O., Peet, A., Siljander, H., Tillmann, V., Knip, M., Mändar, R., & Uibo, R. (2022) · Scientific Reports · doi:10.1038/s41598-022-10679-x · Cited by 10
Optimistic effects of dual nano-encapsulated probiotics on breeders laying performance, intestinal barrier functions, immunity and resistance against Salmonella Typhimurium challenge
Elabbasy, M. T., Kishawy, A. T. Y., Abdelaziz, W. S., Hassan, A. A., Nada, H. S., Elbhnsawy, R. A., Shosha, A. M., Ibrahim, D., Eldemery, F., Atwa, S. A. E., et al. (2025) · Scientific Reports · doi:10.1038/s41598-025-05495-y · Cited by 10
Heavy Metal Removal Processes by Sulfate-Reducing Bacteria
Neria‐González, M. I., & Aguilar‐López, R. (2021) · Environmental and microbial biotechnology · doi:10.1007/978-981-15-5499-5_13 · Cited by 9
BdNub Is Essential for Maintaining gut Immunity and Microbiome Homeostasis in Bactrocera dorsalis
Gu, J., Zhang, P., Yao, Z., Li, X., & Zhang, H. (2023) · Insects · doi:10.3390/insects14020178 · Cited by 9
“, 2004) [23,28] 16S RNA 195 bp Ent R 5′-CTCTACGAGACTCAAGCTTGC-3′”
Background
Laboratory identification of anaerobic bacteria isolated on Clostridium difficile selective medium
Rodriguez, C., Warszawski, N., Korsak, N., Taminiau, B., Broeck, J. V., Delmée, M., & Daube, G. (2016) · Acta Microbiologica et Immunologica Hungarica · doi:10.1556/030.63.2016.2.3 · Cited by 9
Potential for Monitoring Gut Microbiota for Diagnosing Infections and Graft-versus-Host Disease in Cancer and Stem Cell Transplant Patients
Koh, A. Y. (2017) · Clinical Chemistry · doi:10.1373/clinchem.2016.259499 · Cited by 9
Do Rural Second Homes Shape Commensal Microbiota of Urban Dwellers? A Pilot Study among Urban Elderly in Finland
Saarenpää, M., Roslund, M. I., Puhakka, R., Grönroos, M., Parajuli, A., Hui, N., Nurminen, N., Laitinen, O. H., Hyöty, H., Cinek, O., et al. (2021) · International Journal of Environmental Research and Public Health · doi:10.3390/ijerph18073742 · Cited by 11
Demonstration of the cellular viability and safety ofEnterococcus faeciumCRL 183 in long-term experiments
Cano, V. S. P., Valentini, S. R., Sivieri, K., & Rossi, E. A. (2007) · Le Lait · doi:10.1051/lait:2007002 · Cited by 9
Effect of high canola meal content on growth performance, nutrient digestibility and fecal bacteria in nursery pigs fed either corn or wheat based diets
Mejicanos, G. A., Regassa, A., & Nyachoti, C. M. (2017) · Animal Feed Science and Technology · doi:10.1016/j.anifeedsci.2017.06.012 · Cited by 9
Effect of cellobiose supplementation on in vitro fermentation activity and bacterial numbers of porcine inocula
Heinritz, S. N., Weiss, E., Seifert, J., Mosenthin, R., Kuß, S., Degenhardt, A. G., & Koch, T. J. (2017) · Journal of Animal Physiology and Animal Nutrition · doi:10.1111/jpn.12770 · Cited by 9
An Evaluation Method of Human Gut Microbial Homeostasis by Testing Specific Fecal Microbiota
Wu, Z., Pan, X., Yuan, Y., Lou, P., Gordejeva, L., Ni, S., Zhu, X., Liu, B., Wu, L., Li, L., et al. (2023) · Engineering · doi:10.1016/j.eng.2023.03.007 · Cited by 8
Faecalibacterium duncaniae A2‐165 growth is strongly promoted by yeast extract and vitamin B5 in cGMP medium
Bircher, L., Sourabié, A. M., Paurevic, M., Hochuli, J., Geirnaert, A., Navas, C., Drogue, B., & Lacroix, C. (2023) · Microbial Biotechnology · doi:10.1111/1751-7915.14374 · Cited by 8
“Quantitative real-time polymerase chain reaction (qPCR) targeting the F. prausnitzii -specific 16S rRNA gene regions using the primers Fprau223F and Fprau420R (Bartosch et al., 2004) was used for cell quantification.”
Method
Effects of seaweed on blood plasma immunoglobulin concentration, mucosal immunity, small intestine histomorphology, cecal microbial population, and volatile fatty acid profile in broiler chickens
Azizi, M. N., Loh, T. C., Foo, H. L., & Izuddin, W. I. (2025) · Veterinary World · doi:10.14202/vetworld.2025.508-518 · Cited by 8
“The sequences of the targeted microbes are shown in Table 4 [19–21].”
Dynamic Population of Gut Microbiota as an Indicator of Inflammatory Bowel Disease
Salimi, A., Sepehr, A., Ajdarkosh, H., Aghamohammad, S., Talebi, M., Rohani, M., & Pourshafie, M. R. (2022) · Iranian Biomedical Journal · doi:10.52547/ibj.3772 · Cited by 8
Quantitative analysis of the three gut microbiota in UC and non-UC patients using real-time PCR
Al-Bayati, L., Fasaei, B. N., Merat, S., Bahonar, A., & Ghoddusi, A. (2023) · Microbial Pathogenesis · doi:10.1016/j.micpath.2023.106198 · Cited by 8
Buffered formic acid and a monoglyceride blend improve performance and modulate gut bacteria and immunity gene expression in broilers under necrotic enteritis challenge
Daneshmand, A., Sharma, N. K., Kheravii, S. K., Hall, L., & Wu, S. (2023) · Poultry Science · doi:10.1016/j.psj.2023.102978 · Cited by 10
A new QRT-PCR assay designed for the differentiation between elements provided from Agrobacterium sp. in GMOs plant events and natural Agrobacterium sp . bacteria
Nabi, N., Chaouachi, M., Zellama, M. S., Hafsa, A. B., Mrabet, B., Saïd, K., & Fathia, H. S. (2015) · Food Chemistry · doi:10.1016/j.foodchem.2015.09.015 · Cited by 8
Microbiota: A Key for Healthy Aging
Choi, Y. J., & Lee, D. H. (2016) · Annals of Geriatric Medicine and Research · doi:10.4235/agmr.2016.20.4.168 · Cited by 8
Acquired Genetic Elements that Contribute to Antimicrobial Resistance in Frequent Gram-Negative Causative Agents of Healthcare-Associated Infections
Cruz-López, F., Villarreal-Treviño, L., Camacho-Ortíz, A., Morfín‐Otero, R., Flores-Treviño, S., & Garza‐González, E. (2020) · The American Journal of the Medical Sciences · doi:10.1016/j.amjms.2020.06.028 · Cited by 8
Varying ensiling conditions affect the fermentation quality and abundance of bacterial key players in lucerne silages
Hartinger, T., Kube, K., Gresner, N., & Südekum, K. (2020) · The Journal of Agricultural Science · doi:10.1017/s002185962000057x · Cited by 8
Effects of Bacillus subtilis BSNK-5-Fermented Soymilk on the Gut Microbiota by In Vitro Fecal Fermentation
Gao, Y., Hou, L., Hu, M., Li, D., Tian, Z., Wen, W., Fan, B., Li, S., & Wang, F. (2022) · Foods · doi:10.3390/foods11213501 · Cited by 10
“, obesity, diabetes), cancers and inflammatory bowel disease [16,17].”
Background
Faecal Concentrations of Short-chain Fatty Acids and Selected Bacteria in Healthy and Celiac Children
Primec, M., Klemenak, M., Aloisio, I., Gorenjak, M., Gioia, D. D., Mičetić‐Turk, D., & Langerholc, T. (2016) · Archivio istituzionale della ricerca (Alma Mater Studiorum Università di Bologna) · doi:10.12691/ijcd-4-3-6 · Cited by 9
Microbial community and diversity in the feces of Sichuan takin (Budorcas taxicolor tibetana) as revealed by Illumina Miseq sequencing and quantitative real-time PCR
Zhu, H., Zeng, D., Wang, N., Niu, L., Zhou, Y., Zeng, Y., & Ni, X. (2018) · AMB Express · doi:10.1186/s13568-018-0599-y · Cited by 8
Isolation of swine‐derived Lactobacillus plantarum and its synergistic antimicrobial and health‐promoting properties with ZnO nanoparticles
Zheng, L., Hu, Y., He, X., Zhao, Y., & Xu, H. (2020) · Journal of Applied Microbiology · doi:10.1111/jam.14605 · Cited by 8
Exploring the causal relationship between gut microbiota and frailty: a two-sample mendelian randomization analysis
Bo, F., Teng, H., Shi, J., Luo, Z., Xu, Y., Pan, R., Xia, Y., Zhu, S., Zhang, Y., & Zhang, W. (2024) · Frontiers in Medicine · doi:10.3389/fmed.2024.1354037 · Cited by 7
Underlying Mechanisms of the Protective Effects of Lifestyle Factors On Age-Related Diseases
Alcaraz, N., Salcedo‐Tello, P., González‐Barrios, R., Torres‐Arciga, K., & Guzmán-Ramos, K. R. (2024) · Archives of Medical Research · doi:10.1016/j.arcmed.2024.103014 · Cited by 9
Inulin and Health Benefits
Moser, M., Sentko, A., & Alexiou, H. (2015) · Springer eBooks · doi:10.1007/978-3-319-16298-0_37 · Cited by 7
In vitro Intervention of Lactobacillus paracasei N1115 Can Alter Fecal Microbiota and Their SCFAs Metabolism of Pregnant Women with Constipation and Diarrhea
Dang, C., Zhao, K., Xun, Y., Feng, L., Zhang, D., Cui, L., Cui, Y., Jia, X., & Wang, S. (2022) · Current Microbiology · doi:10.1007/s00284-022-02906-5 · Cited by 7
“Bifidobacterium F: GGG TGG TAA TGC CGG ATG 450 bp [45]”
Background
The Anti-Inflammatory Effect of a Probiotic Cocktail in Human Feces Induced-Mouse Model
Salimi, A., Sepehr, A., Hejazifar, N., Talebi, M., Rohani, M., & Pourshafie, M. R. (2023) · Inflammation · doi:10.1007/s10753-023-01870-x · Cited by 7
The Intestinal Microbiota of the Elderly
He, F. (2006) · CRC Press eBooks · doi:10.3109/9781420014952-5 · Cited by 7
Identification of the Microbiota in the Aging Process
Sarkar, A., & Pitchumoni, C. S. (2017) · Elsevier eBooks · doi:10.1016/b978-0-12-804024-9.00004-5 · Cited by 8
Microbial biotechnology for sustainable biomedicine systems: Current research and future challenges
Yadav, A. N., Kour, D., Kaur, T., Devi, R., Guleria, G., Rana, K. L., Yadav, N., & Rastegari, A. A. (2020) · Elsevier eBooks · doi:10.1016/b978-0-12-820528-0.00020-x · Cited by 8
The Order of Limiting Amino Acids in a Wheat–Sorghum-Based Reduced-Protein Diet for Laying Hens
Jahan, A. A., Dao, H. T., Akter, N., Sukirno, S., Swick, R. A., Morgan, N. K., Crowley, T. M., & Moss, A. F. (2023) · Applied Sciences · doi:10.3390/app132312934 · Cited by 8
Method comparison for the direct enumeration of bacterial species using a chemostat model of the human colon
Moura, I. B., Normington, C., Ewin, D. J., Clark, E., Wilcox, M. H., Buckley, A. M., & Chilton, C. H. (2020) · BMC Microbiology · doi:10.1186/s12866-019-1669-2 · Cited by 6
Use of the Dynamic TIM-1 Model for an In-Depth Understanding of the Survival and Virulence Gene Expression of Shiga Toxin-Producing Escherichia coli in the Human Stomach and Small Intestine
Uriot, O., Chalançon, S., Mazal, C., Etienne‐Mesmin, L., Denis, S., & Blanquet‐Diot, S. (2021) · Methods in molecular biology · doi:10.1007/978-1-0716-1339-9_14 · Cited by 6
Compositional dynamics of the human intestinal microbiota with aging: Implications for health
Lakshminarayanan, B., Stanton, C., O’Toole, P. W., & Ross, R. P. (2014) · The journal of nutrition health & aging · doi:10.1007/s12603-014-0513-5 · Cited by 7
A Non-Randomized Trial Investigating the Impact of Brown Rice Consumption on Gut Microbiota, Attention, and Short-Term Working Memory in Thai School-Aged Children
Gruneck, L., Marriott, L. K., Gentekaki, E., Kespechara, K., Sharpton, T. J., Denny, J., Shannon, J., & Popluechai, S. (2022) · Nutrients · doi:10.3390/nu14235176 · Cited by 6
The effect of genetically modified Lactobacillus plantarum 590 on the gut health of sprague–dawley rats
Liu, H., Xu, W., Yuan, Y., Cao, S., He, X., Li, S., Huang, K., & Luo, Y. (2012) · IUBMB Life · doi:10.1002/iub.1027 · Cited by 6
“Primer sequences targeting 16SrDNA of different groups or genera of bacteria have been designed and optimized (14, 18) 618 LIU ET AL.”
Method
Stool vs. Serum Hepatitis B Virus DNA in Patients with Chronic Hepatitis B
Zheng, J.-S., Chen, M.-M., Yang, H., Zhou, X., Liu, Y., & Li, J. (2015) · Medical Science Monitor · doi:10.12659/msm.896243 · Cited by 5
Synbiotic Yogurts and the Elderly
Sivieri, K., Freire, F., Lopes, N. P., Shiraishi, C., Pires, A., Lima, A. C., Zavarizi, A. C. M., Sgarbosa, L., & Bianchi, F. (2017) · Elsevier eBooks · doi:10.1016/b978-0-12-805134-4.00014-6 · Cited by 4
A feasibility study: association between gut microbiota enterotype and antibody response to seasonal trivalent influenza vaccine in adults
Shortt, N., Poyntz, H., Young, W., Jones, A., Gestin, A., Mooney, A., Thayabaran, D., Sparks, J., Ostapowicz, T., Tay, A., et al. (2018) · Clinical & Translational Immunology · doi:10.1002/cti2.1013 · Cited by 5
Correlation of Gut Microbiota, Vitamin D Status, and Pulmonary Function Tests in Children With Cystic Fibrosis
Albedewi, H., Bindayel, I. A., Albarrag, A., & Banjar, H. H. (2022) · Frontiers in Nutrition · doi:10.3389/fnut.2022.884104 · Cited by 6
Effect of Increasing Dietary Protein from Soybean Meal on Intestinal Microbiota and Their Fatty Acids Production in Broiler Chicken
Nakphaichit, M. (2014) · Advances in Animal and Veterinary Sciences · doi:10.14737/journal.aavs/2014/2.6.337.343 · Cited by 6
Effects of the Probiotics Supplementation in Diet on Intestinal Microflora Ecosystem in Broilers
Yu, B., Chang, C.-H., & Lee, T.-T. (2015) · Journal of Advanced Agricultural Technologies · doi:10.12720/joaat.2.2.138-142 · Cited by 6
Modulatory effects of synbiotic blend on selected human fecal bacteria and TNFα + LPS-induced inflammation in human intestinal epithelial cells
Rawat, A., Bhattacharya, A., Tharu, R., Maurya, R., Bhadada, S. K., Bishnoi, M., & Kondepudi, K. K. (2025) · The Microbe · doi:10.1016/j.microb.2025.100512 · Cited by 5
Changes in the Microbiota Composition and Function in Relation to Aging
Maukonen, J., & Ouwehand, A. C. (2021) · Elsevier eBooks · doi:10.1016/b978-0-12-819265-8.00060-7 · Cited by 4
Assessment the role of some Bacillus strains in improvement rex rabbits resistance against ETEC challenge
Wang, J., Wen, B., Zeng, Y., Wang, H., Zhao, W. H., Zhou, Y., Liu, L., Wang, P., Pan, K., Jing, B., et al. (2022) · Microbial Pathogenesis · doi:10.1016/j.micpath.2022.105477 · Cited by 5
Molecular Diversity of Gut Microbiota and Short Chain Fatty Acids in Egyptian Adults Following Dietary Intervention with Fermented Sobya
Labib, E., Blaut, M., Hussein, L., Goud, M., Kramer, D. L., Paliy, O., Ganesh, B. P., Schümann, P., Pukall, R. ⁄. D., Woting, A., et al. (2018) · doi:10.4172/2476-2059.1000139 · Cited by 5
Detection of viable Bifidobacterium lactis HN019 (DR10™) in stools of children during a synbiotic dietary intervention trial
Prasad, J., Sazawal, S., Dhingra, U., & Gopal, P. K. (2012) · International Dairy Journal · doi:10.1016/j.idairyj.2012.12.001 · Cited by 5
The microbiome of rainbow trout (Oncorhynchus mykiss)
Lowrey, L. (2014) · UNM’s Digital Repository (University of New Mexico) · Cited by 5
Weaning drives microbiome-mediated epigenetic regulation to shape immune memory in mice
Yang, L., Peery, R. C., Zhou, S., Chen, X., Farmer, L. M., Gutierrez, F., Fowler, S., Zhang, L., Salamat, J. M., Riggins, K. S., et al. (2026) · Nature Microbiology · doi:10.1038/s41564-026-02295-6 · Cited by 4
Microbial diversity in drug-naïve Parkinson’s disease patients
Papić, E., Rački, V., Hero, M., Zimani, A. N., Sajko, M. Č., Rožmarić, G., Čizmarević, N. S., Ostojić, S., Kapović, M., Hauser, G., et al. (2025) · PLoS ONE · doi:10.1371/journal.pone.0328761 · Cited by 6
“…al. it has been found that in healthy older populations with no pronounced comorbidities, there were no significant changes in the gut microbiome when compared to younger populations, while in the elderly group that was hospitalized or was taking antibiotics, these changes were more apparent [70].”
A proof of concept infant-microbiota associated rat model for studying the role of gut microbiota and alleviation potential of Cutibacterium avidum in infant colic
Martin, V. N. R., Del’Homme, C., Chassard, C., Schwab, C., Braegger, C., Bernalier‐Donadille, A., & Lacroix, C. (2022) · Frontiers in Nutrition · doi:10.3389/fnut.2022.902159 · Cited by 5
Gut microbiota composition in patients with Crohn’s disease in Saudi Arabia
Alahdal, H. M., Almuneef, G., Alkhulaifi, M. M., Aldibasi, O. S., Aljouie, A., Alharbi, O., Almohawes, Z. N., Basingab, F. S., & Rejili, M. S. (2024) · PLoS ONE · doi:10.1371/journal.pone.0299749 · Cited by 4
Assessment of gut microbiota in the elderly with sarcopenic obesity: a case-control study
Hosseini, F., Behrouzi, A., Shafaie, E., Sharifi, F., & Ejtahed, H. (2025) · Journal of Diabetes & Metabolic Disorders · doi:10.1007/s40200-025-01584-x · Cited by 4
“For this purpose, we employed quantitative PCR (qPCR) with genus-specific primers (Table S1) [ 27 , 28] and conducted duplicate assays to guarantee the precision and reproducibility of the results.”
The Intestinal Microbiota and Aging
O’Toole, P. W., & Brigidi, P. (2013) · World review of nutrition and dietetics · doi:10.1159/000345748 · Cited by 4
PREBIOTICS AND BOWEL CANCER
Walton, G., & Gibson, G. R. (2007) · Cited by 4
Homeostatic Microbiome (Microbiota) – Formation, Maintenance and Influence on Human Health
Dragan Nikolic, M. (2018) · Journal of Gastroenterology and Hepatology Research · doi:10.17554/j.issn.2224-3992.2018.07.760 · Cited by 4
Effect of fermented blood cells on growth performance and intestinal characteristics of weaned piglets
Zhang, B., Yang, W., Zhang, H., Meng, Q., Bi, C., & Shan, A. (2019) · Journal of Animal Physiology and Animal Nutrition · doi:10.1111/jpn.13194 · Cited by 4

Authors: Bartosch, S., Fite, A., Macfarlane, G. T., & McMurdo, M. E. T.
Affiliations: University of Dundee (GB)
MRC Microbiology and Gut Biology Group
Venue: Applied and Environmental Microbiology
Publisher: American Society for Microbiology
Published: 2004-06
Volume: 70
Issue: 6
Pages: 3575-3581
ISSN: 0099-2240 (ISSN-L)
1098-5336
DOI: 10.1128/aem.70.6.3575-3581.2004
PMC: PMC427772
OpenAlex: W2109744701
Cited by: 762
References: 51
Citations by year: 2026: 15 · 2025: 29 · 2024: 12 · 2023: 31 · 2022: 36 · 2021: 51 · 2020: 49 · 2019: 36 · 2018: 38 · 2017: 63 · 2016: 59 · 2015: 65 · 2014: 44 · 2013: 46 · 2012: 46
FWCI: 4.63
Type: journal article
Language: en
Open access: green
europepmc.org
Licence: journals.asm.org/non-commercial-tdm-license (tdm)
Locations: Applied and Environmental Microbiology (publishedVersion)
Europe PMC (PubMed Central) (publishedVersion)
PubMed Central (publishedVersion)
PubMed (publishedVersion)
Discovery Research Portal (University of Dundee) (submittedVersion)
Funders: Medical Research Council
Topics: Life Sciences › Biochemistry, Genetics and Molecular Biology › Molecular Biology › Gut microbiota and health
Health Sciences › Medicine › Infectious Diseases › Clostridium difficile and Clostridium perfringens research
Physical Sciences › Environmental Science › Ecology › Microbial Community Ecology and Physiology
Keywords: fecal microbiota, older adults, hospitalized patients, antibiotic therapy, Bifidobacterium, Desulfovibrio, Faecalibacterium prausnitzii, 16S rRNA gene quantification, Enterobacteriaceae, Enterococcus faecalis, intestinal bacteria, community-acquired infections
MeSH terms: Aged, Aged, 80 and over, Anti-Bacterial Agents, Bacteria, Bacterial Infections, DNA, Bacterial, DNA, Ribosomal, Feces, Hospitalization, Humans, RNA, Ribosomal, 16S, Species Specificity, Polymerase Chain Reaction, Ecosystem, DNA Primers, Gene Dosage, Genes, rRNA

About these checks

Registry, retraction, Cites and statistics results are computed, not judged, with one exception: a printed reference that no index lists is read once by a model before it counts as a citation error. Claims are extracted by a model and kept only when their quote appears verbatim in the text; each cited source is then checked, with a model’s help, for whether it says what the claim relies on. Those verdicts can be wrong — read the claim’s quote and the cited source before relying on one.

Statistics and arithmetic are recomputed, not judged.

Confidence bands are shown only for fields calibrated on our annotated test set. None is calibrated yet, so no band is shown.

What counts as a claim ›How we measure confidence ›How we check this ›

Are you an author, or do you see a problem with this page? Request a review

Characterization of Bacterial Communities in Feces from Healthy Elderly Volunteers and Hospitalized Elderly Patients by Using Real-Time PCR and Effects of Antibiotic Treatment on the Fecal Microbiota

Abstract

Overview

Integrity signals

Verification

Claims the paper makes

Claims other papers make about this one

Self-check

Citations

Cites

Cited by

Related

Metadata

Record

About these checks