Distribution of vesicular glutamate transporter mRNA in rat hypothalamus

“Glutamatergic, GABAergic and peptidergic neurons are highly intermingled in this region, making it difficult to predict its net impact on stress response”

“Many neurons in this region express the vesicular glutamate transporter 2 (Hur and Zaborszky, 2005; Ziegler et al., 2002) but whether these glutamatergic neurons promote arousal remains to be determined.”

“Based upon the heavy expression of VGLUT2 (glutamate synaptic vesicle transport protein) in the VMH and the relative absence of other neurotransmitter synaptic vesicle transport proteins in the VMH (Collin et al., 2003; Ziegler et al., 2002 ), it is likely that the majority of VMH neurons are glutamatergic.”

“levels are very low in DMH neurons (Ziegler et al., 2002).”

“LH-to-VTA projections, drawn in black, could be GABAergic [142] and/or glutamatergic [592].”

“Most of the cells in rat cerebral cortex express very high levels of vGluT1 mRNA (Gras et al., 2002; Ziegler et al., 2002), whereas the other two transporters are found at much lower densities.”

“Some areas that supply vesicular glutamate transporter-expressing fibers to the PVN and that may thus be targets for fast glucocorticoid actions include the lateral hypothalamus, bed nucleus of the stria terminalis, ventromedial hypothalamus, and dorsomedial hypothalamus (40, 41).”

“The posterior hypothalamus, which is involved in alertness, uses glutamate as the primary neurotransmitter [20].”

“In agreement with Ziegler et al. (2002) and Lin et al. (2003), many Vglut2 cells are seen in the preoptic region, including the median, periventricular, anterodorsal, and medial preoptic nuclei (Figs.”

“…and in situ hybridization studies have concluded that VGLUT1 and VGLUT2 are expressed by different neurons, projection systems, and synaptic terminals in the brain (above-cited studies; see also Hisano et al., 2000; Sakata-Haga et al., 2001; Kaneko et al., 2002; Ziegler et al., 2002).”

“Hybridization using antisense probes for VGLUT1 and VGLUT2 yielded labeling that conformed with the reported distributions in rat brain (Ziegler et al., 2002), and sense probes for each did not provide evidence of specific labeling.”

“Ziegler et al. (2002) , reprinted with permission 64 Brain Struct Funct (2008) 213:63‐72”

“First, we colocalized mRNAs for glutamic acid decarboxylase (GAD; marker of GABA neurons ) and VGLUT2 (marker of hypothalamic glutamatergic neurons) (Ziegler et al., 2002) in the AVPV and in the medial preoptic area (MPO) of OVX rats (n ϭ 5).”

“Most VMN neurons are glutamatergic (39, 40), and previous evidence points to a role for glutamate release from these neurons in the CRR response (11).”

“…is consistent with previous in situ hybridization and immunocytochemical studies showing that VGLUT2 is the predominant isoform expressed in the PVN (Ziegler et al., 2002), and that hypophysiotropic parvocellular CRF neurons of the PVN express VGLUT2 (Lin et al., 2003; Hrabovszky et al., 2005).”

“named solute carrier family 17 (sodium-dependent inorganic phosphate cotransporter), member 6 (Slc17a6), is a marker of hypothalamic glutamatergic neurons [50].”

“One likely candidate for corelease with Orx is glutamate, given that vesicular glutamate transporters are expressed by LHA neurons and extensively colocalized with Orx (Rosin et al., 2003; Ziegler et al., 2002).”

“…either a general mapping of the distribution of VGLUT proteins in the whole rat brain (Kaneko and Fujiyama, 2002; Kaneko et al., 2002; Varoqui et al., 2002) or a more detailed analysis of their distribution the hypothalamus (Ziegler et al., 2002) and the cerebral cortex (Fujiyama et al., 2001).”

“Parvocellular CRH neurons also express numerous co-secreted peptides as well as glutamate (Swanson, 1991; Ziegler et al., 2002), indicating that multiple factors may be involved in parvocellular signaling.”

“Combined immunohistochemistry/in situ hybridization Preparation of cRNA probes for vesicular glutamate transporter 1 (vGluT1), 2 (vGluT2), and glutamic acid decarboxylase 65 (GAD65) mRNAs was carried out as previously described (Bowers et al. 1998; Ulrich-Lai et al. 2011; Ziegler et al. 2002, 2012).”

“Notably, VGluT2 is the primary form within the parvocellular division of the PVN (Herzog et al., 2001; Ziegler et al., 2002).”

“Glutamate is the primary neurotransmitter in the VMN (Ziegler et al., 2002) and is a known modulator of dendritic spine formation and maintenance in many brain regions (Malenka and Nicoll, 1993; McKinney et al.”

“…as well as CRF-immunoreactive neurons that are potential sources of afferents to the DRN include the paraventricular hypothalamic nucleus, bed nucleus of the stria terminalis and central nucleus of the amygdala (Hur and Zaborszky, 2005; Lin et al., 2003; Poulin et al., 2008; Ziegler et al., 2002).”

“On the other hand, expression of VGLUT1 is confined to relatively weak labeling in the lateral hypothalamic area (51).”

“RESULTS VGLUT2 mRNA and VGLUT2 immunoreactivity are present in PVH neurons with axonal projections to the RVLM As noted by previous authors (Ziegler et al., 2002; Rosin et al., 2003; Lin et al., 2003; Hur and Zaborszky, 2005; Hrabovszky et al., 2005), VGLUT2 mRNA was detectable by in situ…”

“It is known that glutamate transporters, particularity VGLUT2, are highly expressed in the hypothalamus, including OX neurons (Ziegler et al., 2002; Rosin et al., 2003), and play a main role in the regulation of energy balance (Tong et al.”

“…1997; Elmquist et al., 1998), type 2 corticotropin-releasing factor receptor (CRFR2) (Chalmers et al., 1995; Van Pett et al., 2000; Chen et al., 2005; Chao et al., 2012), and vesicular glutamate transporter 2 (vGLUT2) (Ziegler et al., 2002; Lin et al., 2003; Eyigor et al., 2004; Meister, 2007).”

“The nucleus mainly contains glutamatergic cells expressing VGLUT-2 (Ziegler et al., 2002) and displaying tonic firing during theta state (Bland et al.”

“Although these data are still preliminary, they are supported by other VGlut2 in situ hybridization studies (Hisano et al., 2000, Fremeau et al., 2001, Ziegler et al., 2002, Rosin et al., 2003, Hur and Zaborszky, 2005) and by tracing experiments (Phillipson, 1979b, Geisler and Zahm, 2005).”

“…VGluT2, in combination, appear to account for glutamate packing by essentially all excitatory neurons in brain regions (Bai et al., 2001; Fremeau et al., 2001; Fujiyama et al., 2001; Kaneko et al., 2002; Varoqui et al., 2002; Ziegler et al., 2002; for further review, see Kaneko and Fujiyama, 2002).”

“1, available at www.jneurosci.org as supplemental material) as well as in several other nuclei where VGluT2 expression has been demonstrated previously, for instance, in the thalamus, mammillary nucleus, and medial geniculate body (Fremeau et al., 2001; Ziegler et al., 2002) (supplemental Fig.”

“…1,267–1,855. was generated by reverse transcriptase-polymerase chain reaction (RT-PCR) from total rat brain RNA with upstream primer ACGTGAACCACTTGGACATC and downstream primer CAAGAGGCAGTTGAGAAGGA and clone in a pGEM-T easy vector (Promega, Madison, WI), as described in Ziegler et al. (2002).”

“areas DMH and medial preoptic area were noted for their intermingled populations of glutamatergic and GABAergic neurons (Ziegler et al., 2002).”

“In situ hybridization Antisense cRNA probes for VGluT2 [59], GAD 65 [60], NPY [61], and GLP-1R [62] mRNAs were transcribed using either (35)S-UTP or a Digoxigenin RNA labeling mix (Roche) as previously described with minor modifications [57].”

“…whereas VGLUT2 is expressed in numerous thalamic, hypothalamic, and brainstem nuclei (Ni et al., 1994, 1995; Bellocchio et al., 1998, 2000; Aihara et al., 2000; Hisano et al., 2000; Takamori et al., 2000; Fremeau et al., 2001; Fujiyama et al., 2001; Hayashi et al., 2001; Ziegler et al., 2002).”

“Three different types of vesicular glutamate transporters (VGLUT1-3) are selectively, but not exclusively, expressed in different anatomical areas (Fremeau et al., 2001; Herzog et al., 2001; Kaneko et al., 2002; Ziegler et al., 2002; Fremeau et al., 2004).”

“They were as follows: for VGAT (McIntire et al., 1997), sense and antisense as described (Lamas et al., 2001); nested (antisense), 5 -TGATCTGGGCCACATTGACC-3 ; dynorphin (Glasgow et al., 1999), sense, 5 -GAAGTGACAAACAGCGCTACAC-3 ; antisense, 5 -TGCAACCTCAGAGGGGATCACAAG-3 ; nested (sense), 5 -ACTGCCATAGGGGGATTTGGTAGC-3…”

“The results indicate that GAD65 and VGLUT2 are both highly and heterogeneously expressed in the hypothalamus, consistent with and confirmatory to previous work (33, 34).”

“Because VGLUT2 is the predominant vesicular glutamate transporter expressed in the mediobasal hypothalamus (Ziegler et al., 2002), and GAD67 is expressed in the same pattern in the arcuate nucleus as the other GABA-synthetic enzyme isoform, GAD65 (Esclapez et al., 1993; Feldblum et al., 1993),…”

“The dense distribution of GFP cells in the VMH area is consistent with the heavy expression of vGluT2 in the VMH (Ziegler et al., 2002; Collin et al., 2003), and supports the view that many VMH neurons use glutamate as an excitatory neurotransmitter (Beart et al., 1988).”

“The plasmid template for in vitro transcription of this probe (10) was a kind gift from Dr.”

“In addition, vSUB efferents also contact limbic regions implicated in HPA axis excitation, including the medial amygdaloid nucleus (32), and are in position to interact with PVNprojecting circuits in the hypothalamus (26, 33).”

“The effects of T3 in the VMN may be mediated by glutamate [19] and/or brain-derived neurotrophic factor (BDNF) neurons [20].”

“VGluT1 mRNA was highly expressed in cerebral cortex, hippocampus, habenula, and cortical amygdala, with considerably less expression in hypothalamic regions, as described previously (Kaneko and Fujiyama, 2002; Ziegler et al., 2002; Collin et al., 2003).”

“The vGluT2 is the subtype expressed in the hypothalamic neuroendocrine magnocells and exhibit robust up-regulation in response to certain homeostatic challenges (Ziegler et al., 2002; Hrabovszky and Liposits, 2007, 2008).”

“A likely source of some of these fibers is the parvicellular part of the hypothalamic paraventricular nucleus, where VGLUT2-expressing neurons occur in high numbers (1, 2).”

“…PVN and DMH are major axonal targets of hindbrain GLP1 neurons (Maniscalco et al. 2012; Rinaman 1999b; Larsen et al. 1997a; Vrang et al. 2007), and glutamatergic inputs to both hypothalamic nuclei predominantly express VGLUT2 rather than VGLUT1 (Kaneko et al. 2002; Ziegler et al. 2002, 2005).”

“While it is clear that GABA is the predominant neurotransmitter for extrinsic output connections of the cerebral nuclei (BST included), and glutamate (GLU) for the cerebral cortex (Swanson, 2000), the picture for the LHA is (perhaps unsurprisingly) more complex (Ziegler et al., 2002; Meister, 2007).”

“VGLUT2 mRNA or immunostaining of cell bodies in the SCN (Ziegler et al., 2002; Lin et al., 2003).”

“VGLUT2 mRNA has also been detected in many parvocellular neurons in the hypothalamic paraventricular nucleus (Ziegler et al., 2002).”

“VGLUT2 mRNA is abundantly expressed throughout the LH region, and scattered VGLUT1 mRNA-positive cells are also observed in the LH (129).”

“…et al., 2001; Schafer et al., 2002) and the distribution of VGluT1 and 2 has been documented for cell bodies and varicosities of the hypothalamus and preoptic area of rats by in situ hybridization and immunohistochemistry (Herzog et al., 2001; Ziegler et al., 2002; Kaneko and Fujiyama, 2002).”

“Seminal work (mostly on rodents) revealed that, while the majority of VMH neurons are glutamatergic (8), the nucleus accommodates a heterogeneous mixture of cell types (Fig.”

“Appropriate controls for the GAD and VGlu experiments were performed with sensestrand and antisense VGlu and GAD probes as described previously by Esclapez et al. (1993) and Ziegler et al. (2002), respectively.”

“The probes were synthesized from 250 ng of VGLUT1 PCR template (Ziegler et al., 2002) or VGLUT2 cDNA-containing linearized plasmid (from Dr.”

“The authors were interested in evaluating the role of VGLUT2 in ventromedial hypothalamic (VMH) neurons, which are predominantly glutamatergic and previously were shown to express VGLUT2 (27).”

“THE HYPOTHALAMIC PARAVENTRICULAR nucleus (PVN) includes neurons containing neurotransmitters, such as glutamate (41, 48) and GABA (6), as well as neuromodulators like nitric oxide (NO) (3, 27, 47).”

“While these assignments are largely consistent with previous literature ( 61 – 63 ), rarer populations may not be fully represented in our analysis.”

“…neurons of the VMHvl and posterior ventral MeA (MePV) are largely glutamatergic (Hong et al., 2014; Lin et al., 2011; Sakurai et al., 2016; Ziegler et al., 2002), while ERα+ cells in the MPOA, BNST, and posterior dorsal MeA (MePD) are predominantly GABAergic (Cheong et al., 2015; Choi et…”

“Riboprobes for VGLUT2 (originally named DNPI, 734 bp, 50 cloned into pGEM-T EZ vector) were generated using standard in vitro transcription methodology, with SP6 polymerase and 35S-UTP as the radiolabel (PerkinElmer/NEN, Boston, MA) as described by Ziegler et al. (2002).”

“VGLUT is a reliable and specific marker of glutamate terminals (Takamori et al. 2000) and the VGLUT2 is the more abundant isoform found in the hypothalamus (Ziegler et al. 2002).”

“…to evoke typical rapid glutamatergic responses in neurons targeted by their axons (Schöne et al., 2012; Figure 3); a subpopulation of SCN neurons (Ziegler et al., 2002; Kiss et al., 2007), consistent with observations that electrical or chemical stimulation in SCN can evoke ionotropic AMPANMDA…”

“Among the sources of this input, the medial septum diagonal band complex (MSDB) and the supramammillary area (SUM) are known to contain both VGLUT2 mRNAexpressing (Fremeau et al., 2001; Ziegler et al., 2002; Lin et al., 2003) and VGLUT2-IR neurons (Hajszan et al.”

“The prominent expression of Vglut2 in the VMH [2,3] suggests that excitatory, glutamatergic neurotransmission mediates multiple and diverse aspects of VMH functions.”

“It contains multiple cell types with unique neurochemical profiles, vesicular transporter (s) (Collin et al., 2003; Rosin et al., 2003; Ziegler et al., 2002), connectivity (Ekstrand et al.”

“Based on available anatomical data, the glutamatergic non-retinal axons probably belong to intrahypothalamic connections (Ziegler et al., 2002) and ⁄ or intrinsic SCN neurons (Kiss et al.”