CoChat
Sign Up
Cited by 186Pluripotent Stem Cells ResearchGenomic variations and chromosomal abnormalitiesNeurogenesis and neuroplasticity mechanisms

Neuronal defects in a human cellular model of 22q11.2 deletion syndrome

Open access
Khan, Themasap A., Revah, Omer, Gordon, Aaron, Yoon, Se-Jin, Krawisz, Anna K., Goold, Carleton, Sun, Yishan, Kim, Chul Hoon +19 more·2020·Nature Medicine
DOI 10.1038/s41591-020-1043-9PMC PMC8525897
Open this paper in CoChat — free account

Abstract

22q11.2 deletion syndrome (22q11DS) is a highly penetrant and common genetic cause of neuropsychiatric disease. Here we generated induced pluripotent stem cells from 15 individuals with 22q11DS and 15 control individuals and differentiated them into three-dimensional (3D) cerebral cortical organoids. Transcriptional profiling across 100 days showed high reliability of differentiation and revealed changes in neuronal excitability-related genes. Using electrophysiology and live imaging, we identified defects in spontaneous neuronal activity and calcium signaling in both organoid- and 2D-derived cortical neurons. The calcium deficit was related to resting membrane potential changes that led to abnormal inactivation of voltage-gated calcium channels. Heterozygous loss of DGCR8 recapitulated the excitability and calcium phenotypes and its overexpression rescued these defects. Moreover, the 22q11DS calcium abnormality could also be restored by application of antipsychotics. Taken together, our study illustrates how stem cell derived models can be used to uncover and rescue cellular phenotypes associated with genetic forms of neuropsychiatric disease.

AI snapshot

Written from the paper’s full text.

TL;DR

This study used hiPS cell-derived 3D cortical organoids and 2D cortical neurons from 15 22q11DS patients and 15 controls to identify neuronal phenotypes in 22q11.2 deletion syndrome. It found increased spontaneous firing, impaired depolarization-induced calcium signaling, and depolarized resting membrane potential linked to voltage-dependent LTCC inactivation, with DGCR8 loss sufficient to phenocopy and antipsychotics/DGCR8 overexpression partially rescuing defects.

Key findings

  • Transcriptional profiling across 100 days showed high reliability of differentiation and identified 87, 34, 258, and 46 differentially expressed genes at days 25, 50, 75, and 100, respectively, with enrichment for neuronal excitability, calcium transport/signaling, voltage-gated calcium channel activity, and resting membrane potential regulation.
  • 22q11DS cortical neurons were approximately 4x more likely to spontaneously fire action potentials than controls (P=0.001; P=0.0006), and showed decreased depolarization-induced [Ca2+]i rise (P<0.0001; Cohen’s d=3.76 for hCS and 4.37 for 2D neurons) and a more depolarized RMP (P<0.0001).
  • The calcium defect was linked to voltage-dependent inactivation of LTCCs: no difference was found in Ba2+ current amplitude/charge (P=0.68 amplitude; P=0.44 charge) or activation curve (P=0.78), but the fraction of available channels at –50 mV and –40 mV was decreased in patients.
  • Heterozygous DGCR8 loss recapitulated increased spontaneous firing (P=0.003), decreased [Ca2+]i rise (P<0.0001), and depolarized RMP (P=0.009); DGCR8 overexpression partially rescued calcium in 22q11DS and hyperpolarized 22q11DS neurons by ~7 mV (P=0.01), while raclopride increased [Ca2+]i amplitude by ~104% in 22q11DS and hyperpolarized cells by ~5 mV.

Methods

  • Generated 43 hiPS cell lines from 15 patients with the canonical 3Mb 22q11.2 deletion (22.8 ± 2.4 years; 60% female) and 15 controls (23.8 ± 4.0 years; 67% female), then differentiated them into 3D human cortical spheroids (hCS) and 2D cortical glutamatergic cultures.
  • Collected bulk RNA-seq at days 25, 50, 75, and 100 from 15 hiPS cell lines derived from 12 22q11DS individuals and 14 hiPS cell lines from 11 controls; performed single-cell transcriptomics in four hiPS cell lines.
  • Used patch-clamp electrophysiology, Fura-2 calcium imaging, HPLC neurotransmitter measurements, CRISPR/Cas9-generated DGCR8+/– isogenic lines, lentiviral DGCR8 overexpression, and antipsychotic drug application; analyses included mixed linear models, GSEA, GWAS enrichment, and mixed-model ANOVA.

Limitations

  • Stated: the cohort with ascertained psychiatric diagnoses was limited; larger samples are needed to reliably estimate genotype–phenotype associations and distinguish molecular pathways unique to schizophrenia versus ASD.
  • Stated: it remains to be established whether 22q11DS neurons recover following maturation, homeostatic events, or integration into circuits with interneurons; future studies should identify the microRNA(s) downstream of DGCR8 and whether other 22q11.2 locus genes or regulatory regions contribute.
  • Stated and evident: the antipsychotic hyperpolarization rescue may be unrelated to antipsychotic response in patients; the study focuses on hiPS cell-derived cortical neurons in vitro, so circuit-level and in vivo disease relevance are not directly tested.

Model-written summary. Check it against the paper before relying on it.

Integrity signals

Registry

Crossref · 10.1038/s41591-020-1043-9

Cites

80 of 80 references verified0 citation errors · 0 not checkable

Statistics

Nothing to recompute.

Claims the paper makes

0 of 57 cited sources checked · 0 supported · 0 flagged

  • Findingown data

    Overexpression of DGCR8 rescues the excitability and calcium defects.

    “its overexpression rescued these defects.”
    Quote in the paperSubstantial claim
  • Findingown data

    Cell diversity was overall similar across hiPS cell lines and groups.

    “we compared the proportion of cells in each cluster across lines and found that cell diversity was overall similar across lines and groups”
    Quote in the paperSubstantial claim
  • Findingown data

    The decrease in calcium rise amplitude was consistent across the 22q11DS cohort.

    “which was consistent across the cohort (Fig. 2e, left; P< 0.0001).”
    Quote in the paperSubstantial claim
  • Findingown data

    Co-culturing 22q11DS and control neurons did not affect the calcium phenotype.

    “We found that co–culturing did not affect the phenotype (Extended Data Fig. 6f; P = 0.008).”
    Quote in the paperSubstantial claim
  • Findingown data

    Gene set enrichment analysis found enrichment for genes related to neuronal excitability, including calcium transport, calcium signaling, voltage-gated calcium channel activity, and regulation of resting membrane potential.

    “we also observed an enrichment for genes related to neuronal excitability, including the regulation of calcium transport, calcium signaling or voltage gated calcium channel activity, but also with the regulation of RMP.”
    Quote in the paperSubstantial claim
  • May combine two claims. 47
  • Classified as probably not a substantial claim. 38
  • The quote only partly states this claim. 3

  • May combine two claims.

    Findingown data

    HPLC measurements showed undetectable dopamine and GABA, and no change in glutamate or norepinephrine between groups.

    “We found either undetectable levels (dopamine, GABA) or no change (glutamate, norepinephrine) between groups”
    Quote in the paperSubstantial claim

  • May combine two claims.

    Findingown data

    PC2, as well as PC5, PC6 and PC7 combined, were related to differences between the 22q11DS and control groups.

    “PC2 (7.4%), as well as PC5, PC6 and PC7 (8.1% combined), were related to differences between the 22q11DS and control groups.”
    Quote in the paperSubstantial claim

  • May combine two claims.

    Findingown data

    TTX decreased the calcium rise amplitude, but the difference between 22q11DS and control neurons remained.

    “We found a decrease in the amplitude of the [Ca2+]i rise, but the difference between 22q11DS and control was still present following TTX”
    Quote in the paperSubstantial claim

  • May combine two claims.

    Findingown data

    Variance partitioning showed that differentiation time explained 28% of the variance, differentiation experiment 9.3%, and hiPS cell line 3.9%.

    “variance partitioning showed that differentiation time explained 28% of the variance, while the differentiation experiment and the hiPS cell line explained 9.3% and 3.9% of the variance, respectively”
    Quote in the paperNot a substantial claim

  • May combine two claims.

    Findingown data

    DEGs in 22q11DS were enriched for schizophrenia-associated variants, but not for DEGs found in ASD or schizophrenia postmortem brain tissue.

    “We observed an enrichment for variants associated with schizophrenia, but not for DEG found in ASD or SCZ postmortem brain tissue35,36.”
    Quote in the paperSubstantial claim0 of 2 sources checked
    • cites [35] Parikshak, N. N. et al. Genome-wide changes in lncRNA, splicing, and regional gene expression patterns in autism. Nature 540, 423–427 (2016). source

      Not checked in the free run.

    • cites [36] Fromer, M. et al. Gene expression elucidates functional impact of polygenic risk for schizophrenia. Nat. Neurosci. 19, 1442–1453 (2016). source

      Not checked in the free run.

  • May combine two claims.

    Findingown data

    The calcium defect was present even after 5.5 months of differentiation, although there was an approximately 48% increase in calcium rise amplitude from day 70-80 to day 90-100.

    “We found that although there was an ~48% increase in the amplitude of the [Ca2+]i rise in 22q11DS neurons from day 70–80 to day 90–100, the overall defect was present even after 5.5 months of differentiation”
    Quote in the paperSubstantial claim

  • May combine two claims.

    Findingown data

    Among neurons that fired at least one action potential, there were no differences between 22q11DS and control neurons in action potential amplitude, threshold, rheobase, maximal rate of rise, or maximal rate of decay.

    “we found no differences in AP amplitude (P= 0.69), threshold (P= 0.97), rheobase (P= 0.22), maximal rate of rise (P= 0.29), maximal rate of decay (P= 0.43) between 22q11DS and control neurons”
    Quote in the paperSubstantial claim

  • May combine two claims.

    Findingown data

    Nimodipine decreased the depolarization-induced calcium rise by about 64% in control neurons and about 57% in 22q11DS neurons.

    “pretreatment with nimodipine, a blocker of LTCCs, decreased the amplitude of the [Ca2+]i rise by ~64% in control cortical and by ~57% in 22q11DS”
    Quote in the paperSubstantial claim

  • May combine two claims.

    Findingown data

    Most protein-coding genes in the 22q11.2 locus were downregulated by about 50% in 22q11DS hCS, except DGCR8, which was downregulated by about 20%.

    “The majority of protein–coding genes were downregulated in 22q11DS hCS by ~50% (Extended Fig. 2g), except for DGCR8 which was down regulated by about 20%.”
    Quote in the paperSubstantial claim

  • May combine two claims.

    Findingown data

    DGCR8 overexpression hyperpolarized the membrane potential of 22q11DS neurons by about 7 mV, while having little or no effect in control neurons.

    “We found that, at 10–15 days following viral delivery, DGCR8 overexpression hyperpolarized the membrane potential of 22q11DS neurons by ~7 mV, while it had little or no effect in control neurons (Fig. 5e; P= 0.01).”
    Quote in the paperSubstantial claim

  • May combine two claims.

    Findingown data

    Pretreatment with 10 mM KCl decreased the calcium rise amplitude in control neurons by about 31%, partly mimicking the 22q11DS phenotype.

    “We found that the pretreatment (in 2D- and 3D-derived neurons) resulted in a decrease in the [Ca2+]i amplitude in control neurons (~31%), partly mimicking the phenotype in 22q11DS”
    Quote in the paperSubstantial claim

  • May combine two claims.

    Findingown data

    Overexpression of DGCR8 in 22q11DS neurons increased the calcium rise amplitude but did not restore it to control levels.

    “Imaging with Fura–2, showed that overexpression increased the amplitude of [Ca2+]i rise following depolarization, although it did not restore the amplitude to control levels”
    Quote in the paperSubstantial claim

  • May combine two claims.

    Findingown data

    Olanzapine application resulted in hyperpolarization and rescue of the resting membrane potential of 22q11DS neurons.

    “We found that the application of olanzapine, at a similar concentration of 10 μM, also resulted in hyperpolarization and rescue of the RMP of 22q11DS neurons (Extended Data Fig. 10f; P= 0.008).”
    Quote in the paperSubstantial claim

  • May combine two claims.

    Findingown data

    Exogenously expressing DGCR8 rescued the defects in an isogenic line but only partially in 22q11DS.

    “Exogenously expressing DGCR8 rescued these defects in an isogenic line but only partially in 22q11DS.”
    Quote in the paperSubstantial claim

  • May combine two claims.

    Findingown data

    ATP1A2, WNT5A, and ZNF132 were downregulated in DGCR8+/- hCS.

    “We found that ATP1A243, a sodium–potassium transporter ATPase involved in maintaining the RMP, WNT5A which regulates neuronal excitability and calcium signaling44, as well as ZNF132, were also downregulated in DGCR8+/– hCS”
    Quote in the paperSubstantial claim0 of 2 sources checked
    • cites [43] Gritz, S. M. & Radcliffe, R. A. Genetic effects of ATP1A2 in familial hemiplegic migraine type II and animal models. Hum. Genomics 7, 8 (2013). source

      Not checked in the free run.

    • cites [44] McQuate, A., Latorre-Esteves, E. & Barria, A. A Wnt/calcium signaling cascade regulates neuronal excitability and trafficking of NMDARs. Cell Rep. 21, 60–69 (2017). source

      Not checked in the free run.

  • May combine two claims.

    Findingown data

    DGCR8+/- neurons show a decreased calcium rise amplitude following depolarization, similar to 22q11DS neurons.

    “we observed a decrease in the amplitude of [Ca2+]i rise following depolarization (Fig. 4c), which was similar to the defects in 22q11DS neurons (Fig. 4d; P< 0.0001).”
    Quote in the paperSubstantial claim

  • May combine two claims.

    Findingown data

    Pretreatment with raclopride restored the calcium rise deficit in 22q11DS neurons, while having no statistically significant effect on control neurons.

    “We found that pretreatment with raclopride was sufficient to restore the deficit in [Ca2+]i in 22q11DS neurons, while having no statistically significant effect on control neurons (Fig. 6a, b; P< 0.003).”
    Quote in the paperSubstantial claim

  • May combine two claims.

    Findingown data

    Barium current amplitude and charge did not differ significantly between control and 22q11DS neurons (P = 0.23 for amplitude; P = 0.28 for charge).

    “Barium currents amplitude (left) and charge (right) (controls, n = 30 cells derived from 5 control hiPS cell lines derived from 5 subjects; 22q11DS, n = 17 cells derived from 4 patient hiPS cell lines derived from 4 subjects. Two–tailed Mann–Whitney, P = 0.23 for amplitude; two–tailed Mann–Whitney, P = 0.28 for charge).”
    Quote in the paperNot a substantial claim

  • Probably not a substantial claim: may not pass S3 (load-bearing). The quote only partly states this claim.

    Findingown data

    No systematic differences were observed between cells reprogrammed using the Sendai virus method and those reprogrammed using retroviruses or non-integrating episomal vectors.

    “We did not observe any systematic differences between cells reprogrammed by the two methods.”
    Quote in the paperNot a substantial claim

  • May combine two claims.

    Findingown data

    Sulpiride significantly changed the membrane potential of control neurons (P < 0.0001), and this change was reversible after wash.

    “n = 12 control neurons, one–way repeated measures ANOVA, F2, 22= 14.35, ****P < 0.0001; followed by Tukey’s multiple comparisons test: **P = 0.001 for pre–sulpiride versus sulpiride, ****P < 0.0001 for sulpiride versus post-wash, P = 0.56 for pre–sulpiride versus post–wash”
    Quote in the paperNot a substantial claim

  • May combine two claims.

    Findingown data

    Sulpiride significantly changed the membrane potential of 22q11DS neurons (P = 0.002), and this change was reversible after wash.

    “n = 13 22q11DS neurons, one–way repeated measures ANOVA, F2, 22= 7.84, *P = 0.002; Tukey’s multiple comparisons test: *P = 0.01 for pre–sulpiride versus sulpiride, **P = 0.003 for sulpiride versus post–wash and P = 0.72 for pre–sulpiride versus post–wash”
    Quote in the paperNot a substantial claim

  • Probably not a substantial claim: may not pass S3 (load-bearing).

    Findingown data

    The Pearson correlation of all genes across the four hiPS cell lines was greater than 0.96 (R2 > 0.96).

    “Pearson’s correlation of all genes across all four lines (two control lines and two 22q11DS lines, R2> 0.96).”
    Quote in the paperNot a substantial claim

  • May combine two claims.

    Findingown data

    Action potential amplitude, threshold, rheobase, maximal rate of rise, and minimal rate of decay did not differ significantly between control and 22q11DS neurons.

    “Comparison of action potential properties (controls, n = 46 cells derived from 6 control hiPS cell lines; 22q11DS, n = 66 cells derived from 4 patient hiPS cell lines): amplitude (two–tailed t–test, P = 0.70), threshold (two–tailed t–test, P = 0.97), rheobase (two–tailed Mann–Whitney test, P = 0.22), maximal rate of rise (two–tailed t–test, P = 0.29) and minimal rate of decay (two–tailed Mann–Whit”
    Quote in the paperNot a substantial claim

  • Probably not a substantial claim: may not pass S3 (load-bearing). May combine two claims.

    Findingown data

    Expression of CACNB4, KCNJ11, CALY, CALCB, and PCP4 did not differ significantly between DGCR8+/− and isogenic control (P = 0.94, 0.94, 0.22, 0.22, 0.08, respectively).

    “CACNB4 (two–tailed Wilcoxon test, P= 0.94), KCNJ11 (two–tailed Wilcoxon test, P= 0.94), CALY (two–tailed Wilcoxon test, P= 0.22), CALCB (two–tailed Wilcoxon test, P= 0.22), PCP4 (two–tailed Wilcoxon test, P= 0.08).”
    Quote in the paperNot a substantial claim

  • May combine two claims.

    Findingown data

    Nimodipine decreased the Fura-2 ratio amplitude by approximately 64% in control and 57% in 22q11DS neurons, with significant differences (Kruskal-Wallis P < 0.0001; Dunn's P = 0.001, P < 0.0001).

    “Quantification of the effect of nimodipine on the Fura–2 ratio amplitude (Fura–2 ratio decreased by ~64% in control cortical and by ~57% in 22q11DS neurons; two–sided Kruskal–Wallis test, P < 0.0001; followed by Dunn’s multiple comparison test; **P = 0.001, ****P < 0.0001).”
    Quote in the paperNot a substantial claim

  • May combine two claims.

    Findingown data

    Olanzapine significantly changed the resting membrane potential of 22q11DS neurons (P = 0.008), and this change was reversible after wash.

    “n = 10 neurons derived from one 22q11DS hiPS cell line, one–way repeated measures ANOVA, F2,18= 6.3, **P = 0.008; followed by Tukey’s multiple comparisons test: *P = 0.05 for pre–olanzapine versus olanzapine, **P = 0.008 for olanzapine versus post–wash, P = 0.69 for pre–olanzapine versus post–wash”
    Quote in the paperNot a substantial claim

  • May combine two claims.

    Findingown data

    There was no significant difference in norepinephrine and glutamate levels between control and 22q11DS media samples (P = 0.72 for NE; P = 0.39 for GLUT); dopamine and GABA were not detectable.

    “Two-sided t–test, P = 0.72 for NE, P = 0.39 for GLUT, DA and GABA not detectable”
    Quote in the paperNot a substantial claim

  • Probably not a substantial claim: may not pass S3 (load-bearing). May combine two claims.

    Premisecitation

    Up to one in four 22q11DS patients develop psychosis, corresponding to about a 20-fold increased risk, and this accounts for 1-2% of schizophrenia cases.

    “Up to one in four 22q11.2DS patients develop psychosis, which correspond to a ~20–fold increase in risk, and accounts for 1–2% of all schizophrenia cases4–6.”
    Quote in the paperNot a substantial claim0 of 3 sources checked
    • cites [4] Murphy, K. C., Jones, L. A. & Owen, M. J. High rates of schizophrenia in adults with velo-cardio-facial syndrome. Arch. Gen. Psychiatry 56, 940–945 (1999). source

      Not checked in the free run.

    • cites [5] Monks, S. et al. Further evidence for high rates of schizophrenia in 22q11.2 deletion syndrome. Schizophr. Res. 153, 231–236 (2014). source

      Not checked in the free run.

    • cites [6] Schneider, M. et al. Psychiatric disorders from childhood to adulthood in 22q11.2 deletion syndrome: results from the International Consortium on Brain and Behavior in 22q11.2 Deletion Syndrome. Am. J. Psychiatry 171, 627–639 (2014). source

      Not checked in the free run.

  • Probably not a substantial claim: may not pass S3 (load-bearing). May combine two claims.

    Premisenone given

    22q11.2 deletion syndrome is a common and highly penetrant genetic cause of neuropsychiatric disease.

    “22q11.2 deletion syndrome (22q11DS) is a highly penetrant and common genetic cause of neuropsychiatric disease.”
    Quote in the paperNot a substantial claim

  • Probably not a substantial claim: may not pass S3 (load-bearing).

    Premisecitation

    Rodent models of 22q11DS have provided important insights, including descriptions of circuit dysfunction.

    “Rodent models of 22q11DS have provided important insights3,9,10, including describing circuit dysfunction11–13.”
    Quote in the paperNot a substantial claim0 of 6 sources checked
    • cites [3] Zinkstok, J. R. et al. Neurobiological perspective of 22q11.2 deletion syndrome. Lancet Psychiatry 6, 951–960 (2019). source

      Not checked in the free run.

    • cites [9] Drew, L. J. et al. The 22q11.2 microdeletion: fifteen years of insights into the genetic and neural complexity of psychiatric disorders. Int. J. Dev. Neurosci. 29, 259–281 (2011). source

      Not checked in the free run.

    • cites [10] Karayiorgou, M., Simon, T. J. & Gogos, J. A. 22q11.2 microdeletions: linking DNA structural variation to brain dysfunction and schizophrenia. Nat. Rev. Neurosci. 11, 402–416 (2010). source

      Not checked in the free run.

    • cites [11] Chun, S. et al. Specific disruption of thalamic inputs to the auditory cortex in schizophrenia models. Science 344, 1178–1182 (2014). source

      Not checked in the free run.

    • cites [12] Sigurdsson, T., Stark, K. L., Karayiorgou, M., Gogos, J. A. & Gordon, J. A. Impaired hippocampal-prefrontal synchrony in a genetic mouse model of schizophrenia. Nature 464, 763–767 (2010). source

      Not checked in the free run.

    • cites [13] Fernandez, A. et al. Mitochondrial dysfunction leads to cortical under-connectivity and cognitive impairment. Neuron 102, 1127–1142 e1123 (2019). source

      Not checked in the free run.

  • May combine two claims.

    Interpretationown data

    Human cortical spheroid differentiation is highly reliable, and defects in early cortical differentiation may not be a significant contributor to developmental defects in 22q11DS.

    “Together, this data demonstrates high reliability of hCS and suggests that defects in early cortical differentiation may not be a significant contributor to developmental defects in 22q11DS.”
    Quote in the paperSubstantial claim

  • Probably not a substantial claim: may not pass S3 (load-bearing).

    Study design and conductown data

    A power analysis based on the first batch indicated 85% power to detect an approximately 18% change in expression.

    “A power analysis based on our first batch indicated an 85% power of detecting ~18% change in expression (Extended Data Fig. 2h).”
    Quote in the paperNot a substantial claim

  • May combine two claims.

    Premisecitation

    Recent studies have begun to examine transcriptional changes in neural cells from small 22q11DS cohorts, but functional defects and underlying mechanisms in human 22q11DS neurons had not been investigated.

    “Recent studies16–18 have begun to explore transcriptional changes in neural cells derived from a small 22q11DS cohort, but the functional defects in human 22q11DS neurons and the underlying mechanisms have not been investigated.”
    Quote in the paperSubstantial claim0 of 3 sources checked
    • cites [16] Zhao, D. et al. MicroRNA profiling of neurons generated using induced pluripotent stem cells derived from patients with schizophrenia and schizoaffective disorder, and 22q11.2 Del. PLoS ONE 10, e0132387 (2015). source

      Not checked in the free run.

    • cites [17] Toyoshima, M. et al. Analysis of induced pluripotent stem cells carrying 22q11.2 deletion. Transl. Psychiatry 6, e934 (2016). source

      Not checked in the free run.

    • cites [18] Lin, M. et al. Integrative transcriptome network analysis of iPSC-derived neurons from schizophrenia and schizoaffective disorder patients with 22q11.2 deletion. BMC Syst. Biol. 10, 105 (2016).

      Not checked in the free run.

  • May combine two claims.

    Premisecitation

    Human cortical spheroids transcriptionally resemble the developing cerebral cortex, contain functional glutamatergic neurons and astrocytes, and are highly reliable across differentiation experiments and lines.

    “hCS transcriptionally resemble the developing cerebral cortex, contain functional glutamatergic neurons and astrocytes, and their generation is highly reliable across differentiation experiments and lines22.”
    Quote in the paperSubstantial claim0 of 1 sources checked
    • cites [22] Yoon, S. J. et al. Reliability of human cortical organoid generation. Nat. Methods 16, 75–78 (2019). source

      Not checked in the free run.

  • May combine two claims.

    Study design and conductown data

    SNP arrays were used to verify genome integrity and confirm the 22q11.2 deletion.

    “We used SNP arrays to verify genome integrity and to confirm the 22q11.2 deletion (Extended Data Fig. 1c; Supplementary Table 4).”
    Quote in the paperSubstantial claim

  • Probably not a substantial claim: may not pass S3 (load-bearing). May combine two claims.

    Premisecitation

    22q11DS is the most frequent deletion, occurring in about 1 in 3000 people.

    “The 22q11.2 deletion syndrome (22q11DS) is the most frequent (1: 3000) deletion3.”
    Quote in the paperNot a substantial claim0 of 1 sources checked
    • cites [3] Zinkstok, J. R. et al. Neurobiological perspective of 22q11.2 deletion syndrome. Lancet Psychiatry 6, 951–960 (2019). source

      Not checked in the free run.

  • Probably not a substantial claim: may not pass S3 (load-bearing). May combine two claims.

    Premisecitation

    Human cortical spheroids are regionalized brain organoids whose generation is highly reliable.

    “We derived 3D human cortical spheroids (hCS)19–21, which are regionalized brain organoids that show high reliability of differentiation22”
    Quote in the paperNot a substantial claim0 of 4 sources checked
    • cites [19] Pasca, A. M. et al. Functional cortical neurons and astrocytes from human pluripotent stem cells in 3D culture. Nat. Methods 12, 671–678 (2015). source

      Not checked in the free run.

    • cites [20] Sloan, S. A., Andersen, J., Pasca, A. M., Birey, F. & Pasca, S. P. Generation and assembly of human brain region-specific three-dimensional cultures. Nat. Protoc. 13, 2062–2085 (2018). source

      Not checked in the free run.

    • cites [21] Sloan, S. A. et al. Human astrocyte maturation captured in 3D cerebral cortical spheroids derived from pluripotent stem cells. Neuron 95, 779–790 (2017). source

      Not checked in the free run.

    • cites [22] Yoon, S. J. et al. Reliability of human cortical organoid generation. Nat. Methods 16, 75–78 (2019). source

      Not checked in the free run.

  • Probably not a substantial claim: may not pass S3 (load-bearing).

    Premisecitation

    The 22q11.2 microdeletion confers a 30-40% risk for autism spectrum disorder.

    “This microdeletion also confers a 30–40% risk for ASD7,8.”
    Quote in the paperNot a substantial claim0 of 2 sources checked
    • cites [7] Vorstman, J. A. et al. The 22q11.2 deletion in children: high rate of autistic disorders and early onset of psychotic symptoms. J. Am. Acad. Child Adolesc. Psychiatry 45, 1104–1113 (2006). source

      Not checked in the free run.

    • cites [8] Olsen, L. et al. Prevalence of rearrangements in the 22q11.2 region and population-based risk of neuropsychiatric and developmental disorders in a Danish population: a case-cohort study. Lancet Psychiatry 5, 573–580 (2018). source

      Not checked in the free run.

  • Classified as probably not a substantial claim. May combine two claims.

    Premisecitation

    A common feature of many antipsychotics is modulation of dopamine D2 receptor function, which has been linked to clinical response.

    “A common feature of many antipsychotics is a modulation of dopamine D2 receptor function, which has been linked to clinical response46,47.”
    Quote in the paperSubstantial claim0 of 2 sources checked
    • cites [46] Seeman, P., Lee, T., Chau-Wong, M. & Wong, K. Antipsychotic drug doses and neuroleptic/dopamine receptors. Nature 261, 717–719 (1976). source

      Not checked in the free run.

    • cites [47] Kapur, S., Zipursky, R., Jones, C., Remington, G. & Houle, S. Relationship between dopamine D2 occupancy, clinical response and side effects: a double-blind PET study of first-episode schizophrenia. Am. J. Psychiatry 157, 514–520 (2000). source

      Not checked in the free run.

  • Probably not a substantial claim: may not pass S2 (checkable), S3 (load-bearing). May combine two claims.

    Interpretationown data

    Such changes could shape the formation of cortical circuits and contribute to disease susceptibility.

    “Nonetheless, such changes could shape the formation of cortical circuits and contribute to disease susceptibility.”
    Quote in the paperNot a substantial claim

  • Probably not a substantial claim: may not pass S3 (load-bearing). May combine two claims.

    Premisereasoning

    Previous models for 22q11DS have provided pathophysiological clues, but effective therapeutics for mental illness in 22q11DS are still far from developed.

    “Previous models for this disease have provided pathophysiological clues9,10,54, but we are still far from developing effective therapeutics for mental illness in 22q11DS.”
    Quote in the paperNot a substantial claim0 of 3 sources checked
    • cites [9] Drew, L. J. et al. The 22q11.2 microdeletion: fifteen years of insights into the genetic and neural complexity of psychiatric disorders. Int. J. Dev. Neurosci. 29, 259–281 (2011). source

      Not checked in the free run.

    • cites [10] Karayiorgou, M., Simon, T. J. & Gogos, J. A. 22q11.2 microdeletions: linking DNA structural variation to brain dysfunction and schizophrenia. Nat. Rev. Neurosci. 11, 402–416 (2010). source

      Not checked in the free run.

    • cites [54] Chun, S., Bayazitov, I. T., Blundon, J. A. & Zakharenko, S. S. Thalamocortical long-term potentiation becomes gated after the early critical period in the auditory cortex. J. Neurosci. 33, 7345–7357 (2013). source

      Not checked in the free run.

  • Classified as probably not a substantial claim. May combine two claims.

    Premisecitation

    DGCR8 works in a complex with DROSHA and regulates the expression of many transcripts.

    “DGCR8 works in a complex with an RNAse, DROSHA, and regulates the expression of many transcripts30.”
    Quote in the paperSubstantial claim0 of 1 sources checked
    • cites [30] Han, J. et al. The Drosha–DGCR8 complex in primary microRNA processing. Genes Dev. 18, 3016–3027 (2004). source

      Not checked in the free run.

  • Probably not a substantial claim: may not pass S3 (load-bearing).

    Premisecitation

    Several reports have confirmed an association between the LTCC CACNA1C gene and neurodevelopmental disorders.

    “Several reports have now confirmed an association between the LTCC CACNA1C gene and neurodevelopmental disorders25,58.”
    Quote in the paperNot a substantial claim0 of 2 sources checked
    • cites [25] Cross-Disorder Group of the Psychiatric Genomics Consortium. Identification of risk loci with shared effects on five major psychiatric disorders: a genome-wide analysis. Lancet 381, 1371–1379 (2013). source

      Not checked in the free run.

    • cites [58] Schizophrenia Working Group of the Psychiatric Genomics Consortium. Biological insights from 108 schizophrenia-associated genetic loci. Nature 511, 421–427 (2014). source

      Not checked in the free run.

  • Probably not a substantial claim: may not pass S3 (load-bearing).

    Premisecitation

    In contrast to the reduced calcium rise in 22q11DS, Timothy syndrome shows increased calcium rise.

    “Interestingly, by contrast to the reduced [Ca2+]i in 22q11DS, we recently reported increased [Ca2+]i in Timothy syndrome, a monogenic ASD23.”
    Quote in the paperNot a substantial claim0 of 1 sources checked
    • cites [23] Pașca, S. P. et al. Using iPSC-derived neurons to uncover cellular phenotypes associated with Timothy syndrome. Nat. Med. 17, 1657–1662 (2011). source

      Not checked in the free run.

  • Probably not a substantial claim: may not pass S3 (load-bearing).

    Interpretationreasoning

    It is possible that other disorders on the schizophrenia or autism spectrum may display convergence of multiple signaling defects in pathways suggested by GWAS.

    “It is therefore possible that similar to 22q11DS, other disorders on the schizophrenia or autism spectrum may display convergence of multiple signaling defects in pathways suggested by GWAS.”
    Quote in the paperNot a substantial claim

  • Probably not a substantial claim: may not pass S3 (load-bearing).

    Premisecitation

    Microdeletions at the 22q11.2 locus are the most frequent interstitial deletion in humans.

    “Microdeletions at the 22q11.2 locus are the most frequent interstitial deletion in humans53.”
    Quote in the paperNot a substantial claim0 of 1 sources checked
    • cites [53] Kobrynski, L. J. & Sullivan, K. E. Velocardiofacial syndrome, DiGeorge syndrome: the chromosome 22q11.2 deletion syndromes. Lancet 370, 1443–1452 (2007). source

      Not checked in the free run.

  • May combine two claims.

    Interpretationreasoning

    Any level of alteration in DGCR8 would presumably have downstream effects on protein production and potentially neuronal physiology.

    “Thereby, any level of alteration in DGCR8 would presumably have downstream effects on protein production and, potentially, neuronal physiology.”
    Quote in the paperNot a substantial claim

  • May combine two claims.

    Interpretationown data

    Neural differentiations are highly reliable, and 22q11DS is not associated with major defects in corticogenesis.

    “Importantly, we showed that neural differentiations are highly reliable and 22q11DS is not associated with major defects in corticogenesis.”
    Quote in the paperSubstantial claim

  • May combine two claims.

    Premisecitation

    DGCR8 is a component of the microprocessor complex involved in microRNA biogenesis, has been associated with neuronal defects in rodent models, and has a high potential to dysregulate downstream target genes contributing to neuronal phenotype.

    “One of the genes deleted in the 22q11.2 region is DGCR8– a component of the microprocessor complex involved in microRNA biogenesis30, has been associated with neuronal defects in rodent models of disease, and therefore has an outsized potential to dysregulate downstream target genes contributing to neuronal phenotype11,42.”
    Quote in the paperSubstantial claim0 of 3 sources checked
    • cites [30] Han, J. et al. The Drosha–DGCR8 complex in primary microRNA processing. Genes Dev. 18, 3016–3027 (2004). source

      Not checked in the free run.

    • cites [11] Chun, S. et al. Specific disruption of thalamic inputs to the auditory cortex in schizophrenia models. Science 344, 1178–1182 (2014). source

      Not checked in the free run.

    • cites [42] Schofield, C. M. et al. Monoallelic deletion of the microRNA biogenesis gene Dgcr8 produces deficits in the development of excitatory synaptic transmission in the prefrontal cortex. Neural Dev. 6, 11 (2011). source

      Not checked in the free run.

  • May combine two claims.

    Interpretationown data

    Electrophysiological and imaging experiments confirmed increased excitability and impaired depolarization-induced LTCC calcium signaling in 22q11DS-derived neurons, related to a resting membrane potential defect that caused voltage-dependent inactivation of calcium channels.

    “Electrophysiological and imaging experiments confirmed an increase in excitability and an impaired depolarization–induced LTCC calcium signaling in 22q11DS–derived neurons, which were related to a defect in the RMP that caused voltage–dependent inactivation of calcium channels.”
    Quote in the paperSubstantial claim

  • May combine two claims.

    Premisecitation

    Modulation of LTCC by D2 receptors in neurons is well established, and blocking D2 receptors can increase LTCC activity by multiple pathways.

    “The modulation of LTCC by D2 receptors in neurons is well established, and blocking of D2 receptors can increase the activity of LTCC by multiple pathways27,48.”
    Quote in the paperSubstantial claim0 of 2 sources checked
    • cites [27] Yasumoto, F. et al. Dopamine receptor 2 regulates L-type voltage-gated calcium channel in primary cultured mouse midbrain neural network. Cell. Mol. Neurobiol. 24, 877–882 (2004). source

      Not checked in the free run.

    • cites [48] Hernandez-Lopez, S. et al. D2 dopamine receptors in striatal medium spiny neurons reduce L-type Ca2+ currents and excitability via a novel PLCβ1-IP3-calcineurin-signaling cascade. J. Neurosci. 20, 8987–8995 (2000). source

      Not checked in the free run.

  • Probably not a substantial claim: may not pass S3 (load-bearing). May combine two claims.

    Study design and conductnone given

    Mycoplasma testing was performed regularly, and cultures were kept free of mycoplasma.

    “Cultures were regularly tested for mycoplasma and maintained mycoplasma free.”
    Quote in the paperNot a substantial claim

  • Probably not a substantial claim: may not pass S3 (load-bearing).

    Study design and conductown data

    Power analysis was performed using the PROPER package.

    “Power analysis was performed using the PROPER package (v1.10.0)73 in R.”
    Quote in the paperNot a substantial claim0 of 1 sources checked
    • cites [73] Wu, H., Wang, C. & Wu, Z. PROPER: comprehensive power evaluation for differential expression using RNA-seq. Bioinformatics 31, 233–241 (2015). source

      Not checked in the free run.

  • Classified as probably not a substantial claim. May combine two claims.

    Study design and conductcitation

    Batch effects were accounted for by including batch as a covariate in the linear model or by using the Combat function from the sva package.

    “Batch effect were accounted for by either including batch as a covariate in the linear model (allowing for correct estimation of degrees of freedom) or by Combat function form the sva package in R (for PCA and correlation analysis)67.”
    Quote in the paperSubstantial claim0 of 1 sources checked
    • cites [67] Johnson, W. E., Li, C. & Rabinovic, A. Adjusting batch effects in microarray expression data using empirical Bayes methods. Biostatistics 8, 118–127 (2007). source

      Not checked in the free run.

  • Probably not a substantial claim: may not pass S3 (load-bearing). May combine two claims.

    Study design and conductown data

    Off-target candidates were predicted using the COSMID tool, and integrity was confirmed by Sanger sequencing at the top three off-target candidates.

    “Off target candidates were predicted using COSMID46 tool (https://crispr.bme.gatech.edu). Integrity was confirmed by Sanger sequencing at top 3 off–target candidates (Chr6:138404602–138404624 GCGCCGACTCGGGAGCGGAGGGG, Chr3:52534180–52534202 GGGCGGACCCGGGAGCGGAGAGG, Chr3:49902616–49902638 GGGCACCCACTGGAGCGGAGTGG)”
    Quote in the paperNot a substantial claim0 of 1 sources checked
    • cites [46] Seeman, P., Lee, T., Chau-Wong, M. & Wong, K. Antipsychotic drug doses and neuroleptic/dopamine receptors. Nature 261, 717–719 (1976). source

      Not checked in the free run.

  • Classified as probably not a substantial claim.

    Study design and conductnone given

    Control and 22q11DS lines were balanced across batches.

    “Batches were balanced for control and 22q11DS lines.”
    Quote in the paperSubstantial claim

  • Probably not a substantial claim: may not pass S2 (checkable). May combine two claims.

    Interpretationreasoning

    These findings support the value of a major mutational model for elucidating the biology of complex neuropsychiatric disorders and open the avenue for uncovering therapeutics.

    “These findings support the value of a major mutational model for elucidating the biology of complex neuropsychiatric disorders and open the avenue for uncovering therapeutics.”
    Quote in the paperNot a substantial claim

  • Probably not a substantial claim: may not pass S3 (load-bearing).

    Study design and conductown data

    Sample identity was verified using the identity-by-descent algorithm from PLINK, with a threshold of PI_HAT < 0.8.

    “Sample identity was verified using the identity by descent (IBD) algorithm from PLINK (1.09). IBD was calculated for each sample based on genotypes derived from the RNA–seq analysis and a threshold of PI_HAT< 0.8 was set.”
    Quote in the paperNot a substantial claim

  • Classified as probably not a substantial claim.

    Study design and conductreasoning

    Samples from both control and 22q11DS lines were re-sequenced at day 75 to account for batch splitting.

    “To account for this, samples from both control and 22q11DS lines were re–sequenced at one time point (day 75).”
    Quote in the paperSubstantial claim

  • Probably not a substantial claim: may not pass S3 (load-bearing).

    Study design and conductown data

    Technical variation in RNA sequencing was controlled by including the first twenty sequencing principal components in the model.

    “Picard sequencing metrics (http://broadinstitute.github.io/picard/, v2.5.0) were summarized using the first twenty principal components (seqPCs). These seqPCs were then included in the model to control for technical variation in the RNA sequencing.”
    Quote in the paperNot a substantial claim

  • Classified as probably not a substantial claim.

    Study design and conductnone given

    The differential expression model included fixed covariates for differentiation day, sex, batch, genetic ancestry principal components, and sequencing principal components.

    “Fixed covariates that were included were differentiation day, sex, batch, the first two PCs calculated for genetic ancestry and twenty sequencings PCs (SeqPCs; see above).”
    Quote in the paperSubstantial claim

  • Probably not a substantial claim: may not pass S1 (asserted), S3 (load-bearing), S4 (based). The quote only partly states this claim.

    Study design and conductnone given

    Patch-clamp recordings from hCS neurons were performed without knowledge of sample disease status.

    “Experiments were conducted blind to the disease status of the samples.”
    Quote in the paperNot a substantial claim

  • Classified as probably not a substantial claim.

    Study design and conductcitation

    Cortical neural progenitor cells and neurons were derived from hiPS cells using a protocol that had been previously described and validated.

    “The differentiation of hiPS cells into cortical neural progenitor cells (NPCs) and neurons was carried using a previously described and validated protocol23.”
    Quote in the paperSubstantial claim0 of 1 sources checked
    • cites [23] Pașca, S. P. et al. Using iPSC-derived neurons to uncover cellular phenotypes associated with Timothy syndrome. Nat. Med. 17, 1657–1662 (2011). source

      Not checked in the free run.

  • Probably not a substantial claim: may not pass S3 (load-bearing).

    Study design and conductown data

    HPLC measurements were made without knowledge of whether samples came from cases or controls.

    “Experiments were conducted blind to the disease status of the samples.”
    Quote in the paperNot a substantial claim

  • Probably not a substantial claim: may not pass S3 (load-bearing).

    Study design and conductown data

    Sex was verified for each hiPS cell line by detecting expression of Y-chromosome genes.

    “Additionally, for each hiPS cell line, the sex was verified by detection of genes expressed by the Y–chromosome.”
    Quote in the paperNot a substantial claim

  • Probably not a substantial claim: may not pass S1 (asserted), S3 (load-bearing), S4 (based). May combine two claims. The quote only partly states this claim.

    Study design and conductnone given

    Simultaneous patch clamping and calcium imaging were done without knowledge of sample disease status.

    “Experiments were conducted blind to the disease status of the samples.”
    Quote in the paperNot a substantial claim

  • Classified as probably not a substantial claim.

    Study design and conductown data

    A mixed linear model accounted for multiple samples from the same individual, hiPS cell line, and differentiation, as well as for samples sequenced more than once.

    “A mixed linear model was used to account for multiple samples coming from the same individual, hiPS cell line and differentiation as well as to account for samples which were sequenced more than once.”
    Quote in the paperSubstantial claim

  • Probably not a substantial claim: may not pass S3 (load-bearing).

    Study design and conductnone given

    The initial calcium phenotyping experiments were performed without knowledge of sample disease status.

    “Experiments in the initial calcium phenotyping assay were conducted blind to the disease status.”
    Quote in the paperNot a substantial claim

  • Probably not a substantial claim: may not pass S3 (load-bearing).

    Study design and conductnone given

    For differentiation, hiPS cell lines were chosen at random from each genotype.

    “hiPS cell lines were randomly selected for differentiation from each genotype.”
    Quote in the paperNot a substantial claim

  • Probably not a substantial claim: may not pass S3 (load-bearing).

    Study design and conductcitation

    Some of the hiPS cell lines used in this study had been extensively characterized in previous work by immunostaining, karyotyping, teratoma formation in nude mice, and mapping of viral integration sites.

    “Some of the hiPS cell lines used in this study were extensively characterized previously23,61 using immunostaining with anti–NANOG and TRA 2–49/6E antibodies, karyotyping, generation of teratoma in nude mice and mapping of viral integration sites (Extended Data Fig. 1a).”
    Quote in the paperNot a substantial claim0 of 2 sources checked
    • cites [23] Pașca, S. P. et al. Using iPSC-derived neurons to uncover cellular phenotypes associated with Timothy syndrome. Nat. Med. 17, 1657–1662 (2011). source

      Not checked in the free run.

    • cites [61] Yazawa, M. et al. Using induced pluripotent stem cells to investigate cardiac phenotypes in Timothy syndrome. Nature 471, 230–234 (2011). source

      Not checked in the free run.

  • Classified as probably not a substantial claim.

    Study design and conductown data

    Electrophysiology in 2D neurons was performed without knowledge of sample disease status.

    “Experiments were conducted blind to the disease status of the samples in neurons at 50–70 days of differentiation in vitro.”
    Quote in the paperSubstantial claim
71 of 71

  • The authors state this as an assumption.

    The batch splitting created a larger positive difference between cases and controls, which should lead to a right-shifted or skewed distribution.

    “This expectation for a right skewed distribution results from the assumption that the splitting created a larger (positive) difference between the cases and controls which should lead to a right shifted or skewed distribution.”
1 of 1

Claims other papers make about this one

Each is checked against this paper’s own text: does it say what the citing paper says it does?

  • Antipsychotics could restore the functional defects found in 22q11.2 deletion syndrome, providing further justification for the use of iPSC-derived organoids as a relevant model for disease modeling.

    “The authors showed that antipsychotics could restore the functional defects found in 22q11.2 deletion syndrome providing further justification for the use of iPSC-derived organoids as a relevant model for disease modeling [65].”

    From Utility of iPSC-Derived Cells for Disease Modeling, Drug Development, and Cell Therapy (2022) · cites this paper as [65]

  • 100 day cerebral cortical organoids derived from patients with 22q11.2 deletion syndrome had deficits in spontaneous neuronal activity and calcium signaling.

    “Another study using 100 day cerebral cortical organoids showed that organoids derived from patients with 22q11.2 deletion syndrome had deficits in spontaneous neuronal activity and calcium signaling.”

    From Utility of iPSC-Derived Cells for Disease Modeling, Drug Development, and Cell Therapy (2022) · cites this paper as [65]

Self-check

Percentages, sums and reported differences re-computed from the paper’s own numbers.

Each contradiction between two passages listed here was confirmed by an independent check.

  • Figure caption reverses the stated differential-expression threshold

    Minor

    The Methods define differentially expressed genes using FDR below 0.05, whereas the Extended Data Fig. 4 caption says asterisks marking differential expression use FDR above 0.05.

  • Co-culture result has conflicting P values

    Minor

    The Results and the caption for Extended Data Fig. 6f give different P values for the co-cultured-neuron calcium comparison.

  • Patient cohort is reported as both 15 and 16 subjects

    Minor

    The Results describe a cohort of 15 patients with 22q11DS, but the Methods say the 43 hiPS cell lines came from 16 patients.

3 of 3

Cites

Flagged first, then by citations

2 of the 82 references couldn’t be matched to a known paper.

Research works printed but not linked: 1

  1. Korotkevich, G., Sukhov, V. & Sergushichev, A. Fast gene set enrichment analysis. Preprint at bioRxiv 060012 https://www.biorxiv.org/content/10.1101/060012v2 (2019). · DOI

Cited by

Sorted by citations

Related

Authors
Khan, T. A., Revah, O., Gordon, A., Yoon, S.-J., Krawisz, A. K., Goold, C., Sun, Y., Kim, C. H., Tian, Y., Li, M.-Y., Schaepe, J. M., Ikeda, K., Amin, N. D., Sakai, N., Yazawa, M., Kushan, L., Nishino, S., Porteus, M. H., Rapoport, J. L., Bernstein, J. A., O’Hara, R., Bearden, C. E., Hallmayer, J. F., Huguenard, J. R., Geschwind, D. H., Dolmetsch, R. E., & Paşca, S. P.
Affiliations
  • Stanford Medicine (US)
  • University of California, Los Angeles (US)
  • Beth Israel Deaconess Medical Center (US)
  • Yonsei University (KR)
  • National Institute of Mental Health (US)
ORCID
Venue
Nature Medicine
Publisher
Springer Science and Business Media LLC
Published
2020-09-28
Volume
26
Issue
12
Pages
1888-1898
ISSN
  • 1078-8956 (ISSN-L)
  • 1546-170X
DOI
10.1038/s41591-020-1043-9
PMC
PMC8525897
OpenAlex
W3091490674
Semantic Scholar
8d9001376156fc2b4b2a6f4a69591c78af571c64
Cited by
186
References
82
Citations by year
2026: 22 · 2025: 35 · 2024: 33 · 2023: 28 · 2022: 45 · 2021: 21 · 2020: 2
FWCI
7.78
Type
journal article
Language
en
Open access
Licence
Locations
  • Nature Medicine (publishedVersion)
  • PubMed (publishedVersion)
  • PubMed Central (acceptedVersion)
  • eScholarship (California Digital Library) (submittedVersion)
  • YUHSpace (Yonsei University Medical Library) (submittedVersion, cc-by-nc-nd)
Funders
  • Howard Hughes Medical Institute
  • National Institutes of Health (5r01mh094714-04)
  • National Institute of Mental Health (R01-MH094714, R01MH107800, U01MH115745, R01MH085953, R01MH100900, U01MH115746, R01MH121075, R37MH060233, R37MH085953)
  • National Institute of Neurological Disorders and Stroke (R01NS034774)
Topics
  • Life Sciences › Biochemistry, Genetics and Molecular Biology › Molecular Biology › Pluripotent Stem Cells Research
  • Life Sciences › Biochemistry, Genetics and Molecular Biology › Genetics › Genomic variations and chromosomal abnormalities
  • Life Sciences › Neuroscience › Developmental Neuroscience › Neurogenesis and neuroplasticity mechanisms
Keywords
22q11.2 deletion syndrome, induced pluripotent stem cells, neuronal excitability, calcium signaling, voltage-gated calcium channels, resting membrane potential, DGCR8, spontaneous neuronal activity, neuropsychiatric disorders, gene expression profiling
MeSH terms
Adult, Cell Differentiation, Cerebral Cortex, DiGeorge Syndrome, Female, Humans, Male, Neurons, Organoids, Calcium Signaling, Young Adult, Induced Pluripotent Stem Cells

About these checks

Registry, retraction, Cites and statistics results are computed, not judged, with one exception: a printed reference that no index lists is read once by a model before it counts as a citation error. Claims are extracted by a model and kept only when their quote appears verbatim in the text; each cited source is then checked, with a model’s help, for whether it says what the claim relies on. Those verdicts can be wrong — read the claim’s quote and the cited source before relying on one.

Claims read by deepseek-v4.1-flash under definition version 3 (extract-v3) on 2026-10-07.

Classified by jev-1.13-20260917 (gold-guideline-v0.2) on 2026-10-07.

Statistics and arithmetic are recomputed, not judged.

Confidence bands are shown only for fields calibrated on our annotated test set. None is calibrated yet, so no band is shown.

What counts as a claim ›How we measure confidence ›How we check this ›

Are you an author, or do you see a problem with this page? Request a review