CoChat
Sign Up
Cited by 53Cholesterol and Lipid MetabolismCellular transport and secretionLipid metabolism and biosynthesis

The DOI matches its Crossref record; 41 of the 43 references it cites were found in a registry or an index; none of the 21 sources its claims cite is checked for support yet.

EHD1 regulates cholesterol homeostasis and lipid droplet storage

Open access
Naslavsky, Naava, Rahajeng, Juliati, Rapaport, Debora, Horowitz, Mia, Caplan, Steve·2007·Biochemical and Biophysical Research Communications
DOI 10.1016/j.bbrc.2007.04.022PMC PMC1978283
Open this paper in CoChat — free account

Abstract

Endocytic transport is critical for the subcellular distribution of free cholesterol and the endocytic recycling compartment (ERC) is an important organelle that stores cholesterol and regulates its trafficking. The C-terminal EHD protein, EHD1, controls receptor recycling through the ERC and affects free cholesterol distribution in the cell. We utilized embryonic fibroblasts from EHD1 knockout mice (Ehd1(-/-)MEF) and SiRNA in normal MEF cells to assess the role of EHD1 in intracellular transport of cholesterol. Surprisingly, Ehd1(-/-)MEFs displayed reduced levels of esterified and free cholesterol, which returned to normal level upon re-introduction of wild-type, but not dysfunctional EHD1. Moreover, triglyceride and cholesterol storage organelles known as 'lipid droplets' were smaller in size in cells lacking EHD1, indicating that less esterified cholesterol and triglycerides were being stored. Decreased cellular cholesterol and reduced lipid droplet size in Ehd1(-/-)MEFs correlated with ineffectual cholesterol uptake via LDL receptor, suggesting involvement of EHD1 in LDL receptor internalization.

Overview

AI snapshot

Written from the paper’s full text.

TL;DR

EHD1 loss in mouse embryonic fibroblasts reduces cellular free and total cholesterol and decreases lipid droplet size, while wild-type EHD1 re-expression rescues cholesterol levels. The authors propose that EHD1 supports cholesterol homeostasis and lipid droplet storage by enabling LDL-derived cholesterol uptake/internalization.

Key findings

  • Ehd1−/− MEFs had reduced Filipin staining by flow cytometry: mean count 74.8 versus 202 in Ehd1+/+ MEFs, i.e. 37% of control; total cholesterol (esterified and free) was also reduced about two-fold.
  • Re-introduction of wild-type Myc-EHD1 into Ehd1−/− MEFs restored Filipin staining toward control levels, whereas dysfunctional mutants Myc-EHD1 ΔEH and Myc-EHD1 G65R did not.
  • After oleic acid loading, lipid droplets were greatly reduced in size in Ehd1−/− MEFs, although ADRP levels remained intact; EHD1 partially localized to lipid droplets in HeLa and MEF cells.
  • Upon LDL uptake, Ehd1+/+ MEFs showed enhanced Filipin staining and enlarged ADRP-coated lipid droplets, while Ehd1−/− MEFs showed little increase in Filipin staining and little or no change in lipid droplet size.

Methods

  • Used primary and SV40-transformed MEFs from EHD1 knockout mice (Ehd1−/−) and normal counterparts (Ehd1+/+), plus siRNA knockdown of EHD1 in Ehd1+/+ MEFs, confirmed by immunoblotting with >90% knockdown.
  • Measured free cholesterol by Filipin staining with flow cytometry (at least 10,000 cells per sample) and total cholesterol/cholesteryl ester with the Amplex Red Cholesterol kit.
  • Performed immunofluorescence/confocal microscopy with Nile Red, BODIPY-(C12)-fatty acid, oleic acid, ADRP, Filipin, and LDL; rescue experiments used wild-type and mutant Myc-EHD1.

Limitations

  • The paper states possible explanations for reduced lipid droplet size—impaired ACAT activity or enhanced nCEH-mediated efflux—but does not directly test these; it instead hypothesizes impaired LDL-derived cholesterol internalization.
  • Evident from the text: the LDL receptor internalization conclusion is inferential, as no direct LDL receptor internalization or binding assay is reported.
  • Evident from the text: findings are from cultured MEF and HeLa cells, with no in vivo data.

Model-written summary. Check it against the paper before relying on it.

Integrity signals

Registry

Crossref · 10.1016/j.bbrc.2007.04.022

Cites

41 of 41 references verified0 citation errors · 0 not checkable

Statistics

Nothing to recompute.

Verification

Claims the paper makes

0 of 21 cited sources checked · 0 supported · 0 flagged

  • Findingown data
    § Abstract

    Loss of EHD1 reduces cellular levels of free and esterified cholesterol in mouse embryonic fibroblasts.

    “Ehd1-/-MEFs displayed reduced levels of esterified and free cholesterol”
    • Also stated in: § Results and Discussion · plain
      “Knock-down of EHD1 reduces cellular levels of total cholesterol”
    • Also stated in: § Results and Discussion · boosted
      “Total cholesterol levels (esterified and free), extracted from an equivalent number of Ehd1+/+ and Ehd1-/-MEFs were also examined (Fig. 1I), demonstrating a similar ˜two-fold reduction.”
    Quote in the paperSubstantial claim
    • Rests on an assumption: The EHD1-specific siRNA oligonucleotide sequence has no significant overlap with other mouse genes, including those coding for other C-terminal EHD proteins.
  • Findingown data
    § Results and Discussion

    EHD1 partially localizes to lipid droplets in HeLa cells transfected with Myc-EHD1 and in MEF cells.

    “a portion of Myc-EHD1 (red) localized to (green) fatty acid-labeled lipid droplets (see inset Fig. 3H; arrows)”
    • Also stated in: § Results and Discussion · plain
      “partial co-localization of endogenous EHD1 (green) was also observed with Nile Red labeled lipid droplets loaded with oleic acid (Fig. 3I and inset; J).”
    Quote in the paperSubstantial claim
  • Findingown data
    § Abstract

    Re-introduction of wild-type EHD1, but not dysfunctional EHD1 mutants, restores free cholesterol levels in Ehd1-/- MEFs.

    “returned to normal level upon re-introduction of wild-type, but not dysfunctional EHD1”
    • Also stated in: § Results and Discussion · plain
      “Ehd1-/-MEFs that were transfected with wild-type Myc-EHD1 (Fig. 2B (star), C and inset) displayed levels of Filipin staining approximating those of the control Ehd1+/+MEF cells (Fig. 2A).”
    • Also stated in: § Results and Discussion · plain
      “Ehd1-/-MEF cells transfected with two previously described dysfunctional EHD1 mutants, Myc-EHD1 ΔEH and Myc-EHD1 G65R (Fig. 2D-G; stars)[15,18], showed no significant difference in Filipin staining when compared with untransfected Ehd1-/-MEF counterparts.”
    Quote in the paperSubstantial claim0 of 2 sources checked
    • cites [15] Holtta-Vuori, 2002, Modulation of cellular cholesterol transport and homeostasis by Rab11, Mol. Biol. Cell source
    • cites [18] Mintz, 1999, EHD1—an EH-domain-containing protein with a specific expression pattern, Genomics source
  • Findingown data
    § Results and Discussion

    Lipid droplets are smaller in Ehd1-/- MEFs than in Ehd1+/+ MEFs after oleic acid-induced lipid storage.

    “Comparison of the lipid droplet distribution and size in Ehd1+/+ (Fig. 3A-C) vs. Ehd1-/-MEF cells (Fig. 3D-F) revealed dramatic differences, with droplets being greatly reduced in size in the Ehd1-/-MEF cells.”
    Quote in the paperSubstantial claim
  • Interpretationown data
    § Abstract

    EHD1 is involved in LDL receptor internalization.

    “suggesting involvement of EHD1 in LDL receptor internalization”
    • Also stated in: § Results and Discussion · hedged
      “we hypothesized that EHD1 might affect cellular cholesterol homeostasis by regulating LDL transport via its receptor”
    Quote in the paperSubstantial claim
  • It may state two separate claims as one. 6
  • Probably not a substantial claim. 7

  • It may state two separate claims as one.

    Findingown data
    § Results and Discussion

    LDL uptake increases free cholesterol and lipid droplet size in Ehd1+/+ MEFs but not in Ehd1-/- MEFs.

    “upon LDL uptake, Ehd1+/+MEF cells showed markedly enhanced Filipin staining (Fig. 4E), indicating that free cholesterol had been internalized along with LDL. Accordingly, ADRP-coated lipid droplets were also enlarged (Fig. 4F; G is a higher magnification of a single cell)”
    • Also stated in: § Results and Discussion · plain
      “Ehd1-/-MEF cells showed little increase in Filipin staining even after 18 h LDL uptake (Fig. 4H), and little or no change in lipid droplet size was seen with ADRP staining (Fig. 4I; J is a higher magnification of a single cell).”
    Quote in the paperSubstantial claim

  • Probably not a substantial claim.

    Interpretationreasoning
    § Abstract

    Impaired internalization of LDL-derived cholesterol is a possible cause of decreased esterified and free cholesterol and reduced lipid droplet size in cells lacking EHD1.

    “Decreased cellular cholesterol and reduced lipid droplet size in Ehd1-/-MEFs correlated with ineffectual cholesterol uptake via LDL receptor, suggesting involvement of EHD1 in LDL receptor internalization.”
    • Also stated in: § Results and Discussion · hedged
      “we hypothesize that impaired internalization of LDL-derived cholesterol is a possible cause for the decreased levels in esterified and free cholesterol in cells lacking EHD1 and for their reduced size of lipid droplets.”
    Quote in the paperSubstantial claim

  • Probably not a substantial claim. The paper’s conclusions may not depend on it.

    Premisecitation
    § Introduction

    EHD1 plays a critical role in recycling of plasma membrane receptors (e.g., transferrin) internalized through clathrin-coated pits or independently of clathrin.

    “EHD1 [14] has been found to play a critical role in the recycling of plasma membrane receptors (ie., transferrin) that are internalized either through clathrin-coated pits [15-17], or independently of clathrin (MHC-I or β1 integrins) [18,19].”
    Quote in the paperNot a substantial claim0 of 5 sources checked
    • cites [15] Holtta-Vuori, 2002, Modulation of cellular cholesterol transport and homeostasis by Rab11, Mol. Biol. Cell source
    • cites [16] Naslavsky, 2005, C-terminal EH-domain-containing proteins: consensus for a role in endocytic trafficking, EH?, J. Cell Sci. source
    • cites [17] Haider, 1999, Evaluation and molecular characterization of EHD1, a candidate gene for Bardet-Biedl syndrome 1 (BBS1), Gene source
    • cites [18] Mintz, 1999, EHD1—an EH-domain-containing protein with a specific expression pattern, Genomics source
    • cites [19] Lin, 2001, Rme-1 regulates the distribution and function of the endocytic recycling compartment in mammalian cells, Nat. Cell Biol. source

  • It may state two separate claims as one.

    Premisecitation
    § Introduction

    The endocytic recycling compartment (ERC) is a major sterol storage organelle and an important station for cholesterol in the endocytic pathway.

    “the tubulo-vesicular endocytic recycling compartment [9,10], which has also been defined as a major sterol storage organelle [11]”
    • Also stated in: § Introduction · plain
      “Since the ERC has been described as an important station for cholesterol in the endocytic pathway [11]”
    Quote in the paperSubstantial claim0 of 1 sources checked
    • cites [11] Zhao, 2005, Redistribution of macrophage cholesteryl ester hydrolase from cytoplasm to lipid droplets upon lipid loading, J. Lipid Res. source

  • It may state two separate claims as one.

    Interpretationown data
    § Title

    EHD1 regulates cholesterol homeostasis and lipid droplet storage.

    “EHD1 regulates cholesterol homeostasis and lipid droplet storage”
    • Also stated in: § Results and Discussion · hedged
      “These results are consistent with a role for EHD1 in the regulation of cellular cholesterol homeostasis and lipid droplet biogenesis.”
    Quote in the paperSubstantial claim

  • It may state two separate claims as one.

    Premisecitation
    § Introduction

    EHD1 interacts with Rab11-FIP2 and regulates transport of Rab11-FIP2- and Rab11-containing vesicles.

    “we have also demonstrated an interaction between EHD1 and the Rab11 effector protein, Rab11-FIP2, suggesting that EHD1 regulates the transport of Rab11-FIP2- and Rab11-containing vesicles [21].”
    Quote in the paperNot a substantial claim0 of 1 sources checked
    • cites [21] Rapaport, 2006, Recycling to the plasma membrane is delayed in EHD1 knockout mice, Traffic source

  • Probably not a substantial claim. It may state two separate claims as one.

    Premisecitation
    § Introduction

    Overexpression of Rab11 causes accumulation of cholesterol in the ERC and inhibits cholesterol esterification.

    “overexpression of Rab11, a key GTPase involved in the regulation of recycling from the ERC, caused the accumulation of cholesterol in this compartment and inhibited cholesterol esterification [12].”
    Quote in the paperSubstantial claim0 of 1 sources checked
    • cites [12] Mukherjee, 1998, Cholesterol distribution in living cells: fluorescence imaging using dehydroergosterol as a fluorescent cholesterol analog, Biophys. J. source

  • Probably not a substantial claim.

    Premisecitation
    § Introduction

    Much of the free cholesterol within the endocytic pathway resides in the ERC.

    “Recent studies have determined that much of the free cholesterol within the endocytic pathway resides in the tubulo-vesicular endocytic recycling compartment [9,10]”
    Quote in the paperSubstantial claim0 of 2 sources checked
    • cites [9] Atshaves, 2001, Sterol carrier protein-2 expression modulates protein and lipid composition of lipid droplets, J. Biol. Chem. source
    • cites [10] Ghosh, 2003, Mobilization of cytoplasmic CE droplets by overexpression of human macrophage cholesteryl ester hydrolase, J. Lipid Res. source

  • Probably not a substantial claim.

    Premisecitation
    § Results and Discussion

    EHD1 has been implicated in the internalization of certain receptors.

    “EHD1 has been implicated in: (I) recycling of receptors to the plasma membrane [ 15,16,18], and (II) in the internalization of certain receptors [29]”
    Quote in the paperSubstantial claim0 of 1 sources checked
    • cites [29] Braun, 2005, EHD proteins associate with syndapin I and II and such interactions play a crucial role in endosomal recycling, Mol. Biol. Cell source

  • Probably not a substantial claim. The paper’s conclusions may not depend on it.

    Premisecitation
    § Results and Discussion

    EHD2 can associate with lipid droplets.

    “Recent reports suggest that the EHD1 paralog, EHD2, can associate with lipid droplets [27,28].”
    Quote in the paperNot a substantial claim0 of 2 sources checked
    • cites [27] Rotem-Yehudar, 2001, Association of insulin-like growth factor 1 receptor with EHD1 and SNAP29, J. Biol. Chem. source
    • cites [28] Xu, 2004, Mutually exclusive interactions of EHD1 with GS32 and syndapin II, Mol. Membr. Biol. source

  • It may state two separate claims as one.

    Premisecitation
    § Results and Discussion

    The EHD1 mutants Myc-EHD1 ΔEH and Myc-EHD1 G65R are dysfunctional.

    “two previously described dysfunctional EHD1 mutants, Myc-EHD1 ΔEH and Myc-EHD1 G65R (Fig. 2D-G; stars)[15,18]”
    Quote in the paperSubstantial claim0 of 2 sources checked
    • cites [15] Holtta-Vuori, 2002, Modulation of cellular cholesterol transport and homeostasis by Rab11, Mol. Biol. Cell source
    • cites [18] Mintz, 1999, EHD1—an EH-domain-containing protein with a specific expression pattern, Genomics source

  • Probably not a substantial claim.

    Premisecitation
    § Results and Discussion

    The addition of fatty acids induces formation of large, detectable lipid droplets in non-adipocyte cells.

    “the addition of fatty acids is known to induce formation of large, detectable lipid droplets [25,26].”
    Quote in the paperSubstantial claim0 of 2 sources checked
    • cites [25] Naslavsky, 2006, Interactions between EHD Proteins and Rab11-FIP2: a role for EHD3 in early endosomal transport, Mol. Biol. Cell source
    • cites [26] Guilherme, 2004, Role of EHD1 and EHBP1 in perinuclear sorting and insulin-regulated GLUT4 recycling in 3T3-L1 adipocytes, J. Biol. Chem. source
12 of 12

  • The paper relies on this without support.

    LDL receptor-mediated internalization of LDL-bound cholesterol is a major source of cellular cholesterol in non-adipose cells.

    “Since LDL receptor-mediated internalization of LDL-bound cholesterol is a major source of cellular cholesterol in non-adipose cells, the endocytic transport of this sterol plays a key role in defining its subcellular distribution.”

  • The paper relies on this without support.

    The EHD1-specific siRNA oligonucleotide sequence has no significant overlap with other mouse genes, including those coding for other C-terminal EHD proteins.

    “The EHD1-specific oligonucleotide sequence (AAGACATCCAGTCTCTGCCGA) (base-pairs 921-942) has no significant overlap with other mouse genes, including those that code for the other C-terminal EHD proteins.”

  • The paper relies on this without support.

    Lipid droplet size tends to reflect overall levels of intracellular cholesterol.

    “the size of lipid droplets (which tends to reflect the overall levels of intracellular cholesterol) was largely dependent upon LDL uptake.”
3 of 3

Citations

Cites

Flagged first, then by citations

2 of the 43 references couldn’t be matched to a known paper.

Cited by

Sorted by citations

Related

Metadata

Authors
Naslavsky, N., Rahajeng, J., Rapaport, D., Horowitz, M., & Caplan, S.
Affiliations
  • University of Nebraska Medical Center (US)
  • Tel Aviv University (IL)
Corresponding author
Caplan, Steve
ORCID
Venue
Biochemical and Biophysical Research Communications
Publisher
Elsevier BV
Published
2007-06
Volume
357
Issue
3
Pages
792-799
ISSN
0006-291X (ISSN-L)
DOI
10.1016/j.bbrc.2007.04.022
PMC
PMC1978283
OpenAlex
W2003180539
Semantic Scholar
c4cd52f80b1e6bd6e53182c63be4932b2ceace96
Cited by
53
References
43
Citations by year
2026: 3 · 2025: 1 · 2024: 2 · 2023: 3 · 2022: 6 · 2020: 2 · 2018: 2 · 2017: 2 · 2016: 3 · 2015: 3 · 2014: 2 · 2013: 1 · 2012: 5
FWCI
1.85
Type
journal article
Language
en
Open access
Licence
Locations
  • Biochemical and Biophysical Research Communications (publishedVersion)
  • PubMed (publishedVersion)
  • PubMed Central (acceptedVersion)
Funders
National Institute of General Medical Sciences (R01GM074876)
Topics
  • Life Sciences › Biochemistry, Genetics and Molecular Biology › Biochemistry › Cholesterol and Lipid Metabolism
  • Life Sciences › Biochemistry, Genetics and Molecular Biology › Cell Biology › Cellular transport and secretion
  • Life Sciences › Biochemistry, Genetics and Molecular Biology › Biochemistry › Lipid metabolism and biosynthesis
Keywords
EHD1, cholesterol homeostasis, lipid droplets, recycling endosomes, endocytic transport, cholesterol absorption, esterified cholesterol, triglyceride storage
MeSH terms
Animals, Biological Transport, Cells, Cultured, Cholesterol, Genetic Complementation Test, HeLa Cells, Homeostasis, Humans, Lipids, Lipoproteins, Mutation, Transfection, Mice, Knockout, Microscopy, Confocal, Cytoplasmic Vesicles, Vesicular Transport Proteins, Lipid Metabolism, Mice, Embryonic Stem Cells

About these checks

Registry, retraction, Cites and statistics results are computed, not judged, with one exception: a printed reference that no index lists is read once by a model before it counts as a citation error. Claims are extracted by a model and kept only when their quote appears verbatim in the text; each cited source is then checked, with a model’s help, for whether it says what the claim relies on. Those verdicts can be wrong — read the claim’s quote and the cited source before relying on one.

A language model drew the claims from the paper on 2026-11-10, under version 3 of the claim definition (model deepseek-v4.1-flash, prompt extract-v3).

A second model labelled each claim on 2026-11-10 (model jev-1.13-20260917, definition revision gold-guideline-v0.2).

Statistics and arithmetic are recomputed, not judged.

Confidence bands are shown only for fields calibrated on our annotated test set. None is calibrated yet, so no band is shown.

What counts as a claim ›How we measure confidence ›How we check this ›

Are you an author, or do you see a problem with this page? Request a review