The DOI matches its Crossref record; 52 of the 53 references it cites were found in a registry or an index; none of the 37 sources its claims cite is checked for support yet.
Multiscale 3D Genome Rewiring during Mouse Neural Development
Open accessAbstract
Chromosome conformation capture technologies have revealed important insights into genome folding. Yet, how spatial genome architecture is related to gene expression and cell fate remains unclear. We comprehensively mapped 3D chromatin organization during mouse neural differentiation in vitro and in vivo, generating the highest-resolution Hi-C maps available to date. We found that transcription is correlated with chromatin insulation and long-range interactions, but dCas9-mediated activation is insufficient for creating TAD boundaries de novo. Additionally, we discovered long-range contacts between gene bodies of exon-rich, active genes in all cell types. During neural differentiation, contacts between active TADs become less pronounced while inactive TADs interact more strongly. An extensive Polycomb network in stem cells is disrupted, while dynamic interactions between neural transcription factors appear in vivo. Finally, cell type-specific enhancer-promoter contacts are established concomitant to gene expression. This work shows that multiple factors influence the dynamics of chromatin interactions in development.
Overview
AI snapshot
Written from the paper’s full text.
TL;DR
Ultra-deep in situ Hi-C across mouse ES cells, neural progenitors, and cortical neurons in vitro and in vivo reveals multiscale 3D genome rewiring during neural differentiation. The study links transcription, CTCF, Polycomb, neural transcription factors, and enhancer-promoter contacts to dynamic chromatin architecture, while showing that transcription alone is not sufficient to create TAD boundaries de novo.
Key findings
- Differentiation involves global compartment reorganization: interactions between active A-type domains decrease, while contacts within inactive B-type domains become stronger; compartment borders decrease with differentiation.
- TADs decrease in number and increase in size; CTCF-less boundaries increase. Developmentally regulated boundaries include 259 ES-specific and 54 neural-specific boundaries. CRISPR-dCas9 activation at Zfp608 and Sox4 caused >10- to 20-fold gene activation but no significant insulation or contact-map change, indicating transcription is correlated with but not sufficient for de novo TAD boundary formation.
- CTCF-mediated loops between convergent CTCF sites increase during differentiation despite decreased CTCF binding; ES-specific CTCF contacts and insulation are lost in NPCs, validated by 3D DNA FISH at the Zfp42 locus.
- Active promoters show CTCF-independent insulation and interact with other active promoters across TAD boundaries; gene bodies of exon-rich, highly expressed genes form long-range contacts in cis and trans, correlating with exon number/splicing. Polycomb-mediated contacts are disrupted during differentiation and correlate with Ring1B rather than H3K27me3. In vivo, neural TFs Pax6, NeuroD2, and Tbr1 organize cell-type-specific contacts, and enhancer-promoter contacts are mostly cell-type specific and generally established concomitantly with gene expression.
Methods
- In situ Hi-C was performed on FACS-purified G0/G1 mouse ES cells, NPCs, and CNs from an in vitro differentiation system, plus NPCs and CNs purified from E14.5 mouse neocortex in vivo. The study reports >40 billion paired-end reads and >17 billion uniquely mapped contacts, with >11 billion uniquely aligned contacts in vitro and ~3 billion per in vivo cell type; maximum resolution reached 750 bp.
- Complementary assays included RNA-seq, ChIP-seq for chromatin marks and factors such as CTCF and Ring1B, 3D DNA FISH, and CRISPR-dCas9-mediated gene activation.
- Hi-C analysis used fragment-end resolution, expected models generated with the Shaman R package, insulation scores, eigenvector-based A/B compartment assignment, aggregate Hi-C maps, and contact enrichment quantification.
Limitations
- The paper states that the in vitro system recapitulates some but not all aspects of cortical development, such as neuronal migration and morphogen signaling; it also notes that whether the observed gene-body contacts are directly linked to co-transcriptional splicing remains to be seen, and whether TF contacts represent true homotypic interactions is unresolved.
- The paper states that clear violations of a simple enhancer-promoter looping model exist, as some enhancer-promoter loops are pre-established.
- Evident from the text: Hi-C is population-averaged and cannot resolve single-cell or allele-specific heterogeneity; FISH validates only selected loci; dCas9 activation was tested at two loci; and in vitro versus in vivo differences may limit generalization.
Model-written summary. Check it against the paper before relying on it.
Integrity signals
Registry
Cites
Statistics
Figures
![Figure 7 Enhancer-Promoter Contacts Are Mostly Cell-Type Specific and Are Correlated with Gene Expression (A and B) Aggregate Hi-C maps and quantification between intra-TAD pairs of enhancers and either active or inactive promoters identified in CNs. Genes were oriented according to the direction of transcription. Data are represented as a scatter dot plot showing the mean ± SD. Statistical significance is calculated using two-way ANOVA with Šídák correction. (C) Heat map showing Z scores based on either gene expression (fragments per kb of transcript per million mapped reads [FPKM]) or the average E-P interactions per gene. Genes are partitioned using k-means clustering on the RNA expression data across all cell types. (D) Average expression or average E-P Hi-C score within the specified cluster. Shown are also the average Hi-C scores when the enhancer contact anchor was randomly shuffled within the same TAD (dashed lines). Error bars indicate ± SEM. (E) Boxplots representing the Pearson correlation coefficient between expression and average E-P interactions per gene, either real or shuffled (shuffled are indicated by the “_s” prefix). (F) Hi-C contact maps showing ∼2.6-Mb region around Brn2 promoter. Insets show a magnified view of the contact between the Brn2 promoter and an NPC-specific enhancer (dashed circle). (G) Hi-C contact maps showing ∼2-Mb region at the Sox2 locus. The positions of two putative NPC-specific enhancers are indicated by green arrowheads. Insets showing the interaction between Sox2 promoter and an ES-specific enhancer (blue arrow, Gi); or Sox2 promoter and a known NPC-specific enhancer (green arrow, Gii). See also Figure S8 and Table S3.](/paper-figures/9b0922f4710c4babba533e76bc6248a6/multiscale-3d-genome-rewiring-during-mouse-neural-development-figure-7.jpg)
Verification
Claims the paper makes
90 Own result · 22 Not checked yet · 19 Own interpretation · 11 Own method · 5 No basis given
A result the paper reports from its own data — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“We found that transcription is correlated with chromatin insulation and long-range interactions, but dCas9-mediated activation is insufficient for creating TAD boundaries de novo.”
- Also stated in: § Transcription Is Correlated with but Not Sufficient to Induce Insulation at TAD Boundaries De Novo · hedged
“Therefore, transcriptional activation per se appears insufficient to cause chromatin insulation and create a TAD boundary.”
§ Multiscale 3D Genome Rewiring during Mouse Neural Development > Abstract
plain- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: passes — The paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
- Also stated in: § Transcription Is Correlated with but Not Sufficient to Induce Insulation at TAD Boundaries De Novo · hedged
A result the paper reports from its own data — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“An extensive Polycomb network in stem cells is disrupted, while dynamic interactions between neural transcription factors appear in vivo.”
- Also stated in: § Polycomb-Mediated Interactions Are Disrupted Independently of H3K27me3 during Neural Differentiation · boosted
“we observed a strong decrease in contact intensity between common H3K27me3 sites, which was especially notable at long distances (Figure S6A).”
§ Multiscale 3D Genome Rewiring during Mouse Neural Development > Abstract
boosteddirect- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: passes — The paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
- Also stated in: § Polycomb-Mediated Interactions Are Disrupted Independently of H3K27me3 during Neural Differentiation · boosted
A result the paper reports from its own data — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“Finally, cell type-specific enhancer-promoter contacts are established concomitant to gene expression.”
§ Multiscale 3D Genome Rewiring during Mouse Neural Development > Abstract
plaincorrelational- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: passes — The paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
A result the paper reports from its own data — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“Additionally, we discovered long-range contacts between gene bodies of exon-rich, active genes in all cell types.”
- Also stated in: § Active Gene Promoters and the Bodies of Exon-Rich Genes Interact at Multiple Genomic Scales · plain
“Finally, actively transcribed genes with a large number of exons engage in long-range chromatin loops in clusters both in cis- and in trans.”
§ Multiscale 3D Genome Rewiring during Mouse Neural Development > Abstract
plaincorrelational- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: passes — The paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
- Also stated in: § Active Gene Promoters and the Bodies of Exon-Rich Genes Interact at Multiple Genomic Scales · plain
A result the paper reports from its own data — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“We found that transcription is correlated with chromatin insulation and long-range interactions, but dCas9-mediated activation is insufficient for creating TAD boundaries de novo.”
§ Multiscale 3D Genome Rewiring during Mouse Neural Development > Abstract
plaincorrelational- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: passes — The paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
A result the paper reports from its own data — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“An extensive Polycomb network in stem cells is disrupted, while dynamic interactions between neural transcription factors appear in vivo.”
§ Multiscale 3D Genome Rewiring during Mouse Neural Development > Abstract
hedged- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: passes — The paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
A result the paper reports from its own data — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“We found that genes located in close proximity to the neural-specific TAD boundaries tend to be upregulated (Figures 2Fi and 2Gi)”
§ Multiscale 3D Genome Rewiring during Mouse Neural Development > Results > Transcription Is Correlated with but Not Sufficient to Induce Insulation at TAD Boundaries De Novo
plaincorrelational- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: unclear — It is unclear whether the paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
- Rests on an assumption: The mechanisms contributing to developmentally regulated TAD borders remain poorly understood.
None of the sources cited for this claim have been checked yet.
In the paper
“we observed a similar increase in insulation around SOX11 (Figure S3M).”
§ Multiscale 3D Genome Rewiring during Mouse Neural Development > Results > Transcription Is Correlated with but Not Sufficient to Induce Insulation at TAD Boundaries De Novo
What the sources say
plaincorrelational- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: passes — The paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
- Rests on an assumption: The mechanisms contributing to developmentally regulated TAD borders remain poorly understood.
A result the paper reports from its own data — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“Highly conserved boundaries in our system were characterized by a small but consistent increase in insulation during differentiation (Figures S3D–S3F).”
§ Multiscale 3D Genome Rewiring during Mouse Neural Development > Results > Transcription Is Correlated with but Not Sufficient to Induce Insulation at TAD Boundaries De Novo
plaindirect- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: unclear — It is unclear whether the paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
- Rests on an assumption: The mechanisms contributing to developmentally regulated TAD borders remain poorly understood.
A result the paper reports from its own data — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“Analysis of TAD boundaries revealed that the proportion of the CTCF-less borders increased during differentiation (Figure S3C).”
§ Multiscale 3D Genome Rewiring during Mouse Neural Development > Results > Transcription Is Correlated with but Not Sufficient to Induce Insulation at TAD Boundaries De Novo
plaindirect- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: passes — The paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
- It may state two separate claims as one. 53
- Probably not a substantial claim. 14
- The quote only partly states this claim. 1
A result the paper reports from its own data — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“During neural differentiation, contacts between active TADs become less pronounced while inactive TADs interact more strongly.”
- Also stated in: § Global Reorganization of the 3D Genome during Neural Differentiation · plain
“Surprisingly, the interaction strength between A-type domains decreased, whereas contacts within the B compartment became stronger between NPCs and CNs (Figures 1E and S1L).”
§ Multiscale 3D Genome Rewiring during Mouse Neural Development > Abstract
plaindirect- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: passes — The paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
It may state two separate claims as one.
- Also stated in: § Global Reorganization of the 3D Genome during Neural Differentiation · plain
A result the paper reports from its own data — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“In total, we sequenced over 40 billion paired-end reads that resulted in more than 17 billion uniquely mapped contacts.”
§ Multiscale 3D Genome Rewiring during Mouse Neural Development > Introduction
plain- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: passes — The paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
It may state two separate claims as one.
A result the paper reports from its own data — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“CTCF was bound to the Sox4 promoter already in ESs, yet insulation dramatically increased only when the gene became expressed at the NPC stage (Figures S3K and S3J).”
§ Multiscale 3D Genome Rewiring during Mouse Neural Development > Results > Transcription Is Correlated with but Not Sufficient to Induce Insulation at TAD Boundaries De Novo
plaincorrelationalSingle case- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: passes — The paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
It may state two separate claims as one.
- Rests on an assumption: The mechanisms contributing to developmentally regulated TAD borders remain poorly understood.
A result the paper reports from its own data — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“We then examined TADs and found that their number decreased during differentiation (Figure S3A), with a corresponding increase in size (Figure S3B).”
§ Multiscale 3D Genome Rewiring during Mouse Neural Development > Results > Transcription Is Correlated with but Not Sufficient to Induce Insulation at TAD Boundaries De Novo
plaincorrelational- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: unclear — It is unclear whether the paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
It may state two separate claims as one.
A result the paper reports from its own data — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“the correlation between signal enrichment and eigenvector value for active histone marks decreased during differentiation, while the anti-correlation between H3K9me3 and the eigenvector value became stronger”
§ Multiscale 3D Genome Rewiring during Mouse Neural Development > Results > Global Reorganization of the 3D Genome during Neural Differentiation
plaincorrelational- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: unclear — It is unclear whether the paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
It may state two separate claims as one.
A result the paper reports from its own data — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“a novel TAD boundary was formed at the transcriptional start site (Tss) of Zfp608 during differentiation (Figure 2H), concomitant with the activation of the gene (Figure S3J) but in the absence of CTCF binding.”
§ Multiscale 3D Genome Rewiring during Mouse Neural Development > Results > Transcription Is Correlated with but Not Sufficient to Induce Insulation at TAD Boundaries De Novo
plaincorrelationalSingle case- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: passes — The paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
It may state two separate claims as one.
- Rests on an assumption: The mechanisms contributing to developmentally regulated TAD borders remain poorly understood.
A result the paper reports from its own data — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“We observed three classes of boundaries: CTCF-positive boundaries, CTCF-negative boundaries close to active gene promoters, and a set of boundaries without enrichment of active marks (Figure 2A).”
§ Multiscale 3D Genome Rewiring during Mouse Neural Development > Results > Transcription Is Correlated with but Not Sufficient to Induce Insulation at TAD Boundaries De Novo
plain- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: passes — The paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
It may state two separate claims as one.
A result the paper reports from its own data — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“cohesin was found both at CTCF-positive boundaries, where it colocalized with CTCF, and on CTCF-negative borders marked by active transcription (Figure 2A).”
§ Multiscale 3D Genome Rewiring during Mouse Neural Development > Results > Transcription Is Correlated with but Not Sufficient to Induce Insulation at TAD Boundaries De Novo
plaincorrelational- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: passes — The paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
It may state two separate claims as one.
A result the paper reports from its own data — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“the absolute levels of Ring1B decreased during differentiation (with only a mild effect on gene expression [Figure S6D]), while H3K27me3 levels did not (Figure 5D).”
§ Multiscale 3D Genome Rewiring during Mouse Neural Development > Results > Polycomb-Mediated Interactions Are Disrupted Independently of H3K27me3 during Neural Differentiation
plain- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: passes — The paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
It may state two separate claims as one.
A result the paper reports from its own data — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“In contrast, both the contact enrichment and the insulation between ES-specific CTCF regions were decreased in NPCs (Figures 3E, 3F and S4F).”
§ Multiscale 3D Genome Rewiring during Mouse Neural Development > Results > Dynamic CTCF-Based Loops and Insulation during Neural Differentiation
plain- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: passes — The paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
It may state two separate claims as one.
None of the sources cited for this claim have been checked yet.
In the paper
“We observed strong enrichment as expected (Guo et al., 2015, Rao et al., 2014), and the loops were constrained primarily inside TADs and rarely crossed TAD boundaries (Figures 3B and 3D).”
§ Multiscale 3D Genome Rewiring during Mouse Neural Development > Results > Dynamic CTCF-Based Loops and Insulation during Neural Differentiation
What the sources say
boostedcorrelational- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: passes — The paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
It may state two separate claims as one.
A result the paper reports from its own data — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“Conserved CTCF were characterized by strong interactions in the convergent orientation (Figures 3E and 3F) and by strong insulation both in ESs and NPCs (Figure S4E).”
§ Multiscale 3D Genome Rewiring during Mouse Neural Development > Results > Dynamic CTCF-Based Loops and Insulation during Neural Differentiation
plaincorrelational- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: passes — The paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
It may state two separate claims as one.
A result the paper reports from its own data — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“we also identified clusters of very long-range (> 30 Mb) chromatin contacts between bodies of expressed genes in cis (Figures 4I and S5K) and also in trans (Figure S5L).”
§ Multiscale 3D Genome Rewiring during Mouse Neural Development > Results > Active Gene Promoters and the Bodies of Exon-Rich Genes Interact at Multiple Genomic Scales
plaincorrelational- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: passes — The paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
It may state two separate claims as one.
A result the paper reports from its own data — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“most of these interactions were not mediated by CTCF (Figure 4F) and were readily identified in all three cell types (Figure 4G).”
§ Multiscale 3D Genome Rewiring during Mouse Neural Development > Results > Active Gene Promoters and the Bodies of Exon-Rich Genes Interact at Multiple Genomic Scales
plain- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: passes — The paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
It may state two separate claims as one.
A result the paper reports from its own data — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“only the 3D FISH distance between the pair of probes containing the forward and the reverse CTCF site increased during differentiation, while the other probe pairs displayed the opposite effect (Figures 3H, S4H, and S4I).”
§ Multiscale 3D Genome Rewiring during Mouse Neural Development > Results > Dynamic CTCF-Based Loops and Insulation during Neural Differentiation
plaindirect- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: passes — The paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
It may state two separate claims as one.
A result the paper reports from its own data — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“the contact enrichment between gene bodies was highly correlated not only with expression levels, but also with the number of exons per gene (Figures 4J, 4K, and 4M), and was evident across a large range of genomic distances (Figure S5M) in all three cell types (Figure 4N).”
§ Multiscale 3D Genome Rewiring during Mouse Neural Development > Results > Active Gene Promoters and the Bodies of Exon-Rich Genes Interact at Multiple Genomic Scales
plaincorrelational- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: passes — The paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
It may state two separate claims as one.
A result the paper reports from its own data — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“However, the overall enrichment of CTCF-mediated contacts increased with neural differentiation, and even inter-domain contacts became apparent (Figures 3B–3D and S4B).”
§ Multiscale 3D Genome Rewiring during Mouse Neural Development > Results > Dynamic CTCF-Based Loops and Insulation during Neural Differentiation
plaincorrelational- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: passes — The paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
It may state two separate claims as one.
A result the paper reports from its own data — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“During differentiation, only the forward CTCF site became inaccessible to CTCF, and the chromatin loop disappeared (Figure 3G).”
§ Multiscale 3D Genome Rewiring during Mouse Neural Development > Results > Dynamic CTCF-Based Loops and Insulation during Neural Differentiation
plaindirectSingle case- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: passes — The paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
It may state two separate claims as one.
In the paper
“general TFs such as Taf3 (Liu et al., 2011) appear to enhance interaction between promoters but had little effect on insulation (Figure S5D).”
§ Multiscale 3D Genome Rewiring during Mouse Neural Development > Results > Active Gene Promoters and the Bodies of Exon-Rich Genes Interact at Multiple Genomic Scales
What the sources say
- Not checked yetcites Liu et al., 2011 source
hedgedconditional- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: unclear — It is unclear whether the paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
It may state two separate claims as one.
A result the paper reports from its own data — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“we identified a strong preference for insulation centered on active Tss, but not on inactive ones, a phenomenon that was not dependent on CTCF binding (Figures 4A, 4B, S5A, and S5B).”
§ Multiscale 3D Genome Rewiring during Mouse Neural Development > Results > Active Gene Promoters and the Bodies of Exon-Rich Genes Interact at Multiple Genomic Scales
boostedcorrelational- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: passes — The paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
It may state two separate claims as one.
A result the paper reports from its own data — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“We observed that average intra-TAD contacts become stronger, while inter-TAD contacts appear to be depleted during differentiation (Figures 3A and S4A).”
§ Multiscale 3D Genome Rewiring during Mouse Neural Development > Results > Dynamic CTCF-Based Loops and Insulation during Neural Differentiation
hedgedcorrelational- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: passes — The paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
It may state two separate claims as one.
A result the paper reports from its own data — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“we observed no central enrichment when we performed the same analysis using instead 3′ gene ends (Figure S5F), showing that these interactions were specific to promoters and were correlated with the level of expression (Figures 4H and S5J).”
§ Multiscale 3D Genome Rewiring during Mouse Neural Development > Results > Active Gene Promoters and the Bodies of Exon-Rich Genes Interact at Multiple Genomic Scales
plaincorrelational- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: passes — The paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
It may state two separate claims as one.
A result the paper reports from its own data — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“active chromatin loops span across domains and can be observed even at long distances (Figure 4E), in contrast with CTCF-mediated contacts.”
§ Multiscale 3D Genome Rewiring during Mouse Neural Development > Results > Active Gene Promoters and the Bodies of Exon-Rich Genes Interact at Multiple Genomic Scales
plaincorrelational- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: passes — The paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
It may state two separate claims as one.
In the paper
“Therefore, although we confirmed that most TAD boundaries are conserved (Dixon et al., 2012), novel borders can occur at promoters of developmentally regulated genes.”
§ Multiscale 3D Genome Rewiring during Mouse Neural Development > Discussion
What the sources say
- Not checked yetcites Dixon et al., 2012 source
plain- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: fails — The paper’s conclusions may not depend on it.
- Based: passes — The paper gives a reason why it holds.
Probably not a substantial claim. The paper’s conclusions may not depend on it.
A result the paper reports from its own data — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“Moreover, we identified regions that switch compartments between the in vitro and the in vivo systems, which were accompanied with corresponding changes in gene expression (Figures S8B and S8C).”
§ Multiscale 3D Genome Rewiring during Mouse Neural Development > Results > Cell-Type Specific Chromatin Folding Is Organized around the Neural Transcription Factors Pax6, NeuroD2, and Tbr1 In Vivo
plaincorrelational- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: passes — The paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
It may state two separate claims as one.
A result the paper reports from its own data — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“We observed a strong decrease in the interactions between Sox2 promoter and the ES-specific enhancer (Figure 7G, blue arrow) during differentiation, which coincides with a decrease in both CTCF binding and the H3K27ac mark on the enhancer (Figure 7Gi).”
§ Multiscale 3D Genome Rewiring during Mouse Neural Development > Results > Enhancer-Promoter Contacts Are Mostly Cell-Type Specific and Are Generally Established Concomitantly with Gene Expression
boostedcorrelational- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: passes — The paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
It may state two separate claims as one.
A result the paper reports from its own data — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“NeuroD2 and Tbr1 interactions were also mostly constrained inside TADs (Figures 6C, 6D, S7P, and S7Q) but increased during differentiation and were the strongest in CNs in vivo.”
§ Multiscale 3D Genome Rewiring during Mouse Neural Development > Results > Cell-Type Specific Chromatin Folding Is Organized around the Neural Transcription Factors Pax6, NeuroD2, and Tbr1 In Vivo
plaindirect- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: passes — The paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
It may state two separate claims as one.
A result the paper reports from its own data — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“These interactions are strongly correlated with the number of splicing events per gene with the strongest contacts occurring between genes that undergo most splicing.”
§ Multiscale 3D Genome Rewiring during Mouse Neural Development > Discussion
boostedcorrelational- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: passes — The paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
It may state two separate claims as one.
A result the paper reports from its own data — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“The analysis of a well-controlled differentiation system and its in vivo cell counterparts shows that cell differentiation is accompanied by a global chromatin reorganization and a change in compartmentalization with a decrease in long-range interactions between A-type domains concomitant with an increase in contacts between inactive B-type domains.”
§ Multiscale 3D Genome Rewiring during Mouse Neural Development > Discussion
plaincorrelational- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: passes — The paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
It may state two separate claims as one.
The paper states this without a source or data behind it here, so there is nothing to check it against. The quote shows it is in the paper.
In the paper
“In ESs, the strong long-range interactions also involve Polycomb-bound genes and, to a lesser extent, genes bound by pluripotency TFs.”
§ Multiscale 3D Genome Rewiring during Mouse Neural Development > Discussion
plaincorrelational- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: unclear — It is unclear whether the paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
It may state two separate claims as one.
A result the paper reports from its own data — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“These networks are reorganized in neuronal differentiation, which in the case of Polycomb appears to correlate with PRC1 binding levels.”
§ Multiscale 3D Genome Rewiring during Mouse Neural Development > Discussion
hedgedcorrelational- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: passes — The paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
It may state two separate claims as one.
A result the paper reports from its own data — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“We identified a NPC-specific enhancer, which interacted strongly with the promoter of the neuronal TF Brn2 gene only in NPCs, and this interaction was disrupted in CNs when the enhancer was inactive (Figure 7F).”
§ Multiscale 3D Genome Rewiring during Mouse Neural Development > Results > Enhancer-Promoter Contacts Are Mostly Cell-Type Specific and Are Generally Established Concomitantly with Gene Expression
boosteddirect- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: passes — The paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
It may state two separate claims as one.
A result the paper reports from its own data — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“Principal component analysis (PCA) also confirmed that NPC populations, either in vitro or in vivo, are highly similar to each other and are distinct from CNs and vice versa (Figure S8A).”
§ Multiscale 3D Genome Rewiring during Mouse Neural Development > Results > Cell-Type Specific Chromatin Folding Is Organized around the Neural Transcription Factors Pax6, NeuroD2, and Tbr1 In Vivo
plain- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: passes — The paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
It may state two separate claims as one.
A result the paper reports from its own data — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“Furthermore, the average Hi-C scores and the correlation between expression and chromatin contacts were strongly decreased when we randomly shuffled the position of the enhancer region within the same TAD (Figures 7D, 7E, and S8H).”
§ Multiscale 3D Genome Rewiring during Mouse Neural Development > Results > Enhancer-Promoter Contacts Are Mostly Cell-Type Specific and Are Generally Established Concomitantly with Gene Expression
boosteddirect- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: passes — The paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
It may state two separate claims as one.
A result the paper reports from its own data — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“We observed a cell-type specific contact enrichment between Pax6-bound sites strongest in ncx NPC where Pax6 is highly expressed (Figures 6C and 6D).”
§ Multiscale 3D Genome Rewiring during Mouse Neural Development > Results > Cell-Type Specific Chromatin Folding Is Organized around the Neural Transcription Factors Pax6, NeuroD2, and Tbr1 In Vivo
plaincorrelational- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: passes — The paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
It may state two separate claims as one.
A result the paper reports from its own data — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“Although we did identify instances of pre-set chromatin interactions between enhancers and their cognate target genes that precede transcriptional activation (Figures 7C, S8N, and S8O), the majority of those interactions appear to be established concomitantly to gene expression and are also disrupted when the genes become repressed.”
§ Multiscale 3D Genome Rewiring during Mouse Neural Development > Results > Enhancer-Promoter Contacts Are Mostly Cell-Type Specific and Are Generally Established Concomitantly with Gene Expression
hedgedcorrelational- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: passes — The paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
It may state two separate claims as one.
A result the paper reports from its own data — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“mean nuclear radius of the ES, NPC and CNs population were calculated (ES = 1.73 ± 0.28; NPC = 1.39 ± 0.24; CN = 1.43 ± 0.20).”
§ Multiscale 3D Genome Rewiring during Mouse Neural Development > STAR★Methods > Quantification and Statistical Analysis
plain- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: passes — The paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
It may state two separate claims as one.
A result the paper reports from its own data — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“Domains in each cluster exhibit distinct signature based on the enrichment of chromatin marks, replication timing and Lamin B1 DamID enrichment where available (Figure S1I), prompting us to assign cluster 1 to the B-, inactive compartment and cluster 2 to the A-, active compartment.”
§ Multiscale 3D Genome Rewiring during Mouse Neural Development > STAR★Methods > Quantification and Statistical Analysis
plaindirect- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: passes — The paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
It may state two separate claims as one.
None of the sources cited for this claim have been checked yet.
In the paper
“At intermediate scales (100 kb to 1 Mb), a major discovery is the existence of topologically associating domains (TADs) (Dixon et al., 2012, Nora et al., 2012, Sexton et al., 2012).”
§ Multiscale 3D Genome Rewiring during Mouse Neural Development > Introduction
What the sources say
plain- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: fails — The paper’s conclusions may not depend on it.
- Based: passes — The paper gives a reason why it holds.
Probably not a substantial claim. The paper’s conclusions may not depend on it.
What the paper did — it cites no source for this, so there is none to check. The quote shows it is in the paper.
In the paper
“We comprehensively mapped 3D chromatin organization during mouse neural differentiation in vitro and in vivo, generating the highest-resolution Hi-C maps available to date.”
- Also stated in: § Global Reorganization of the 3D Genome during Neural Differentiation · plain
“We reached a maximum resolution of 750 bp—the highest to date (Figure S1F).”
§ Multiscale 3D Genome Rewiring during Mouse Neural Development > Abstract
plain- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: passes — The paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
It may state two separate claims as one.
- Rests on an assumption: Our understanding of the interaction dynamics at the smallest scales during developmental processes is currently limited.
- Rests on an assumption: The relation between loop extrusion models and transcription remains unclear.
- Also stated in: § Global Reorganization of the 3D Genome during Neural Differentiation · plain
A conclusion the paper draws from its own results — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“Our data demonstrate that cellular differentiation involves changes at all scales of folding, and in addition to CTCF-dependent processes, it includes major changes in Polycomb and in transcription factor (TF) interaction networks.”
§ Multiscale 3D Genome Rewiring during Mouse Neural Development > Introduction
boosteddirect- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: passes — The paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
It may state two separate claims as one.
- Rests on an assumption: Our understanding of the interaction dynamics at the smallest scales during developmental processes is currently limited.
- Rests on an assumption: The relation between loop extrusion models and transcription remains unclear.
In the paper
“At larger scales, interactions between domains are thought to give rise to two main types of spatial compartments referred to as “A” and “B” (Lieberman-Aiden et al., 2009)”
§ Multiscale 3D Genome Rewiring during Mouse Neural Development > Introduction
What the sources say
- Not checked yetcites Lieberman-Aiden et al., 2009 source
hedgeddirect- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: fails — The paper’s conclusions may not depend on it.
- Based: passes — The paper gives a reason why it holds.
Probably not a substantial claim. The paper’s conclusions may not depend on it.
What the paper did — it cites no source for this, so there is none to check. The quote shows it is in the paper.
In the paper
“verified that these borders represent a genuine loss or gain of insulation, respectively, using aggregate Hi-C maps (Figure 2E), insulation score (Figures S3G and S3H), and directionality index (DI) (Figure S3I).”
§ Multiscale 3D Genome Rewiring during Mouse Neural Development > Results > Transcription Is Correlated with but Not Sufficient to Induce Insulation at TAD Boundaries De Novo
boosted- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: passes — The paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
It may state two separate claims as one.
- Rests on an assumption: The mechanisms contributing to developmentally regulated TAD borders remain poorly understood.
In the paper
“recent evidence indicates that domains and compartment formation can be at least partially uncoupled and may result from different biological phenomena (Nora et al., 2017).”
§ Multiscale 3D Genome Rewiring during Mouse Neural Development > Introduction
What the sources say
- Not checked yetcites Nora et al., 2017 source
hedgedconditional- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: fails — The paper’s conclusions may not depend on it.
- Based: passes — The paper gives a reason why it holds.
Probably not a substantial claim. The paper’s conclusions may not depend on it. It may state two separate claims as one.
None of the sources cited for this claim have been checked yet.
In the paper
“Domain insulation has been shown to be important for gene expression and physiology (Flavahan et al., 2016, Lupiáñez et al., 2015).”
§ Multiscale 3D Genome Rewiring during Mouse Neural Development > Introduction
What the sources say
boosteddirect- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: fails — The paper’s conclusions may not depend on it.
- Based: passes — The paper gives a reason why it holds.
Probably not a substantial claim. The paper’s conclusions may not depend on it.
In the paper
“which are functionally related to gene expression and can switch extensively during differentiation (Dixon et al., 2015).”
§ Multiscale 3D Genome Rewiring during Mouse Neural Development > Introduction
What the sources say
- Not checked yetcites Dixon et al., 2015 source
plaincorrelational- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: fails — The paper’s conclusions may not depend on it.
- Based: passes — The paper gives a reason why it holds.
Probably not a substantial claim. The paper’s conclusions may not depend on it. It may state two separate claims as one.
In the paper
“very few studies using mostly in vitro cultured cells have achieved high resolution (Rao et al., 2014).”
§ Multiscale 3D Genome Rewiring during Mouse Neural Development > Introduction
What the sources say
- Not checked yetcites Rao et al., 2014 source
plain- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: passes — The paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
Probably not a substantial claim.
What the paper did — it cites no source for this, so there is none to check. The quote shows it is in the paper.
In the paper
“we employed a fluorescence-activated cell sorting (FACS) approach, which allowed us to purify G0G1 cells based on DNA content”
§ Multiscale 3D Genome Rewiring during Mouse Neural Development > Results > Global Reorganization of the 3D Genome during Neural Differentiation
plaindirect- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: fails — The paper’s conclusions may not depend on it.
- Based: passes — The paper gives a reason why it holds.
Probably not a substantial claim. The paper’s conclusions may not depend on it.
What the paper did — it cites no source for this, so there is none to check. The quote shows it is in the paper.
In the paper
“we controlled for cell type heterogeneity and cell-cycle variation.”
- Also stated in: § Global Reorganization of the 3D Genome during Neural Differentiation · plain
“we employed a fluorescence-activated cell sorting (FACS) approach, which allowed us to purify G0G1 cells based on DNA content”
§ Multiscale 3D Genome Rewiring during Mouse Neural Development > Introduction
plain- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: passes — The paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
It may state two separate claims as one.
- Also stated in: § Global Reorganization of the 3D Genome during Neural Differentiation · plain
None of the sources cited for this claim have been checked yet.
In the paper
“It is known that architectural proteins such as CTCF and cohesin play a role (Haarhuis et al., 2017, Nora et al., 2017, Phillips-Cremins et al., 2013)”
§ Multiscale 3D Genome Rewiring during Mouse Neural Development > Introduction
What the sources say
boostedcorrelational- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: fails — The paper’s conclusions may not depend on it.
- Based: passes — The paper gives a reason why it holds.
Probably not a substantial claim. The paper’s conclusions may not depend on it.
What the paper did — it cites no source for this, so there is none to check. The quote shows it is in the paper.
In the paper
“Biological replicates were highly correlated at all resolutions (Figure S1D) and for each different cell type (Figures S1E and S2A).”
§ Multiscale 3D Genome Rewiring during Mouse Neural Development > Results > Global Reorganization of the 3D Genome during Neural Differentiation
plaincorrelational- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: passes — The paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
It may state two separate claims as one.
A conclusion the paper draws from its own results — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“In conclusion, a major genome-folding reprogramming occurs during neural differentiation with a progressive increase in compartment size, decreased interactions within the A compartment, and a concomitant increase in interactions between B-type domains.”
§ Multiscale 3D Genome Rewiring during Mouse Neural Development > Results > Global Reorganization of the 3D Genome during Neural Differentiation
plaindirect- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: passes — The paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
It may state two separate claims as one.
- Rests on an assumption: Our understanding of the interaction dynamics at the smallest scales during developmental processes is currently limited.
- Rests on an assumption: The relation between loop extrusion models and transcription remains unclear.
None of the sources cited for this claim have been checked yet.
In the paper
“The deposition of chromatin marks is thought to contribute to this process (Dixon et al., 2015, Nora et al., 2012)”
§ Multiscale 3D Genome Rewiring during Mouse Neural Development > Introduction
What the sources say
hedgedconditional- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: fails — The paper’s conclusions may not depend on it.
- Based: passes — The paper gives a reason why it holds.
Probably not a substantial claim. The paper’s conclusions may not depend on it.
A conclusion the paper draws from its own results — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“In summary, promoters of active genes are characterized by strong insulation, which is correlated with transcriptional activity, but is mostly CTCF independent.”
§ Multiscale 3D Genome Rewiring during Mouse Neural Development > Results > Active Gene Promoters and the Bodies of Exon-Rich Genes Interact at Multiple Genomic Scales
plaincorrelational- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: passes — The paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
It may state two separate claims as one.
None of the sources cited for this claim have been checked yet.
In the paper
“Polycomb-mediated interactions have been previously reported in mouse ESs using a Capture-C approach (Schoenfelder et al., 2015b) and are a prominent feature in Drosophila (Bantignies et al., 2011).”
§ Multiscale 3D Genome Rewiring during Mouse Neural Development > Results > Polycomb-Mediated Interactions Are Disrupted Independently of H3K27me3 during Neural Differentiation
What the sources say
- Not checked yetcites Schoenfelder et al., 2015b
- Not checked yetcites Bantignies et al., 2011 source
plain- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: fails — The paper’s conclusions may not depend on it.
- Based: passes — The paper gives a reason why it holds.
Probably not a substantial claim. The paper’s conclusions may not depend on it. It may state two separate claims as one.
A conclusion the paper draws from its own results — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“Active Tss maintain contacts with the gene body and, contrary to CTCF interactions, can interact with other transcribed Tss across TAD boundaries.”
§ Multiscale 3D Genome Rewiring during Mouse Neural Development > Results > Active Gene Promoters and the Bodies of Exon-Rich Genes Interact at Multiple Genomic Scales
plaincorrelational- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: passes — The paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
It may state two separate claims as one.
In the paper
“As many as 40–50% of the CTCF sites may change in different cell types (Chen et al., 2012).”
§ Multiscale 3D Genome Rewiring during Mouse Neural Development > Results > Dynamic CTCF-Based Loops and Insulation during Neural Differentiation
What the sources say
- Not checked yetcites Chen et al., 2012 source
hedgedconditional- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: fails — The paper’s conclusions may not depend on it.
- Based: passes — The paper gives a reason why it holds.
Probably not a substantial claim. The paper’s conclusions may not depend on it.
None of the sources cited for this claim have been checked yet.
In the paper
“Chromatin insulation occurs at multiple levels and leads to a hierarchical 3D nuclear organization, whereby smaller, less insulated regions (called also sub-TADs [Flavahan et al., 2016, Phillips-Cremins et al., 2013] or contact domains [Rao et al., 2014]) are nested inside TADs, which are usually bigger and more strongly insulated (Dixon et al., 2012, Nora et al., 2012, Sexton et al., 2012).”
§ Multiscale 3D Genome Rewiring during Mouse Neural Development > Results > Dynamic CTCF-Based Loops and Insulation during Neural Differentiation
What the sources say
plaindirect- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: passes — The paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
It may state two separate claims as one.
None of the sources cited for this claim have been checked yet.
In the paper
“However, very few public chromatin immunoprecipitation sequencing (ChIP-seq) profiles exist, and most of those have been performed in the developing mouse neocortex (Bayam et al., 2015, Notwell et al., 2016, Sun et al., 2015).”
§ Multiscale 3D Genome Rewiring during Mouse Neural Development > Results > Cell-Type Specific Chromatin Folding Is Organized around the Neural Transcription Factors Pax6, NeuroD2, and Tbr1 In Vivo
What the sources say
plain- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: passes — The paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
It may state two separate claims as one.
What the paper did — it cites no source for this, so there is none to check. The quote shows it is in the paper.
In the paper
“We performed RNA-seq and verified our approach using known markers for neural progenitors (Nestin) and differentiating neurons (Dcx) (Figure S7D).”
§ Multiscale 3D Genome Rewiring during Mouse Neural Development > Results > Cell-Type Specific Chromatin Folding Is Organized around the Neural Transcription Factors Pax6, NeuroD2, and Tbr1 In Vivo
plain- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: passes — The paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
The quote only partly states this claim.
What the paper did — it cites no source for this, so there is none to check. The quote shows it is in the paper.
In the paper
“Pearson correlation coefficient (Figure S7E), comparison of the eigenvector values, insulation score, and contact probability (Figures S7G and S8A) confirmed the high quality of the data and that, importantly, samples group together based on cell type.”
§ Multiscale 3D Genome Rewiring during Mouse Neural Development > Results > Cell-Type Specific Chromatin Folding Is Organized around the Neural Transcription Factors Pax6, NeuroD2, and Tbr1 In Vivo
boostedcorrelational- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: passes — The paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
It may state two separate claims as one.
In the paper
“Pax6 is one of the few “master regulator” neural TFs with a well-known role in cortical development (Manuel et al., 2015).”
§ Multiscale 3D Genome Rewiring during Mouse Neural Development > Results > Cell-Type Specific Chromatin Folding Is Organized around the Neural Transcription Factors Pax6, NeuroD2, and Tbr1 In Vivo
What the sources say
- Not checked yetcites Manuel et al., 2015 source
boosted- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: fails — The paper’s conclusions may not depend on it.
- Based: passes — The paper gives a reason why it holds.
Probably not a substantial claim. The paper’s conclusions may not depend on it.
A conclusion the paper draws from its own results — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“These results suggest that E-P interactions are highly dynamic and cell-type specific.”
§ Multiscale 3D Genome Rewiring during Mouse Neural Development > Results > Enhancer-Promoter Contacts Are Mostly Cell-Type Specific and Are Generally Established Concomitantly with Gene Expression
hedgedcorrelational- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: passes — The paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
It may state two separate claims as one.
A conclusion the paper draws from its own results — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“Finally, E-P interactions are highly dynamic and are usually established concomitantly with gene expression.”
§ Multiscale 3D Genome Rewiring during Mouse Neural Development > Discussion
plaincorrelational- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: passes — The paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
It may state two separate claims as one.
What the paper did — it cites no source for this, so there is none to check. The quote shows it is in the paper.
In the paper
“Boundaries within 10Kb of each other were merged and only boundaries, which were detected in at least 3 biological replicates, were retained.”
§ Multiscale 3D Genome Rewiring during Mouse Neural Development > STAR★Methods > Quantification and Statistical Analysis
plain- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: passes — The paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
Probably not a substantial claim.
The paper relies on this without support.
Our understanding of the interaction dynamics at the smallest scales during developmental processes is currently limited.
“However, our understanding of the interaction dynamics at the smallest scales during developmental processes is currently limited.”
The paper relies on this without support.
The relation between loop extrusion models and transcription remains unclear.
“However, the relation between such models and transcription remains unclear.”
The paper relies on this without support.
The mechanisms contributing to developmentally regulated TAD borders remain poorly understood.
“yet the mechanisms contributing to developmentally regulated borders remain poorly understood.”
The paper relies on this without support.
The majority of strong Polycomb-bound regions are on gene promoters.
“As the majority of strong Polycomb-bound regions are on gene promoters, we examined whether their interaction might depend on paused Pol II that is located at bivalent gene promoters (Min et al., 2011).”
The paper relies on this without support.
Enhancer-promoter contacts have been difficult to observe in Hi-C, and their strength relative to surrounding regions is unclear.
“Enhancer-promoter (E-P) contacts have been difficult to observe in Hi-C, and it is unclear how strong they are compared to the surrounding regions.”
The paper relies on this without support.
The in vitro differentiation system recapitulates some aspects of cortical development but not others such as neuronal migration and morphogen signaling.
“Furthermore, although the in vitro system we employed recapitulates some aspects of cortical development, other features, such as neuronal migration and morphogen signaling, are not.”
The paper relies on this without support.
The vast majority of ultra-close cis Hi-C contacts (separated by less than 1 kb) originate from non-digested DNA.
“Contacts separated by less than 1kb were not considered for subsequent analysis, as the vast majority of this ultra-close cis contacts originate from non-digested DNA.”
Claims other papers make about this one
Each is checked against this paper’s own text: does it say what the citing paper says it does?
The source backs part of the claim, not all of it — or backs it for a different population, condition or comparison.
In the citing paper
“The Sox2 gene has an essential enhancer, the Sox2 Control Region (SCR), which was found by 3C-derived techniques to loop to the Sox2 promoter (for example, [379, 401]).”
From Transcriptional enhancers and their communication with gene promoters (2021) · cites this paper as [401]
Experimental — accuracy not yet measuredThe source backs part of the claim, not all of it — or backs it for a different population, condition or comparison.
In the citing paper
“active promoters and enhancers can likely give rise to TAD boundaries even in the absence of convergent CTCF sites [401].”
From Transcriptional enhancers and their communication with gene promoters (2021) · cites this paper as [401]
Experimental — accuracy not yet measuredThe cited source says what the claim attributes to it.
In the citing paper
“Interestingly, Hi-C data obtained using differentiated mouse neurons led us to detect chromatin interactions between HAR202 and the Npas3 promoter (Bonev et al. 2017; supplementary fig. S8, Supplementary Material online).”
From The Human Accelerated Region HAR202 Controls NPAS3 Expression in the Developing Forebrain Displaying Differential Enhancer Activity Between Modern and Archaic Human Sequences (2024) · cites this paper as Bonev et al. 2017
The cited source says what the claim attributes to it.
In the citing paper
“The majority of specific enhancer–promoter loops follow this pattern and are highly enriched within, compared with across, TAD boundaries [277, 401, 405].”
From Transcriptional enhancers and their communication with gene promoters (2021) · cites this paper as [401]
In the citing paper
“The 3D genome plays an important role in neuronal gene expression and function”
From Neuronal DNA double-strand breaks lead to genome structural variations and 3D genome disruption in neurodegeneration (2023) · cites this paper as [96]
In the citing paper
“5C maps from our mature primary cortical neurons were highly correlated with and exhibited similar loops as published Hi-C maps from ES cell-derived cortical neurons”
From Three-dimensional genome restructuring across timescales of activity-induced neuronal gene expression (2020) · cites this paper as [33]
In the citing paper
“We applied published methods17 to identify 24,937 loops in cortical neurons”
From Three-dimensional genome restructuring across timescales of activity-induced neuronal gene expression (2020) · cites this paper as [33]
Self-check
Percentages, sums and reported differences re-computed from the paper’s own numbers.
Each contradiction between two passages listed here was confirmed by an independent check.
Rated minor: it would not touch a result — a value no result rests on, a p-value that stays on the same side of the significance level, or a conflict that is clerical, resolved elsewhere in the paper, or outside its own findings.
In the paper
§ Multiscale 3D Genome Rewiring during Mouse Neural Development > Results > Transcription Is Correlated with but Not Sufficient to Induce Insulation at TAD Boundaries De Novo
“We used the CRISPR-dCas9 system (Konermann et al., 2015) to activate gene expression at the endogenous Zfp608 and Sox4 loci”
§ Multiscale 3D Genome Rewiring during Mouse Neural Development > STAR★Methods > Experimental Model and Subject Details
“Guide RNAs (Zfp604 – AGAAAGCGGAATGAGAAGTT and Sox4 - TTGCTCTGTAAATTGGAATG) were designed and cloned”
Rated minor: it would not touch a result — a value no result rests on, a p-value that stays on the same side of the significance level, or a conflict that is clerical, resolved elsewhere in the paper, or outside its own findings.
In the paper
§ Multiscale 3D Genome Rewiring during Mouse Neural Development > STAR★Methods > Key Resources Table
“| Strand specific total RNA from sorted Hes5-GFP-/Dcx-mRFP+ ncx_NPC cells | This study | GEO: GSE96107 |”
§ Multiscale 3D Genome Rewiring during Mouse Neural Development > Results > Cell-Type Specific Chromatin Folding Is Organized around the Neural Transcription Factors Pax6, NeuroD2, and Tbr1 In Vivo
“GFP-/RFP+ (“ncx CN”) populations from the same embryonic brains”
Rated minor: it would not touch a result — a value no result rests on, a p-value that stays on the same side of the significance level, or a conflict that is clerical, resolved elsewhere in the paper, or outside its own findings.
In the paper
§ Multiscale 3D Genome Rewiring during Mouse Neural Development > STAR★Methods > Method Details
“The appropriate gates to isolate GFP+/RFP- and RFP-/GFP+ cells were set as described in Figure S7B.”
§ Multiscale 3D Genome Rewiring during Mouse Neural Development > Results > Cell-Type Specific Chromatin Folding Is Organized around the Neural Transcription Factors Pax6, NeuroD2, and Tbr1 In Vivo
“GFP+/RFP- (referred to as “ncx NPC” henceafter) and GFP-/RFP+ (“ncx CN”) populations from the same embryonic brains”
Rated minor: it would not touch a result — a value no result rests on, a p-value that stays on the same side of the significance level, or a conflict that is clerical, resolved elsewhere in the paper, or outside its own findings.
In the paper
§ Multiscale 3D Genome Rewiring during Mouse Neural Development > Results > Polycomb-Mediated Interactions Are Disrupted Independently of H3K27me3 during Neural Differentiation
“a loop was formed specifically in NPCs between the Cacna2d1 promoter and another NPC-specific Ring1B site located ∼500 kb downstream in the gene body (Figure S6J).”
§ Multiscale 3D Genome Rewiring during Mouse Neural Development > Results > Polycomb-Mediated Interactions Are Disrupted Independently of H3K27me3 during Neural Differentiation
“(J) HiC contact maps showing ∼150Kb region around Cacna2d1 promoter. Note the appearance of NPC-specific Ring1B/H3K27me3 site inside Cacna2d1 gene body, which coincides with an interaction between this region and the Cacna2d1 promoter.”
Citations
Cites
A 3D Map of the Human Genome at Kilobase Resolution Reveals Principles of Chromatin Looping
Rao, S. S. P., Huntley, M. H., Durand, N. C., Stamenova, E. K., Bochkov, I. D., Robinson, J. T., Sanborn, A. L., Machol, I., Omer, A. D., Lander, E. S., et al. (2014) · Cell · doi:10.1016/j.cell.2014.11.021 · Cited by 9,212
Comprehensive Mapping of Long-Range Interactions Reveals Folding Principles of the Human Genome
Lieberman-Aiden, E., van Berkum, N. L., Williams, L., Imakaev, M., Ragoczy, T., Telling, A., Amit, I., Lajoie, B. R., Sabo, P. J., Dorschner, M. O., et al. (2009) · Science · doi:10.1126/science.1181369 · Cited by 8,898
Topological domains in mammalian genomes identified by analysis of chromatin interactions
Dixon, J. R., Selvaraj, S., Yue, F., Kim, A., Li, Y., Shen, Y., Hu, M., Liu, J. S., & Ren, B. (2012) · Nature · doi:10.1038/nature11082 · Cited by 6,829
Spatial partitioning of the regulatory landscape of the X-inactivation centre
Nora, E. P., Lajoie, B. R., Schulz, E. G., Giorgetti, L., Okamoto, I., Servant, N., Piolot, T., van Berkum, N. L., Meisig, J., Sedat, J., et al. (2012) · Nature · doi:10.1038/nature11049 · Cited by 2,895
Genome-scale transcriptional activation by an engineered CRISPR-Cas9 complex
Konermann, S., Brigham, M. D., Trevino, A. E., Joung, J., Abudayyeh, O. O., Barcena, C., Hsu, P. D., Habib, N., Gootenberg, J. S., Nishimasu, H., et al. (2015) · Nature · doi:10.1038/nature14136 · Cited by 2,825
Disruptions of Topological Chromatin Domains Cause Pathogenic Rewiring of Gene-Enhancer Interactions
Lupiáñez, D. G., Kraft, K., Heinrich, V., Krawitz, P., Brancati, F., Klopocki, E., Horn, D., Kayserili, H., Opitz, J. M., Laxova, R., et al. (2015) · Cell · doi:10.1016/j.cell.2015.04.004 · Cited by 2,132
Formation of chromosomal domains by loop extrusion
Fudenberg, G., Imakaev, M., Lu, C., Goloborodko, A., Abdennur, N., & Mirny, L. A. (2016) · Cell Reports · doi:10.1016/j.celrep.2016.04.085 · Cited by 2,003
Three-dimensional folding and functional organization principles of the Drosophila genome
Sexton, T., Yaffe, E., Kenigsberg, E., Bantignies, F., Leblanc, B., Hoichman, M., Parrinello, H., Tanay, A., & Cavalli, G. (2012) · Cell · doi:10.1016/j.cell.2012.01.010 · Cited by 1,983
Self-citationMediator and cohesin connect gene expression and chromatin architecture
Kagey, M. H., Newman, J. J., Bilodeau, S., Zhan, Y., Orlando, D. A., van Berkum, N. L., Ebmeier, C. C., Goossens, J., Rahl, P. B., Levine, S. S., et al. (2010) · Nature · doi:10.1038/nature09380 · Cited by 1,939
Sanborn, A. L., Rao, S. S. P., Huang, S.-C., Durand, N. C., Huntley, M. H., Jewett, A. I., Bochkov, I. D., Chinnappan, D., Cutkosky, A., Li, J., et al. (2015) · Proceedings of the National Academy of Sciences · doi:10.1073/pnas.1518552112 · Cited by 1,730
Cited by
Sorted by citations
Items 301–400 of 999
The macro and micro of chromosome conformation capture
Goel, V. Y., & Hansen, A. S. (2020) · Wiley Interdisciplinary Reviews Developmental Biology · doi:10.1002/wdev.395 · Cited by 48
“Further probing the relationship between nuclear architecture, gene expression, and cell fate, the first high resolution Hi-C analysis of development mapped 3D genome organization during mouse neural differentiation in vitro and in vivo (Bonev et al., 2017).”
InfluentialWeiss, F. D., Calderón, L., Wang, Y.-F., Georgieva, R., Guo, Y., Cvetešić, N., Kaur, M., Dharmalingam, G., Krantz, I. D., Lenhard, B., et al. (2021) · Nature Communications · doi:10.1038/s41467-021-23141-9 · Cited by 46
Pahl, M. C., Doege, C. A., Hodge, K. M., Littleton, S. H., Leonard, M. E., Lu, S., Rausch, R., Pippin, J. A., Rosa, M. C. D., Basak, A., et al. (2021) · Nature Communications · doi:10.1038/s41467-021-27001-4 · Cited by 46
Transcriptional Regulation and Implications for Controlling Hox Gene Expression
Afzal, Z., & Krumlauf, R. K. (2022) · Journal of Developmental Biology · doi:10.3390/jdb10010004 · Cited by 51
Repression and 3D-restructuring resolves regulatory conflicts in evolutionarily rearranged genomes
Ringel, A. R., Szabo, Q., Chiariello, A. M., Chudzik, K., Schöpflin, R., Rothe, P., Mattei, A. L., Zehnder, T., Harnett, D., Laupert, V., et al. (2022) · Cell · doi:10.1016/j.cell.2022.09.006 · Cited by 50
“Gene pair co-expressionwas determined from FANTOM5CAGE data, whereas TADswere identified in limb, cortical neuron (CN), and ESC Hi-C (Bonev et al., 2017; Consortium et al., 2014; Kraft et al., 2019; Lizio et al., 2015).”
BackgroundMethodInfluentialSelf-citationLiu, X., Chen, Y., Zhang, Y., Liu, Y., Liu, N., Botten, G. A., Cao, H., Orkin, S. H., Zhang, M. Q., & Xu, J. (2020) · Genome biology · doi:10.1186/s13059-020-01973-w · Cited by 44
Dynamic 3D Chromatin Reorganization during Establishment and Maintenance of Pluripotency
Pelham‐Webb, B., Murphy, D., & Apostolou, E. (2020) · Stem Cell Reports · doi:10.1016/j.stemcr.2020.10.012 · Cited by 45
“In agreement with reports in other cellular systems and during differentiation (Bonev et al., 2017; Crane et al., 2015; Van Bortle et al., 2014), insulation changes during reprogramming associated with transcriptional changes likely by facilitating or preventing enhancer-promoter communication.”
BackgroundMethodNSD1 deposits histone H3 lysine 36 dimethylation to pattern non-CG DNA methylation in neurons
Hamagami, N., Wu, D. Y., Clemens, A. W., Nettles, S. A., Li, A., & Gabel, H. W. (2023) · Molecular Cell · doi:10.1016/j.molcel.2023.04.001 · Cited by 45
Gentile, C., Berlivet, S., Mayran, A., Paquette, D., Guerard-Millet, F., Bajon, E., Dostie, J., & Kmita, M. (2018) · Developmental Cell · doi:10.1016/j.devcel.2019.05.021 · Cited by 48
Computational Biology Solutions to Identify Enhancers-target Gene Pairs
Hariprakash, J. M., & Ferrari, F. (2019) · Computational and Structural Biotechnology Journal · doi:10.1016/j.csbj.2019.06.012 · Cited by 41
“Namely, the 3C-derived technologies such as Hi-C [17], ChIA-PET [18] and capture Hi-C [19,20] have added more resources to this repertoire of knowledge, while achieving higher and higher resolution over the years [21,22], as reviewed in [23].”
BackgroundPeñalosa-Ruiz, G., Bright, A. R., Mulder, K. W., & Veenstra, G. J. C. (2019) · Biochimica et Biophysica Acta (BBA) - Gene Regulatory Mechanisms · doi:10.1016/j.bbagrm.2019.194407 · Cited by 42
“Upon differentiation those contacts are lost [56,59].”
BackgroundMethodInfluentialMesoscale Liquid Model of Chromatin Recapitulates Nuclear Order of Eukaryotes
Laghmach, R., Pierro, M. D., & Potoyan, D. A. (2019) · Biophysical Journal · doi:10.1016/j.bpj.2019.09.013 · Cited by 39
The multiscale effects of polycomb mechanisms on 3D chromatin folding
Cheutin, T., & Cavalli, G. (2019) · Critical Reviews in Biochemistry and Molecular Biology · doi:10.1080/10409238.2019.1679082 · Cited by 43
“…interactions described a strong network of interaction between Polycomb-associated chromatin in mouse ESCs that becomes progressively disrupted during neuronal differentiation, although some of the distant Polycombbound sites actually gained interactions upon differentiation (Bonev et al. 2017).”
BackgroundSelf-citationTADKB: Family classification and a knowledge base of topologically associating domains
Liu, T., Porter, J., Zhao, C., Zhu, H., Wang, N., Sun, Z., Mo, Y.-Y., & Wang, Z. (2019) · BMC Genomics · doi:10.1186/s12864-019-5551-2 · Cited by 41
The essential but enigmatic regulatory role of HERVH in pluripotency
Sexton, C. E., Tillett, R. L., & Han, M. (2021) · Trends in Genetics · doi:10.1016/j.tig.2021.07.007 · Cited by 47
“Although CTCF defines 75–95% of TAD boundaries in mammals, there is a minor proportion of TAD boundaries that are not associated with CTCF, which are instead associated with active transcription or chromatin type [30,33].”
BackgroundSanalkumar, R., Dong, R., Lee, L., Xing, Y., Iyer, S., Letovanec, I., Rosa, S. L., Finzi, G., Musolino, E., Papait, R., et al. (2023) · Science Advances · doi:10.1126/sciadv.abo3789 · Cited by 45
The Stochastic Genome and Its Role in Gene ExpressionPreprint
Bohrer, C. H., & Larson, D. R. (2021) · Cold Spring Harbor Perspectives in Biology · doi:10.1101/cshperspect.a040386 · Cited by 43
Maintaining Transcriptional Specificity Through Mitosis
Ito, K., & Zaret, K. S. (2022) · Annual Review of Genomics and Human Genetics · doi:10.1146/annurev-genom-121321-094603 · Cited by 39
Yang, X., Hu, B., Liao, J., Qiao, Y., Chen, Y., Qian, Y., Feng, S., Yu, F., Dong, J., Hou, Y., et al. (2019) · Cell Research · doi:10.1038/s41422-019-0234-8 · Cited by 41
Transcription processes compete with loop extrusion to homogenize promoter and enhancer dynamics
Platania, A., Erb, C., Barbieri, M., Molcrette, B., Grandgirard, E., de Kort, M. A. C., Pomp, W., Meaburn, K., Taylor, T., Shchuka, V. M., et al. (2024) · Science Advances · doi:10.1126/sciadv.adq0987 · Cited by 40
“S6A) ( 26 ).”
p63 cooperates with CTCF to modulate chromatin architecture in skin keratinocytes
Qu, J., Yi, G., & Zhou, H. (2019) · Epigenetics & Chromatin · doi:10.1186/s13072-019-0280-y · Cited by 38
An enhancer cluster controls gene activity and topology of the SCN5A-SCN10A locus in vivo
Man, J. C. K., Mohan, R. A., van den Boogaard, M., Hilvering, C. R. E., Jenkins, C., Wakker, V., Bianchi, V., de Laat, W. L., Barnett, P., Boukens, B. J., et al. (2019) · Nature Communications · doi:10.1038/s41467-019-12856-5 · Cited by 43
LATS kinase–mediated CTCF phosphorylation and selective loss of genomic binding
Luo, H., Yu, Q., Liu, Y., Tang, M., Liang, M., Zhang, D., Xiao, T. S., Wu, L., Tan, M., Ruan, Y., et al. (2020) · Science Advances · doi:10.1126/sciadv.aaw4651 · Cited by 39
Hierarchical chromatin organization detected by TADpole
Soler-Vila, P., Cuscó, P., Farabella, I., Stefano, M. D., & Martı́-Renom, M. A. (2020) · Nucleic Acids Research · doi:10.1093/nar/gkaa087 · Cited by 39
CHESS enables quantitative comparison of chromatin contact data and automatic feature extraction
Galan, S., Machnik, N., Kruse, K., Díaz, N., Martı́-Renom, M. A., & Vaquerizas, J. M. (2020) · Nature Genetics · doi:10.1038/s41588-020-00712-y · Cited by 38
Chromatin Liquid–Liquid Phase Separation (LLPS) Is Regulated by Ionic Conditions and Fiber Length
Chen, Q., Zhao, L., Soman, A., Arkhipova, A. Y., Li, J., Li, H., Chen, Y., Shi, X., & Nordenskiöld, L. (2022) · Cells · doi:10.3390/cells11193145 · Cited by 40
Simultaneous profiling of chromatin architecture and transcription in single cells
Qu, J., Sun, J., Zhao, C., Liu, X., Zhang, X., Jiang, S., Wei, C., Yu, H., Zeng, X., Fan, L., et al. (2023) · Nature Structural & Molecular Biology · doi:10.1038/s41594-023-01066-9 · Cited by 39
Chromatin and Epigenetic Rearrangements in Embryonic Stem Cell Fate Transitions
Sun, L., Fu, X., Ma, G., & Hutchins, A. P. (2021) · Frontiers in Cell and Developmental Biology · doi:10.3389/fcell.2021.637309 · Cited by 38
Laber, S., Forcisi, S., Bentley, L., Petzold, J., Moritz, F., Smirnov, K. S., Sadat, L. A., Williamson, I., Strobel, S., Agnew, T., et al. (2021) · Science Advances · doi:10.1126/sciadv.abg0108 · Cited by 39
“Hi-C data from human H1-ESC (top track) (16) and mouse embryonic stem cell (mESC) (bottom track) (74) are visualized in the 3D Genome Browser (http://3dgenome.”
BackgroundSex-specific multi-level 3D genome dynamics in the mouse brain
Rocks, D., Shukla, M., Ouldibbat, L., Finnemann, S. C., Kalluchi, A., Rowley, M. J., & Kundaković, M. (2022) · Nature Communications · doi:10.1038/s41467-022-30961-w · Cited by 39
Liu, Y., Wan, X., Li, H., Chen, Y., Hu, X., Chen, H., Zhu, D., Li, C., & Zhang, Y. (2023) · Cell Reports · doi:10.1016/j.celrep.2023.113259 · Cited by 39
Spatial enhancer activation influences inhibitory neuron identity during mouse embryonic development
Dvoretskova, E., Ho, M. C., Kittke, V., Neuhaus, F., Vitali, I., Lam, D. D., Delgado, I., Feng, C., Torres, M., Winkelmann, J., et al. (2024) · Nature Neuroscience · doi:10.1038/s41593-024-01611-9 · Cited by 36
Modeling Down syndrome in animals from the early stage to the 4.0 models and next
Moreno, M. D. M. M., Brault, V., Birling, M., Pavlovic, G., & Hérault, Y. (2020) · Progress in brain research · doi:10.1016/bs.pbr.2019.08.001 · Cited by 35
“The Mouse data, displayed corresponds to the neuronal cortex Hi-C map with a resolution of 25 Kbs from the assembly version mm10 (Bonev et al., 2017).”
Computational approaches from polymer physics to investigate chromatin folding
Bianco, S., Chiariello, A. M., Conte, M., Esposito, A., Fiorillo, L., Musella, F., & Nicodemi, M. (2020) · Current Opinion in Cell Biology · doi:10.1016/j.ceb.2020.01.002 · Cited by 41
Closser, M., Guo, Y., Wang, P., Patel, T., Jang, S., Hammelman, J., de Nooij, J. C., Kopunova, R., Mazzoni, E. O., Ruan, Y., et al. (2021) · Neuron · doi:10.1016/j.neuron.2021.10.014 · Cited by 41
Evolution of genetic mechanisms regulating cortical neurogenesis
Espinós, A., Ortuño, E. F., Negri, E., & Borrell, V. (2022) · Developmental Neurobiology · doi:10.1002/dneu.22891 · Cited by 38
“This is the case of Sox2, its expression driven by an Embryonic Stem (ES)-specific enhancer at early embryonic stages, and then by an NPC-specific enhancer at late stages (Bonev et al., 2017).”
BackgroundActive enhancers strengthen insulation by RNA-mediated CTCF binding at chromatin domain boundariesPreprint
Islam, Z., Saravanan, B., Walavalkar, K., Farooq, U., Singh, A. K., Sabarinathan, R., Thakur, J., Pandit, A., Henikoff, S., & Notani, D. (2023) · Genome Research · doi:10.1101/gr.276643.122 · Cited by 39
“However, activation of transcription at the boundary alone is not sufficient to maintain a TAD boundary (Bonev et al. 2017; Hug et al. 2017).”
BackgroundResultThe global and promoter-centric 3D genome organization temporally resolved during a circadian cycle
Furlan-Magaril, M., Ando-Kuri, M., Arzate-Mejía, R. G., Morf, J., Cairns, J., Román-Figueroa, A., Tenorio-Hernández, L., Poot-Hernández, A. C., Andrews, S., Várnai, C., et al. (2021) · Genome Biology · doi:10.1186/s13059-021-02374-3 · Cited by 39
PAX3-FOXO1 dictates myogenic reprogramming and rhabdomyosarcoma identity in endothelial progenitors
Searcy, M. B., Larsen, R. K., Stevens, B. T., Zhang, Y., Jin, H., Drummond, C. J., Langdon, C. G., Gadek, K. E., Vuong, K., Reed, K. B., et al. (2023) · Nature Communications · doi:10.1038/s41467-023-43044-1 · Cited by 39
On-Target CRISPR/Cas9 Activity Can Cause Undesigned Large Deletion in Mouse Zygotes
Korablev, A. N., Lukyanchikova, V., Serova, I. A., & Баттулин, Н. Р. (2020) · International Journal of Molecular Sciences · doi:10.3390/ijms21103604 · Cited by 37
“(2017) [57], in HiGlass visualization tool (Figure 1) [86].”
BackgroundMethodInfluentialHistone Variants and Histone Modifications in Neurogenesis
Zhang, M., Zhao, J., Lv, Y., Wang, W., Feng, C., Zou, W., Su, L., & Jiao, J. (2020) · Trends in Cell Biology · doi:10.1016/j.tcb.2020.09.003 · Cited by 37
Understanding and Engineering Chromatin as a Dynamical System across Length and Timescales
Johnstone, C. P., Wang, N., Sevier, S. A., & Galloway, K. E. (2020) · Cell Systems · doi:10.1016/j.cels.2020.09.011 · Cited by 36
Setting the clock of neural progenitor cells during mammalian corticogenesis
Koo, B., Lee, K., Ming, G., Yoon, K., & Song, H. (2022) · Seminars in Cell and Developmental Biology · doi:10.1016/j.semcdb.2022.05.013 · Cited by 36
“Time-dependent gene expression of RGCs can be regulated by global and local epigenetic changes [6,43,48] with reorganization of cell-type-specific 3D chromatin architectures [127,128].”
Background3D spatial genome organization in the nervous system: From development and plasticity to disease
Fujita, Y., Pather, S. R., Ming, G., & Song, H. (2022) · Neuron · doi:10.1016/j.neuron.2022.06.004 · Cited by 37
Generative modeling of multi-mapping reads with mHi-C advances analysis of Hi-C studies
Zheng, Y., Ay, F., & Keleş, S. (2019) · eLife · doi:10.7554/elife.38070 · Cited by 34
TAD fusion score: discovery and ranking the contribution of deletions to genome structure
Huynh, L. N., & Hormozdiari, F. (2019) · Genome biology · doi:10.1186/s13059-019-1666-7 · Cited by 35
“But this limitation can be overcome as more high-resolution Hi-C data will be contributed by the community [68] and the computational tool such as [69] can also help us predict the high-resolution data.”
BackgroundEpigenetic mechanism of SETDB1 in brain: implications for neuropsychiatric disorders
Zhu, Y.-Y., Sun, D., Jakovcevski, M., & Jiang, Y. (2020) · Translational Psychiatry · doi:10.1038/s41398-020-0797-7 · Cited by 29
HiGlass: Web-based Visual Exploration and Analysis of Genome Interaction MapsPreprint
Kerpedjiev, P., Abdennur, N. A., Lekschas, F., McCallum, C., Dinkla, K., Strobelt, H., Luber, J. M., Ouellette, S., Azhir, A., Kumar, N., et al. (2017) · bioRxiv (Cold Spring Harbor Laboratory) · doi:10.1101/121889 · Cited by 43
Hsieh, T.-H. S., Cattoglio, C., Slobodyanyuk, E., Hansen, A. S., Darzacq, X., & Tjian, R. (2021) · doi:10.1101/2021.07.14.452365 · Cited by 42
Species-specific regulation of XIST by the JPX/FTX orthologs
Rosspopoff, O., Cazottes, E., Huret, C., Loda, A., Collier, A., Casanova, M., Rugg-Gunn, P., Heard, E., Ouimette, J.-F., & Rougeulle, C. (2023) · Nucleic Acids Research · doi:10.1093/nar/gkad029 · Cited by 31
BRD9 determines the cell fate of hematopoietic stem cells by regulating chromatin state
Xiao, M., Kondo, S., Nomura, M., Kato, S., Nishimura, K., Zang, W., Zhang, Y., Akashi, T., Viny, A. D., Shigehiro, T., et al. (2023) · Nature Communications · doi:10.1038/s41467-023-44081-6 · Cited by 39
Similarities and differences in the regulation of HoxD genes during chick and mouse limb development
Yakushiji‐Kaminatsui, N., Lopez‐Delisle, L., Bolt, C. C., Andrey, G., Beccari, L. L., & Duboule, D. (2018) · PLoS Biology · doi:10.1371/journal.pbio.3000004 · Cited by 29
Genome Improvement and Core Gene Set Refinement of Fugacium kawagutii
Li, T., Yu, L., Song, B., Song, Y., Li, L., Lin, X., & Lin, S. (2020) · Microorganisms · doi:10.3390/microorganisms8010102 · Cited by 35
Snetkova, V., & Skok, J. A. (2018) · Epigenomics · doi:10.2217/epi-2017-0157 · Cited by 34
An epigenome atlas of neural progenitors within the embryonic mouse forebrain
Rhodes, C. T., Thompson, J. J., Mitra, A., Asokumar, D., Lee, D. R., Lee, D. J., Zhang, Y., Jason, E., Dale, R., Rocha, P. P., et al. (2022) · Nature Communications · doi:10.1038/s41467-022-31793-4 · Cited by 34
Rapid depletion of CTCF and cohesin proteins reveals dynamic features of chromosome architecturePreprint
Liu, N.-Q., Magnitov, M. D., Schijns, M. M. G. A., van Schaik, T., van der Weide, R. H., Teunissen, H., van Steensel, B., & de Wit, E. (2021) · bioRxiv · doi:10.1101/2021.08.27.457977 · Cited by 34
“Both Hi-C (Bonev et al., 2017) and ChIA-PET (Li et al., 2012) analyses have revealed clustering of active promoters.”
BackgroundMethodInfluentialPolycomb Repressive Complexes in Hox Gene Regulation: Silencing and Beyond
Gentile, C., & Kmita, M. (2020) · BioEssays · doi:10.1002/bies.201900249 · Cited by 35
Lee, D.-I., & Roy, S. (2021) · Genome biology · doi:10.1186/s13059-021-02378-z · Cited by 34
“…regions potentially involved in local topological changes during the mouse neural development, we took GRiNCH clusters from the Hi-C data of mouse embryonic stem cells (mESC), neural progenitors (NPC), and cortical neurons (CN) [45] and looked for cluster merges or splits across the time points.”
InfluentialRheinberger, M., Costa, A. L., Kampmann, M., Glavaš, D., Shytaj, I. L., Sreeram, S., Penzo, C., Tibroni, N., García‐Mesa, Y., Leskov, K., et al. (2023) · Cell Reports · doi:10.1016/j.celrep.2023.112110 · Cited by 33
Rahman, S., Dong, P., Apontes, P., Fernando, M. B., Kosoy, R., Townsley, K. G., Girdhar, K., Bendl, J. M., Shao, Z., Misir, R., et al. (2023) · Nucleic Acids Research · doi:10.1093/nar/gkad798 · Cited by 32
“Previous studies have identified long-range polycomb-associated interactions in ES cells and human cell lines ( 11 ,80–86 ).”
BackgroundResultSingle cell epigenomic atlas of the developing human brain and organoids
Ziffra, R. S., Kim, C. N., Wilfert, A., Turner, T. N., Haeussler, M., Casella, A. M., Przytycki, P. F., Kreimer, A., Pollard, K. S., Ament, S. A., et al. (2019) · doi:10.1101/2019.12.30.891549 · Cited by 33
3D genome folding in epigenetic regulation and cellular memory
Paldi, F., & Cavalli, G. (2025) · Trends in Cell Biology · doi:10.1016/j.tcb.2025.03.001 · Cited by 34
“Compartment changes are well correlated with transcriptional changes that occur during cellular state transitions [55–58], but cause–consequence relationships vary according to genomic position and biological condition.”
Self-citationKopp, N., Nygaard, K. R., Liu, Y., McCullough, K. B., Maloney, S. E., Gabel, H. W., & Dougherty, J. D. (2020) · Human Molecular Genetics · doi:10.1093/hmg/ddaa070 · Cited by 32
“5 cortical neuron HiC data (66) was carried out using domains previously called by arrowhead (67,68).”
MethodLong-distance association of topological boundaries through nuclear condensates
Gamliel, A., Meluzzi, D., Oh, S., Jiang, N., Destici, E., Rosenfeld, M. G., & Nair, S. J. (2022) · Proceedings of the National Academy of Sciences · doi:10.1073/pnas.2206216119 · Cited by 38
“Overrepresentation of the highly transcribed housekeeping genes has been a key feature of the TAD boundaries (9, 41).”
BackgroundGalupa, R., & Heard, É. (2017) · Cold Spring Harbor Symposia on Quantitative Biology · doi:10.1101/sqb.2017.82.035030 · Cited by 30
“Cohesin is present in the CTCF-bound boundaries, as well as in those associated with active promoters (Bonev et al. 2017).”
BackgroundResultInfluentialCohesin-mediated 3D contacts tune enhancer-promoter regulationPreprint
Guckelberger, P., Doughty, B. R., Munson, G., Rao, S. S. P., Tan, Y., Cai, X. S., Fulco, C. P., Nasser, J., Mualim, K. S., Bergman, D. T., et al. (2024) · bioRxiv (Cold Spring Harbor Laboratory) · doi:10.1101/2024.07.12.603288 · Cited by 33
Ramirez, M., Badayeva, Y., Yeung, J., Wu, J., Abdalla-Wyse, A., Yang, E., Trost, B., Scherer, S. W., & Goldowitz, D. (2022) · eLife · doi:10.7554/elife.74207 · Cited by 33
“…revealed that neural progenitor cells and mature neurons exhibit distinct signatures of enhancer-associated histone profiles, DNA methylation, chromatin conformation and enhancer-promoter interactions ( Bonev et al., 2017 ; Torre-Ubieta et al., 2018 ; Lister et al., 2013 ; Whyte et al., 2012 ).”
InfluentialTuning cohesin trajectories enables differential readout of the Pcdhα cluster across neurons
Kiefer, L., Gaudin, S., Rajkumar, S. M., Servito, G., Langen, J., Mui, M. H., Nawsheen, S., & Canzio, D. (2024) · Science · doi:10.1126/science.adm9802 · Cited by 29
“To establish the molecular basis of the Pcdh a expression profile in CNs, we queried the chromatin landscape of the Pcdh a locus in these cells ( 37 ).”
MethodSpatial Genome Organization: From Development to Disease
Sivakumar, A., Heras, J. I. D. L., & Schirmer, E. C. (2019) · Frontiers in Cell and Developmental Biology · doi:10.3389/fcell.2019.00018 · Cited by 34
CRUP: a comprehensive framework to predict condition-specific regulatory units
Ramisch, A., Heinrich, V., Glaser, L. V., Fuchs, A., Yang, X., Benner, P., Schöpflin, R., Li, N., Kinkley, S., Römer-Hillmann, A., et al. (2019) · Genome biology · doi:10.1186/s13059-019-1860-7 · Cited by 29
“Raw data from RNA-seq for the three in vitro-generated murine cell types ES, NPC, and CN were downloaded via GEO (GEO:GSE96107 [31]) and aligned to the genome assembly GRCm38 with BWA-MEM [72, 73].”
BackgroundMethodInfluentialHIFI: estimating DNA-DNA interaction frequency from Hi-C data at restriction-fragment resolution
Cameron, C. J. F., Dostie, J., & Blanchette, M. (2020) · Genome biology · doi:10.1186/s13059-019-1913-y · Cited by 31
Kakui, Y., Barrington, C., Barry, D. J., Gerguri, T., Fu, X., Bates, P. A., Khatri, B. S., & Uhlmann, F. (2020) · Genome biology · doi:10.1186/s13059-020-02183-0 · Cited by 30
“Chromatin loops in turn stabilize promoter-enhancer interactions, while stripes are observed along actively transcribed gene bodies [14, 16].”
BackgroundPHC1 maintains pluripotency by organizing genome-wide chromatin interactions of the Nanog locus
Chen, L., Tong, Q., Chen, X.-W., Jiang, P.-L., Yu, H., Zhao, Q.-B., Sun, L.-G., Liu, C., Gu, B., Zheng, Y., et al. (2021) · Nature Communications · doi:10.1038/s41467-021-22871-0 · Cited by 25
Decoding the PITX2-controlled genetic network in atrial fibrillation
Steimle, J. D., Canozo, F. J. G., Park, M., Kadow, Z. A., Samee, M. A. H., & Martin, J. F. (2022) · JCI Insight · doi:10.1172/jci.insight.158895 · Cited by 33
“Wang Q, et al. Sub-kb Hi-C in D. melanogaster reveals conserved characteristics of TADs between insect and mammalian cells.”
MethodInfluentialCell-type-specific programs for activity-regulated gene expression
Gray, J. M., & Spiegel, I. (2018) · Current Opinion in Neurobiology · doi:10.1016/j.conb.2018.11.001 · Cited by 30
“These are efforts that will be aided by the rapid advance of genome-engineering techniques based on CRISPR/Cas9 and their use in specific types of neurons [45,46], as well as by highthroughput methods for globally determining chromatin conformation [47,48].”
BackgroundSuper-enhancers and novel therapeutic targets in colorectal cancer
Liu, Q., Guo, L., Lou, Z., Xiang, X., & Shao, J. (2022) · Cell Death and Disease · doi:10.1038/s41419-022-04673-4 · Cited by 31
Systematic assessment of ISWI subunits shows that NURF creates local accessibility for CTCF
Iurlaro, M., Masoni, F., Flyamer, I. M., Wirbelauer, C., Iskar, M., Burger, L., Giorgetti, L., & Schübeler, D. (2024) · Nature Genetics · doi:10.1038/s41588-024-01767-x · Cited by 35
CTCF depletion decouples enhancer-mediated gene activation from chromatin hub formation
Karpińska, M. A., Zhu, Y., Ghazvini, Z. F., Ramasamy, S., Barbieri, M., Cao, T. B. N., Varahram, N., Aljahani, A., Lidschreiber, M., Papantonis, A., et al. (2025) · Nature Structural & Molecular Biology · doi:10.1038/s41594-025-01555-z · Cited by 35
“In addition, affinity between transcription factors and coactivators bound at enhancers and promoters is thought to have a role in the formation of specific interactions between these elements 11,12 .”
Advances and Limitations of Current Epigenetic Studies Investigating Mammalian Axonal Regeneration
Palmisano, I., & Giovanni, S. D. (2018) · Neurotherapeutics · doi:10.1007/s13311-018-0636-1 · Cited by 30
Long non-coding RNA-polycomb intimate rendezvous
Cerase, A., & Tartaglia, G. G. (2020) · Open Biology · doi:10.1098/rsob.200126 · Cited by 32
Dynamic Runx1 chromatin boundaries affect gene expression in hematopoietic development
Owens, D. D. G., Anselmi, G., Oudelaar, A. M., Downes, D. J., Cavallo, A., Harman, J. R., Schweßinger, R., Bucakci, A., Greder, L. V., Ornellas, S. D., et al. (2022) · Nature Communications · doi:10.1038/s41467-022-28376-8 · Cited by 33
“The deepC model was trained on Hi-C data from mESCs (Bonev et al. 2017), withholding mouse chromosome 16 containing Runx1.”
MethodInfluentialCTCF: A misguided jack-of-all-trades in cancer cells
Segueni, J., & Noordermeer, D. (2022) · Computational and Structural Biotechnology Journal · doi:10.1016/j.csbj.2022.05.044 · Cited by 31
Comparative chromatin accessibility upon BDNF stimulation delineates neuronal regulatory elements
Ibarra, I. L., Ratnu, V. S., Gordillo, L., Hwang, I., Mariani, L., Weinand, K., Hammarén, H. M., Heck, J., Bulyk, M. L., Savitski, M. M., et al. (2022) · Molecular Systems Biology · doi:10.15252/msb.202110473 · Cited by 33
“Based on a study linking neuronal stimulation response to the three-dimensional conformation of the genome (Beagan et al , 2020), we integrated the DA-peaks with published Hi-C maps generated across neurodevelopment (Bonev et al , 2017).”
Petryk, N., Reverón-Gómez, N., González‐Aguilera, C., Dalby, M., Andersson, R., & Groth, A. (2021) · Nature Protocols · doi:10.1038/s41596-021-00585-3 · Cited by 31
SCL: a lattice-based approach to infer 3D chromosome structures from single-cell Hi-C data
Zhu, H., & Wang, Z. (2019) · Bioinformatics · doi:10.1093/bioinformatics/btz181 · Cited by 31
Kobow, K., Reid, C. A., van Vliet, E. A., Becker, A. J., Carvill, G. L., Goldman, A. M., Hirose, S., Lopes‐Cendes, Í., Khiari, H. M., Poduri, A., et al. (2020) · Epileptic Disorders · doi:10.1684/epd.2020.1143 · Cited by 31
Interactions Between Ticks and Lyme Disease Spirochetes
Pal, U., Kitsou, C., Drecktrah, D., Büyüktanır, Ö., & Fikrig, E. (2020) · Current Issues in Molecular Biology · doi:10.21775/cimb.042.113 · Cited by 30
Three-dimensional chromatin organization in cardiac development and disease
Bertero, A., & Rosa‐Garrido, M. (2020) · Journal of Molecular and Cellular Cardiology · doi:10.1016/j.yjmcc.2020.11.008 · Cited by 32
“in direct control of transcription, for instance by mediating enhancerpromoter interactions or by promoting the formation of polycomb complexes [69].”
BackgroundThe comparative integrated multi-omics analysis identifies CA2 as a novel target for chordoma.
Meng, T., Huang, R., Jin, J.-L., Gao, J., Liu, F.-Y., Wei, Z., Xu, X.-W., Chang, Z.-Y., Lin, J., Ta, N., et al. (2021) · Neuro-Oncology · doi:10.1093/neuonc/noab156 · Cited by 24
Self-citationHao, R.-H., Guo, Y., Wang, C., Chen, F., Di, C., Dong, S., Cao, Q.-L., Guo, J., Rong, Y., Yao, S., et al. (2022) · Cell Death and Differentiation · doi:10.1038/s41418-022-01035-7 · Cited by 34
Synergy between regulatory elements can render cohesin dispensable for distal enhancer function
Hansen, K. L., Adachi, A. S., Braccioli, L., Kadvani, S., Boileau, R. M., Martinovic, M., Pokorny, B., Shah, R., Anderson, E. C., Zhang, K., et al. (2026) · Science · doi:10.1126/science.adt4221 · Cited by 29
Transcription regulates the spatio-temporal dynamics of genes through micro-compartmentalization
Salari, H., Fourel, G., & Jost, D. (2024) · Nature Communications · doi:10.1038/s41467-024-49727-7 · Cited by 35
“For example, the observed correlation between intra-gene compaction and the number of exons [19] at similar Pol II occupancy (Fig.”
Cell type–specific 3D-genome organization and transcription regulation in the brain
Liu, S., Wang, C. Y., Zheng, P., Jia, B. B., Zemke, N. R., Ren, P., Park, H. L., Ren, B., & Zhuang, X. (2025) · Science Advances · doi:10.1126/sciadv.adv2067 · Cited by 34
“Neurons, which have higher transcriptional activity than non-neuronal cells, likely have a higher frequency of enhancer-promoter interactions or other chromatin interactions such as gene-body domains ( 30 , 35 , 92 ), which may contribute to their tighter chromatin packaging at this length scale.”
Johanson, T. M., Coughlan, H. D., Lun, A. T. L., Bediaga, N. G., Naselli, G., Garnham, A. L., Harrison, L. C., Smyth, G. K., & Allan, R. S. (2018) · PLoS Genetics · doi:10.1371/journal.pgen.1007431 · Cited by 27
Enhancer Dysfunction in 3D Genome and Disease
Xia, J., & Wei, G. (2019) · Cells · doi:10.3390/cells8101281 · Cited by 26
Brackley, C. A., & Marenduzzo, D. (2020) · Briefings in Functional Genomics · doi:10.1093/bfgp/elz032 · Cited by 31
“Chromosome organisation is also known to change during cell differentiation [3, 4], in senescence [5, 6], and in disease [7].”
BackgroundDifferential 3D chromatin organization and gene activity in genomic imprinting.
Noordermeer, D., & Feil, R. (2020) · Current Opinion in Genetics and Development · doi:10.1016/j.gde.2020.03.004 · Cited by 25
“The 453 positions of the TAD boundaries are indicated with black dashed lines [33].”
BackgroundInfluentialA complex regulatory landscape involved in the development of mammalian external genitals
Amândio, A. R., Lopez‐Delisle, L., Bolt, C. C., Mascrez, B., & Duboule, D. (2020) · eLife · doi:10.7554/elife.52962 · Cited by 26
Attach and stretch: Emerging roles for genome–lamina contacts in shaping the 3D genome
Rullens, P. M. J., & Kind, J. (2020) · Current Opinion in Cell Biology · doi:10.1016/j.ceb.2020.11.006 · Cited by 26
Nucleome programming is required for the foundation of totipotency in mammalian germline development
Nagano, M., Hu, B., Yokobayashi, S., Yamamura, A., Umemura, F., Coradin, M., Ohta, H., Yabuta, Y., Ishikura, Y., Okamoto, I., et al. (2022) · The EMBO Journal · doi:10.15252/embj.2022110600 · Cited by 27
“In particular, pooled mESC data from (Bonev et al , 2017) after 10 × down-sampling were used for training with default parameters; the inference was then performed using default parameters.”
Influential
Metadata
- Authors
- Bonev, B., Mendelson Cohen, N., Szabo, Q., Fritsch, L., Papadopoulos, G. L., Lubling, Y., Xu, X., Lv, X., Hugnot, J.-P., Tanay, A., & Cavalli, G.
- Affiliations
- Centre National de la Recherche Scientifique (FR)
- Weizmann Institute of Science (IL)
- BGI Group (China) (CN)
- Inserm (FR)
- Corresponding author
- Bonev, Boyan
- Cavalli, Giacomo
- ORCID
- Venue
- Cell
- Publisher
- Elsevier BV
- Published
- 2017-10
- Volume
- 171
- Issue
- 3
- Pages
- 557-572.e24
- ISSN
- 0092-8674 (ISSN-L)
- PMC
- PMC5651218
- OpenAlex
- W2765567136
- Semantic Scholar
- 0728437b5553338297a6cc1bad9f15766a1e1c43
- Cited by
- 1,338
- References
- 53
- Citations by year
- 2026: 110 · 2025: 129 · 2024: 143 · 2023: 139 · 2022: 166 · 2021: 181 · 2020: 190 · 2019: 170 · 2018: 100 · 2017: 6
- FWCI
- 52.01
- Type
- journal article
- Language
- en
- Open access
- hybrid
- doi.org
- Locations
- Cell (publishedVersion, cc-by)
- PubMed Central (publishedVersion, cc-by)
- PubMed (publishedVersion)
- HAL (submittedVersion, cc-by)
- Funders
- European Research Council (232947)
- Israeli Science Foundation
- CNRS
- FP7 European Network of Excellence EpiGeneSys (676556)
- Agence Nationale de la Recherche (ANR-15-CE12-006-01)
- Fondation pour la Recherche Médicale (144186)
- INSERM and ITMO Cancer (PLBIO16-22)
- Laboratory of Excellence (ANR-10-LABX-12-01)
- Topics
- Life Sciences › Biochemistry, Genetics and Molecular Biology › Molecular Biology › Genomics and Chromatin Dynamics
- Life Sciences › Biochemistry, Genetics and Molecular Biology › Molecular Biology › Chromatin Remodeling and Cancer
- Life Sciences › Biochemistry, Genetics and Molecular Biology › Genetics › Chromosomal and Genetic Variations
- Keywords
- 3D genome organization, chromatin conformation, neuronal differentiation, topologically associating domains, long-range chromatin interactions, chromatin insulation, enhancer-promoter interactions
- MeSH terms
- CCCTC-Binding Factor, Animals, Chromatin, Enhancer Elements, Genetic, Exons, Promoter Regions, Genetic, Repressor Proteins, Transcription Factors, Gene Expression, Genome, Mice, Gene Regulatory Networks, Embryonic Stem Cells, Neurogenesis
About these checks
Registry, retraction, Cites and statistics results are computed, not judged, with one exception: a printed reference that no index lists is read once by a model before it counts as a citation error. Claims are extracted by a model and kept only when their quote appears verbatim in the text; each cited source is then checked, with a model’s help, for whether it says what the claim relies on. Those verdicts can be wrong — read the claim’s quote and the cited source before relying on one.
A language model drew the claims from the paper on 2026-10-10, under version 3 of the claim definition (model deepseek-v4.1-flash, prompt extract-v3).
A second model labelled each claim on 2026-10-10 (model jev-1.13-20260917, definition revision gold-guideline-v0.2).
Statistics and arithmetic are recomputed, not judged.
Confidence bands are shown only for fields calibrated on our annotated test set. None is calibrated yet, so no band is shown.
What counts as a claim ›How we measure confidence ›How we check this ›
Are you an author, or do you see a problem with this page? Request a review
