The DOI matches its Crossref record; 52 of the 53 references it cites were found in a registry or an index; none of the 37 sources its claims cite is checked for support yet.
Multiscale 3D Genome Rewiring during Mouse Neural Development
Open accessAbstract
Chromosome conformation capture technologies have revealed important insights into genome folding. Yet, how spatial genome architecture is related to gene expression and cell fate remains unclear. We comprehensively mapped 3D chromatin organization during mouse neural differentiation in vitro and in vivo, generating the highest-resolution Hi-C maps available to date. We found that transcription is correlated with chromatin insulation and long-range interactions, but dCas9-mediated activation is insufficient for creating TAD boundaries de novo. Additionally, we discovered long-range contacts between gene bodies of exon-rich, active genes in all cell types. During neural differentiation, contacts between active TADs become less pronounced while inactive TADs interact more strongly. An extensive Polycomb network in stem cells is disrupted, while dynamic interactions between neural transcription factors appear in vivo. Finally, cell type-specific enhancer-promoter contacts are established concomitant to gene expression. This work shows that multiple factors influence the dynamics of chromatin interactions in development.
Overview
AI snapshot
Written from the paper’s full text.
TL;DR
Ultra-deep in situ Hi-C across mouse ES cells, neural progenitors, and cortical neurons in vitro and in vivo reveals multiscale 3D genome rewiring during neural differentiation. The study links transcription, CTCF, Polycomb, neural transcription factors, and enhancer-promoter contacts to dynamic chromatin architecture, while showing that transcription alone is not sufficient to create TAD boundaries de novo.
Key findings
- Differentiation involves global compartment reorganization: interactions between active A-type domains decrease, while contacts within inactive B-type domains become stronger; compartment borders decrease with differentiation.
- TADs decrease in number and increase in size; CTCF-less boundaries increase. Developmentally regulated boundaries include 259 ES-specific and 54 neural-specific boundaries. CRISPR-dCas9 activation at Zfp608 and Sox4 caused >10- to 20-fold gene activation but no significant insulation or contact-map change, indicating transcription is correlated with but not sufficient for de novo TAD boundary formation.
- CTCF-mediated loops between convergent CTCF sites increase during differentiation despite decreased CTCF binding; ES-specific CTCF contacts and insulation are lost in NPCs, validated by 3D DNA FISH at the Zfp42 locus.
- Active promoters show CTCF-independent insulation and interact with other active promoters across TAD boundaries; gene bodies of exon-rich, highly expressed genes form long-range contacts in cis and trans, correlating with exon number/splicing. Polycomb-mediated contacts are disrupted during differentiation and correlate with Ring1B rather than H3K27me3. In vivo, neural TFs Pax6, NeuroD2, and Tbr1 organize cell-type-specific contacts, and enhancer-promoter contacts are mostly cell-type specific and generally established concomitantly with gene expression.
Methods
- In situ Hi-C was performed on FACS-purified G0/G1 mouse ES cells, NPCs, and CNs from an in vitro differentiation system, plus NPCs and CNs purified from E14.5 mouse neocortex in vivo. The study reports >40 billion paired-end reads and >17 billion uniquely mapped contacts, with >11 billion uniquely aligned contacts in vitro and ~3 billion per in vivo cell type; maximum resolution reached 750 bp.
- Complementary assays included RNA-seq, ChIP-seq for chromatin marks and factors such as CTCF and Ring1B, 3D DNA FISH, and CRISPR-dCas9-mediated gene activation.
- Hi-C analysis used fragment-end resolution, expected models generated with the Shaman R package, insulation scores, eigenvector-based A/B compartment assignment, aggregate Hi-C maps, and contact enrichment quantification.
Limitations
- The paper states that the in vitro system recapitulates some but not all aspects of cortical development, such as neuronal migration and morphogen signaling; it also notes that whether the observed gene-body contacts are directly linked to co-transcriptional splicing remains to be seen, and whether TF contacts represent true homotypic interactions is unresolved.
- The paper states that clear violations of a simple enhancer-promoter looping model exist, as some enhancer-promoter loops are pre-established.
- Evident from the text: Hi-C is population-averaged and cannot resolve single-cell or allele-specific heterogeneity; FISH validates only selected loci; dCas9 activation was tested at two loci; and in vitro versus in vivo differences may limit generalization.
Model-written summary. Check it against the paper before relying on it.
Integrity signals
Registry
Cites
Statistics
Verification
Claims the paper makes
0 of 37 cited sources checked · 0 supported · 0 flagged
A result the paper reports from its own data — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“We found that transcription is correlated with chromatin insulation and long-range interactions, but dCas9-mediated activation is insufficient for creating TAD boundaries de novo.”
- Also stated in: § Transcription Is Correlated with but Not Sufficient to Induce Insulation at TAD Boundaries De Novo · hedged
“Therefore, transcriptional activation per se appears insufficient to cause chromatin insulation and create a TAD boundary.”
§ Multiscale 3D Genome Rewiring during Mouse Neural Development > Abstract
Load-bearingStrength:plain· not yet calibratedTests✓ Asserted: passes✓ Checkable: passes✓ Load-bearing: passes✓ Based: passes- Also stated in: § Transcription Is Correlated with but Not Sufficient to Induce Insulation at TAD Boundaries De Novo · hedged
A result the paper reports from its own data — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“An extensive Polycomb network in stem cells is disrupted, while dynamic interactions between neural transcription factors appear in vivo.”
- Also stated in: § Polycomb-Mediated Interactions Are Disrupted Independently of H3K27me3 during Neural Differentiation · boosted
“we observed a strong decrease in contact intensity between common H3K27me3 sites, which was especially notable at long distances (Figure S6A).”
§ Multiscale 3D Genome Rewiring during Mouse Neural Development > Abstract
Tests✓ Asserted: passes✓ Checkable: passes✓ Load-bearing: passes✓ Based: passes- Also stated in: § Polycomb-Mediated Interactions Are Disrupted Independently of H3K27me3 during Neural Differentiation · boosted
A result the paper reports from its own data — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“Finally, cell type-specific enhancer-promoter contacts are established concomitant to gene expression.”
§ Multiscale 3D Genome Rewiring during Mouse Neural Development > Abstract
Tests✓ Asserted: passes✓ Checkable: passes✓ Load-bearing: passes✓ Based: passesA result the paper reports from its own data — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“Additionally, we discovered long-range contacts between gene bodies of exon-rich, active genes in all cell types.”
- Also stated in: § Active Gene Promoters and the Bodies of Exon-Rich Genes Interact at Multiple Genomic Scales · plain
“Finally, actively transcribed genes with a large number of exons engage in long-range chromatin loops in clusters both in cis- and in trans.”
§ Multiscale 3D Genome Rewiring during Mouse Neural Development > Abstract
Tests✓ Asserted: passes✓ Checkable: passes✓ Load-bearing: passes✓ Based: passes- Also stated in: § Active Gene Promoters and the Bodies of Exon-Rich Genes Interact at Multiple Genomic Scales · plain
A result the paper reports from its own data — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“We found that transcription is correlated with chromatin insulation and long-range interactions, but dCas9-mediated activation is insufficient for creating TAD boundaries de novo.”
§ Multiscale 3D Genome Rewiring during Mouse Neural Development > Abstract
Tests✓ Asserted: passes✓ Checkable: passes✓ Load-bearing: passes✓ Based: passesA result the paper reports from its own data — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“An extensive Polycomb network in stem cells is disrupted, while dynamic interactions between neural transcription factors appear in vivo.”
§ Multiscale 3D Genome Rewiring during Mouse Neural Development > Abstract
Load-bearingStrength:hedged· not yet calibratedTests✓ Asserted: passes✓ Checkable: passes✓ Load-bearing: passes✓ Based: passesA result the paper reports from its own data — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“We found that genes located in close proximity to the neural-specific TAD boundaries tend to be upregulated (Figures 2Fi and 2Gi)”
§ Multiscale 3D Genome Rewiring during Mouse Neural Development > Results > Transcription Is Correlated with but Not Sufficient to Induce Insulation at TAD Boundaries De Novo
Strength:plain· not yet calibratedCausal:correlational· not yet calibratedTests✓ Asserted: passes✓ Checkable: passes? Load-bearing: unclear✓ Based: passes- Rests on an assumption: The mechanisms contributing to developmentally regulated TAD borders remain poorly understood.
None of the sources cited for this claim have been checked yet.
In the paper
“we observed a similar increase in insulation around SOX11 (Figure S3M).”
§ Multiscale 3D Genome Rewiring during Mouse Neural Development > Results > Transcription Is Correlated with but Not Sufficient to Induce Insulation at TAD Boundaries De Novo
What the sources say
Tests✓ Asserted: passes✓ Checkable: passes✓ Load-bearing: passes✓ Based: passes- Rests on an assumption: The mechanisms contributing to developmentally regulated TAD borders remain poorly understood.
A result the paper reports from its own data — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“Highly conserved boundaries in our system were characterized by a small but consistent increase in insulation during differentiation (Figures S3D–S3F).”
§ Multiscale 3D Genome Rewiring during Mouse Neural Development > Results > Transcription Is Correlated with but Not Sufficient to Induce Insulation at TAD Boundaries De Novo
Strength:plain· not yet calibratedCausal:direct· not yet calibratedTests✓ Asserted: passes✓ Checkable: passes? Load-bearing: unclear✓ Based: passes- Rests on an assumption: The mechanisms contributing to developmentally regulated TAD borders remain poorly understood.
A result the paper reports from its own data — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“Analysis of TAD boundaries revealed that the proportion of the CTCF-less borders increased during differentiation (Figure S3C).”
§ Multiscale 3D Genome Rewiring during Mouse Neural Development > Results > Transcription Is Correlated with but Not Sufficient to Induce Insulation at TAD Boundaries De Novo
Tests✓ Asserted: passes✓ Checkable: passes✓ Load-bearing: passes✓ Based: passes
- It may state two separate claims as one. 53
- Probably not a substantial claim. 14
- The quote only partly states this claim. 1
A result the paper reports from its own data — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“During neural differentiation, contacts between active TADs become less pronounced while inactive TADs interact more strongly.”
- Also stated in: § Global Reorganization of the 3D Genome during Neural Differentiation · plain
“Surprisingly, the interaction strength between A-type domains decreased, whereas contacts within the B compartment became stronger between NPCs and CNs (Figures 1E and S1L).”
§ Multiscale 3D Genome Rewiring during Mouse Neural Development > Abstract
Tests✓ Asserted: passes✓ Checkable: passes✓ Load-bearing: passes✓ Based: passesIt may state two separate claims as one.
- Also stated in: § Global Reorganization of the 3D Genome during Neural Differentiation · plain
A result the paper reports from its own data — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“In total, we sequenced over 40 billion paired-end reads that resulted in more than 17 billion uniquely mapped contacts.”
§ Multiscale 3D Genome Rewiring during Mouse Neural Development > Introduction
Load-bearingStrength:plain· not yet calibratedTests✓ Asserted: passes✓ Checkable: passes✓ Load-bearing: passes✓ Based: passesIt may state two separate claims as one.
A result the paper reports from its own data — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“CTCF was bound to the Sox4 promoter already in ESs, yet insulation dramatically increased only when the gene became expressed at the NPC stage (Figures S3K and S3J).”
§ Multiscale 3D Genome Rewiring during Mouse Neural Development > Results > Transcription Is Correlated with but Not Sufficient to Induce Insulation at TAD Boundaries De Novo
Tests✓ Asserted: passes✓ Checkable: passes✓ Load-bearing: passes✓ Based: passesIt may state two separate claims as one.
- Rests on an assumption: The mechanisms contributing to developmentally regulated TAD borders remain poorly understood.
A result the paper reports from its own data — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“We then examined TADs and found that their number decreased during differentiation (Figure S3A), with a corresponding increase in size (Figure S3B).”
§ Multiscale 3D Genome Rewiring during Mouse Neural Development > Results > Transcription Is Correlated with but Not Sufficient to Induce Insulation at TAD Boundaries De Novo
Strength:plain· not yet calibratedCausal:correlational· not yet calibratedTests✓ Asserted: passes✓ Checkable: passes? Load-bearing: unclear✓ Based: passesIt may state two separate claims as one.
A result the paper reports from its own data — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“the correlation between signal enrichment and eigenvector value for active histone marks decreased during differentiation, while the anti-correlation between H3K9me3 and the eigenvector value became stronger”
§ Multiscale 3D Genome Rewiring during Mouse Neural Development > Results > Global Reorganization of the 3D Genome during Neural Differentiation
Strength:plain· not yet calibratedCausal:correlational· not yet calibratedTests✓ Asserted: passes✓ Checkable: passes? Load-bearing: unclear✓ Based: passesIt may state two separate claims as one.
A result the paper reports from its own data — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“a novel TAD boundary was formed at the transcriptional start site (Tss) of Zfp608 during differentiation (Figure 2H), concomitant with the activation of the gene (Figure S3J) but in the absence of CTCF binding.”
§ Multiscale 3D Genome Rewiring during Mouse Neural Development > Results > Transcription Is Correlated with but Not Sufficient to Induce Insulation at TAD Boundaries De Novo
Tests✓ Asserted: passes✓ Checkable: passes✓ Load-bearing: passes✓ Based: passesIt may state two separate claims as one.
- Rests on an assumption: The mechanisms contributing to developmentally regulated TAD borders remain poorly understood.
A result the paper reports from its own data — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“We observed three classes of boundaries: CTCF-positive boundaries, CTCF-negative boundaries close to active gene promoters, and a set of boundaries without enrichment of active marks (Figure 2A).”
§ Multiscale 3D Genome Rewiring during Mouse Neural Development > Results > Transcription Is Correlated with but Not Sufficient to Induce Insulation at TAD Boundaries De Novo
Load-bearingStrength:plain· not yet calibratedTests✓ Asserted: passes✓ Checkable: passes✓ Load-bearing: passes✓ Based: passesIt may state two separate claims as one.
A result the paper reports from its own data — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“cohesin was found both at CTCF-positive boundaries, where it colocalized with CTCF, and on CTCF-negative borders marked by active transcription (Figure 2A).”
§ Multiscale 3D Genome Rewiring during Mouse Neural Development > Results > Transcription Is Correlated with but Not Sufficient to Induce Insulation at TAD Boundaries De Novo
Tests✓ Asserted: passes✓ Checkable: passes✓ Load-bearing: passes✓ Based: passesIt may state two separate claims as one.
A result the paper reports from its own data — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“the absolute levels of Ring1B decreased during differentiation (with only a mild effect on gene expression [Figure S6D]), while H3K27me3 levels did not (Figure 5D).”
§ Multiscale 3D Genome Rewiring during Mouse Neural Development > Results > Polycomb-Mediated Interactions Are Disrupted Independently of H3K27me3 during Neural Differentiation
Load-bearingStrength:plain· not yet calibratedTests✓ Asserted: passes✓ Checkable: passes✓ Load-bearing: passes✓ Based: passesIt may state two separate claims as one.
A result the paper reports from its own data — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“In contrast, both the contact enrichment and the insulation between ES-specific CTCF regions were decreased in NPCs (Figures 3E, 3F and S4F).”
§ Multiscale 3D Genome Rewiring during Mouse Neural Development > Results > Dynamic CTCF-Based Loops and Insulation during Neural Differentiation
Load-bearingStrength:plain· not yet calibratedTests✓ Asserted: passes✓ Checkable: passes✓ Load-bearing: passes✓ Based: passesIt may state two separate claims as one.
None of the sources cited for this claim have been checked yet.
In the paper
“We observed strong enrichment as expected (Guo et al., 2015, Rao et al., 2014), and the loops were constrained primarily inside TADs and rarely crossed TAD boundaries (Figures 3B and 3D).”
§ Multiscale 3D Genome Rewiring during Mouse Neural Development > Results > Dynamic CTCF-Based Loops and Insulation during Neural Differentiation
What the sources say
Tests✓ Asserted: passes✓ Checkable: passes✓ Load-bearing: passes✓ Based: passesIt may state two separate claims as one.
A result the paper reports from its own data — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“Conserved CTCF were characterized by strong interactions in the convergent orientation (Figures 3E and 3F) and by strong insulation both in ESs and NPCs (Figure S4E).”
§ Multiscale 3D Genome Rewiring during Mouse Neural Development > Results > Dynamic CTCF-Based Loops and Insulation during Neural Differentiation
Tests✓ Asserted: passes✓ Checkable: passes✓ Load-bearing: passes✓ Based: passesIt may state two separate claims as one.
A result the paper reports from its own data — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“we also identified clusters of very long-range (> 30 Mb) chromatin contacts between bodies of expressed genes in cis (Figures 4I and S5K) and also in trans (Figure S5L).”
§ Multiscale 3D Genome Rewiring during Mouse Neural Development > Results > Active Gene Promoters and the Bodies of Exon-Rich Genes Interact at Multiple Genomic Scales
Tests✓ Asserted: passes✓ Checkable: passes✓ Load-bearing: passes✓ Based: passesIt may state two separate claims as one.
A result the paper reports from its own data — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“most of these interactions were not mediated by CTCF (Figure 4F) and were readily identified in all three cell types (Figure 4G).”
§ Multiscale 3D Genome Rewiring during Mouse Neural Development > Results > Active Gene Promoters and the Bodies of Exon-Rich Genes Interact at Multiple Genomic Scales
Load-bearingStrength:plain· not yet calibratedTests✓ Asserted: passes✓ Checkable: passes✓ Load-bearing: passes✓ Based: passesIt may state two separate claims as one.
A result the paper reports from its own data — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“only the 3D FISH distance between the pair of probes containing the forward and the reverse CTCF site increased during differentiation, while the other probe pairs displayed the opposite effect (Figures 3H, S4H, and S4I).”
§ Multiscale 3D Genome Rewiring during Mouse Neural Development > Results > Dynamic CTCF-Based Loops and Insulation during Neural Differentiation
Tests✓ Asserted: passes✓ Checkable: passes✓ Load-bearing: passes✓ Based: passesIt may state two separate claims as one.
A result the paper reports from its own data — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“the contact enrichment between gene bodies was highly correlated not only with expression levels, but also with the number of exons per gene (Figures 4J, 4K, and 4M), and was evident across a large range of genomic distances (Figure S5M) in all three cell types (Figure 4N).”
§ Multiscale 3D Genome Rewiring during Mouse Neural Development > Results > Active Gene Promoters and the Bodies of Exon-Rich Genes Interact at Multiple Genomic Scales
Tests✓ Asserted: passes✓ Checkable: passes✓ Load-bearing: passes✓ Based: passesIt may state two separate claims as one.
A result the paper reports from its own data — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“However, the overall enrichment of CTCF-mediated contacts increased with neural differentiation, and even inter-domain contacts became apparent (Figures 3B–3D and S4B).”
§ Multiscale 3D Genome Rewiring during Mouse Neural Development > Results > Dynamic CTCF-Based Loops and Insulation during Neural Differentiation
Tests✓ Asserted: passes✓ Checkable: passes✓ Load-bearing: passes✓ Based: passesIt may state two separate claims as one.
A result the paper reports from its own data — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“During differentiation, only the forward CTCF site became inaccessible to CTCF, and the chromatin loop disappeared (Figure 3G).”
§ Multiscale 3D Genome Rewiring during Mouse Neural Development > Results > Dynamic CTCF-Based Loops and Insulation during Neural Differentiation
Tests✓ Asserted: passes✓ Checkable: passes✓ Load-bearing: passes✓ Based: passesIt may state two separate claims as one.
In the paper
“general TFs such as Taf3 (Liu et al., 2011) appear to enhance interaction between promoters but had little effect on insulation (Figure S5D).”
§ Multiscale 3D Genome Rewiring during Mouse Neural Development > Results > Active Gene Promoters and the Bodies of Exon-Rich Genes Interact at Multiple Genomic Scales
What the sources say
- Not checked yetcites Liu et al., 2011 source
Strength:hedged· not yet calibratedCausal:conditional· not yet calibratedTests✓ Asserted: passes✓ Checkable: passes? Load-bearing: unclear✓ Based: passesIt may state two separate claims as one.
A result the paper reports from its own data — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“we identified a strong preference for insulation centered on active Tss, but not on inactive ones, a phenomenon that was not dependent on CTCF binding (Figures 4A, 4B, S5A, and S5B).”
§ Multiscale 3D Genome Rewiring during Mouse Neural Development > Results > Active Gene Promoters and the Bodies of Exon-Rich Genes Interact at Multiple Genomic Scales
Tests✓ Asserted: passes✓ Checkable: passes✓ Load-bearing: passes✓ Based: passesIt may state two separate claims as one.
A result the paper reports from its own data — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“We observed that average intra-TAD contacts become stronger, while inter-TAD contacts appear to be depleted during differentiation (Figures 3A and S4A).”
§ Multiscale 3D Genome Rewiring during Mouse Neural Development > Results > Dynamic CTCF-Based Loops and Insulation during Neural Differentiation
Tests✓ Asserted: passes✓ Checkable: passes✓ Load-bearing: passes✓ Based: passesIt may state two separate claims as one.
A result the paper reports from its own data — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“we observed no central enrichment when we performed the same analysis using instead 3′ gene ends (Figure S5F), showing that these interactions were specific to promoters and were correlated with the level of expression (Figures 4H and S5J).”
§ Multiscale 3D Genome Rewiring during Mouse Neural Development > Results > Active Gene Promoters and the Bodies of Exon-Rich Genes Interact at Multiple Genomic Scales
Tests✓ Asserted: passes✓ Checkable: passes✓ Load-bearing: passes✓ Based: passesIt may state two separate claims as one.
A result the paper reports from its own data — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“active chromatin loops span across domains and can be observed even at long distances (Figure 4E), in contrast with CTCF-mediated contacts.”
§ Multiscale 3D Genome Rewiring during Mouse Neural Development > Results > Active Gene Promoters and the Bodies of Exon-Rich Genes Interact at Multiple Genomic Scales
Tests✓ Asserted: passes✓ Checkable: passes✓ Load-bearing: passes✓ Based: passesIt may state two separate claims as one.
In the paper
“Therefore, although we confirmed that most TAD boundaries are conserved (Dixon et al., 2012), novel borders can occur at promoters of developmentally regulated genes.”
§ Multiscale 3D Genome Rewiring during Mouse Neural Development > Discussion
What the sources say
- Not checked yetcites Dixon et al., 2012 source
Strength:plain· not yet calibratedTests✓ Asserted: passes✓ Checkable: passes✗ Load-bearing: fails✓ Based: passesProbably not a substantial claim. The paper’s conclusions may not depend on it.
A result the paper reports from its own data — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“Moreover, we identified regions that switch compartments between the in vitro and the in vivo systems, which were accompanied with corresponding changes in gene expression (Figures S8B and S8C).”
§ Multiscale 3D Genome Rewiring during Mouse Neural Development > Results > Cell-Type Specific Chromatin Folding Is Organized around the Neural Transcription Factors Pax6, NeuroD2, and Tbr1 In Vivo
Tests✓ Asserted: passes✓ Checkable: passes✓ Load-bearing: passes✓ Based: passesIt may state two separate claims as one.
A result the paper reports from its own data — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“We observed a strong decrease in the interactions between Sox2 promoter and the ES-specific enhancer (Figure 7G, blue arrow) during differentiation, which coincides with a decrease in both CTCF binding and the H3K27ac mark on the enhancer (Figure 7Gi).”
§ Multiscale 3D Genome Rewiring during Mouse Neural Development > Results > Enhancer-Promoter Contacts Are Mostly Cell-Type Specific and Are Generally Established Concomitantly with Gene Expression
Tests✓ Asserted: passes✓ Checkable: passes✓ Load-bearing: passes✓ Based: passesIt may state two separate claims as one.
A result the paper reports from its own data — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“NeuroD2 and Tbr1 interactions were also mostly constrained inside TADs (Figures 6C, 6D, S7P, and S7Q) but increased during differentiation and were the strongest in CNs in vivo.”
§ Multiscale 3D Genome Rewiring during Mouse Neural Development > Results > Cell-Type Specific Chromatin Folding Is Organized around the Neural Transcription Factors Pax6, NeuroD2, and Tbr1 In Vivo
Tests✓ Asserted: passes✓ Checkable: passes✓ Load-bearing: passes✓ Based: passesIt may state two separate claims as one.
A result the paper reports from its own data — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“These interactions are strongly correlated with the number of splicing events per gene with the strongest contacts occurring between genes that undergo most splicing.”
§ Multiscale 3D Genome Rewiring during Mouse Neural Development > Discussion
Tests✓ Asserted: passes✓ Checkable: passes✓ Load-bearing: passes✓ Based: passesIt may state two separate claims as one.
A result the paper reports from its own data — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“The analysis of a well-controlled differentiation system and its in vivo cell counterparts shows that cell differentiation is accompanied by a global chromatin reorganization and a change in compartmentalization with a decrease in long-range interactions between A-type domains concomitant with an increase in contacts between inactive B-type domains.”
§ Multiscale 3D Genome Rewiring during Mouse Neural Development > Discussion
Tests✓ Asserted: passes✓ Checkable: passes✓ Load-bearing: passes✓ Based: passesIt may state two separate claims as one.
The paper states this without a source or data behind it here, so there is nothing to check it against. The quote shows it is in the paper.
In the paper
“In ESs, the strong long-range interactions also involve Polycomb-bound genes and, to a lesser extent, genes bound by pluripotency TFs.”
§ Multiscale 3D Genome Rewiring during Mouse Neural Development > Discussion
Strength:plain· not yet calibratedCausal:correlational· not yet calibratedTests✓ Asserted: passes✓ Checkable: passes? Load-bearing: unclear✓ Based: passesIt may state two separate claims as one.
A result the paper reports from its own data — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“These networks are reorganized in neuronal differentiation, which in the case of Polycomb appears to correlate with PRC1 binding levels.”
§ Multiscale 3D Genome Rewiring during Mouse Neural Development > Discussion
Tests✓ Asserted: passes✓ Checkable: passes✓ Load-bearing: passes✓ Based: passesIt may state two separate claims as one.
A result the paper reports from its own data — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“We identified a NPC-specific enhancer, which interacted strongly with the promoter of the neuronal TF Brn2 gene only in NPCs, and this interaction was disrupted in CNs when the enhancer was inactive (Figure 7F).”
§ Multiscale 3D Genome Rewiring during Mouse Neural Development > Results > Enhancer-Promoter Contacts Are Mostly Cell-Type Specific and Are Generally Established Concomitantly with Gene Expression
Tests✓ Asserted: passes✓ Checkable: passes✓ Load-bearing: passes✓ Based: passesIt may state two separate claims as one.
A result the paper reports from its own data — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“Principal component analysis (PCA) also confirmed that NPC populations, either in vitro or in vivo, are highly similar to each other and are distinct from CNs and vice versa (Figure S8A).”
§ Multiscale 3D Genome Rewiring during Mouse Neural Development > Results > Cell-Type Specific Chromatin Folding Is Organized around the Neural Transcription Factors Pax6, NeuroD2, and Tbr1 In Vivo
Load-bearingStrength:plain· not yet calibratedTests✓ Asserted: passes✓ Checkable: passes✓ Load-bearing: passes✓ Based: passesIt may state two separate claims as one.
A result the paper reports from its own data — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“Furthermore, the average Hi-C scores and the correlation between expression and chromatin contacts were strongly decreased when we randomly shuffled the position of the enhancer region within the same TAD (Figures 7D, 7E, and S8H).”
§ Multiscale 3D Genome Rewiring during Mouse Neural Development > Results > Enhancer-Promoter Contacts Are Mostly Cell-Type Specific and Are Generally Established Concomitantly with Gene Expression
Tests✓ Asserted: passes✓ Checkable: passes✓ Load-bearing: passes✓ Based: passesIt may state two separate claims as one.
A result the paper reports from its own data — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“We observed a cell-type specific contact enrichment between Pax6-bound sites strongest in ncx NPC where Pax6 is highly expressed (Figures 6C and 6D).”
§ Multiscale 3D Genome Rewiring during Mouse Neural Development > Results > Cell-Type Specific Chromatin Folding Is Organized around the Neural Transcription Factors Pax6, NeuroD2, and Tbr1 In Vivo
Tests✓ Asserted: passes✓ Checkable: passes✓ Load-bearing: passes✓ Based: passesIt may state two separate claims as one.
A result the paper reports from its own data — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“Although we did identify instances of pre-set chromatin interactions between enhancers and their cognate target genes that precede transcriptional activation (Figures 7C, S8N, and S8O), the majority of those interactions appear to be established concomitantly to gene expression and are also disrupted when the genes become repressed.”
§ Multiscale 3D Genome Rewiring during Mouse Neural Development > Results > Enhancer-Promoter Contacts Are Mostly Cell-Type Specific and Are Generally Established Concomitantly with Gene Expression
Tests✓ Asserted: passes✓ Checkable: passes✓ Load-bearing: passes✓ Based: passesIt may state two separate claims as one.
A result the paper reports from its own data — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“mean nuclear radius of the ES, NPC and CNs population were calculated (ES = 1.73 ± 0.28; NPC = 1.39 ± 0.24; CN = 1.43 ± 0.20).”
§ Multiscale 3D Genome Rewiring during Mouse Neural Development > STAR★Methods > Quantification and Statistical Analysis
Load-bearingStrength:plain· not yet calibratedTests✓ Asserted: passes✓ Checkable: passes✓ Load-bearing: passes✓ Based: passesIt may state two separate claims as one.
A result the paper reports from its own data — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“Domains in each cluster exhibit distinct signature based on the enrichment of chromatin marks, replication timing and Lamin B1 DamID enrichment where available (Figure S1I), prompting us to assign cluster 1 to the B-, inactive compartment and cluster 2 to the A-, active compartment.”
§ Multiscale 3D Genome Rewiring during Mouse Neural Development > STAR★Methods > Quantification and Statistical Analysis
Tests✓ Asserted: passes✓ Checkable: passes✓ Load-bearing: passes✓ Based: passesIt may state two separate claims as one.
None of the sources cited for this claim have been checked yet.
In the paper
“At intermediate scales (100 kb to 1 Mb), a major discovery is the existence of topologically associating domains (TADs) (Dixon et al., 2012, Nora et al., 2012, Sexton et al., 2012).”
§ Multiscale 3D Genome Rewiring during Mouse Neural Development > Introduction
What the sources say
Strength:plain· not yet calibratedTests✓ Asserted: passes✓ Checkable: passes✗ Load-bearing: fails✓ Based: passesProbably not a substantial claim. The paper’s conclusions may not depend on it.
What the paper did — it cites no source for this, so there is none to check. The quote shows it is in the paper.
In the paper
“We comprehensively mapped 3D chromatin organization during mouse neural differentiation in vitro and in vivo, generating the highest-resolution Hi-C maps available to date.”
- Also stated in: § Global Reorganization of the 3D Genome during Neural Differentiation · plain
“We reached a maximum resolution of 750 bp—the highest to date (Figure S1F).”
§ Multiscale 3D Genome Rewiring during Mouse Neural Development > Abstract
Load-bearingStrength:plain· not yet calibratedTests✓ Asserted: passes✓ Checkable: passes✓ Load-bearing: passes✓ Based: passesIt may state two separate claims as one.
- Rests on an assumption: Our understanding of the interaction dynamics at the smallest scales during developmental processes is currently limited.
- Rests on an assumption: The relation between loop extrusion models and transcription remains unclear.
- Also stated in: § Global Reorganization of the 3D Genome during Neural Differentiation · plain
A conclusion the paper draws from its own results — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“Our data demonstrate that cellular differentiation involves changes at all scales of folding, and in addition to CTCF-dependent processes, it includes major changes in Polycomb and in transcription factor (TF) interaction networks.”
§ Multiscale 3D Genome Rewiring during Mouse Neural Development > Introduction
Tests✓ Asserted: passes✓ Checkable: passes✓ Load-bearing: passes✓ Based: passesIt may state two separate claims as one.
- Rests on an assumption: Our understanding of the interaction dynamics at the smallest scales during developmental processes is currently limited.
- Rests on an assumption: The relation between loop extrusion models and transcription remains unclear.
In the paper
“At larger scales, interactions between domains are thought to give rise to two main types of spatial compartments referred to as “A” and “B” (Lieberman-Aiden et al., 2009)”
§ Multiscale 3D Genome Rewiring during Mouse Neural Development > Introduction
What the sources say
- Not checked yetcites Lieberman-Aiden et al., 2009 source
Strength:hedged· not yet calibratedCausal:direct· not yet calibratedTests✓ Asserted: passes✓ Checkable: passes✗ Load-bearing: fails✓ Based: passesProbably not a substantial claim. The paper’s conclusions may not depend on it.
What the paper did — it cites no source for this, so there is none to check. The quote shows it is in the paper.
In the paper
“verified that these borders represent a genuine loss or gain of insulation, respectively, using aggregate Hi-C maps (Figure 2E), insulation score (Figures S3G and S3H), and directionality index (DI) (Figure S3I).”
§ Multiscale 3D Genome Rewiring during Mouse Neural Development > Results > Transcription Is Correlated with but Not Sufficient to Induce Insulation at TAD Boundaries De Novo
Load-bearingStrength:boosted· not yet calibratedTests✓ Asserted: passes✓ Checkable: passes✓ Load-bearing: passes✓ Based: passesIt may state two separate claims as one.
- Rests on an assumption: The mechanisms contributing to developmentally regulated TAD borders remain poorly understood.
In the paper
“recent evidence indicates that domains and compartment formation can be at least partially uncoupled and may result from different biological phenomena (Nora et al., 2017).”
§ Multiscale 3D Genome Rewiring during Mouse Neural Development > Introduction
What the sources say
- Not checked yetcites Nora et al., 2017 source
Strength:hedged· not yet calibratedCausal:conditional· not yet calibratedTests✓ Asserted: passes✓ Checkable: passes✗ Load-bearing: fails✓ Based: passesProbably not a substantial claim. The paper’s conclusions may not depend on it. It may state two separate claims as one.
None of the sources cited for this claim have been checked yet.
In the paper
“Domain insulation has been shown to be important for gene expression and physiology (Flavahan et al., 2016, Lupiáñez et al., 2015).”
§ Multiscale 3D Genome Rewiring during Mouse Neural Development > Introduction
What the sources say
Strength:boosted· not yet calibratedCausal:direct· not yet calibratedTests✓ Asserted: passes✓ Checkable: passes✗ Load-bearing: fails✓ Based: passesProbably not a substantial claim. The paper’s conclusions may not depend on it.
In the paper
“which are functionally related to gene expression and can switch extensively during differentiation (Dixon et al., 2015).”
§ Multiscale 3D Genome Rewiring during Mouse Neural Development > Introduction
What the sources say
- Not checked yetcites Dixon et al., 2015 source
Strength:plain· not yet calibratedCausal:correlational· not yet calibratedTests✓ Asserted: passes✓ Checkable: passes✗ Load-bearing: fails✓ Based: passesProbably not a substantial claim. The paper’s conclusions may not depend on it. It may state two separate claims as one.
In the paper
“very few studies using mostly in vitro cultured cells have achieved high resolution (Rao et al., 2014).”
§ Multiscale 3D Genome Rewiring during Mouse Neural Development > Introduction
What the sources say
- Not checked yetcites Rao et al., 2014 source
Load-bearingStrength:plain· not yet calibratedTests✓ Asserted: passes✓ Checkable: passes✓ Load-bearing: passes✓ Based: passesProbably not a substantial claim.
What the paper did — it cites no source for this, so there is none to check. The quote shows it is in the paper.
In the paper
“we employed a fluorescence-activated cell sorting (FACS) approach, which allowed us to purify G0G1 cells based on DNA content”
§ Multiscale 3D Genome Rewiring during Mouse Neural Development > Results > Global Reorganization of the 3D Genome during Neural Differentiation
Strength:plain· not yet calibratedCausal:direct· not yet calibratedTests✓ Asserted: passes✓ Checkable: passes✗ Load-bearing: fails✓ Based: passesProbably not a substantial claim. The paper’s conclusions may not depend on it.
What the paper did — it cites no source for this, so there is none to check. The quote shows it is in the paper.
In the paper
“we controlled for cell type heterogeneity and cell-cycle variation.”
- Also stated in: § Global Reorganization of the 3D Genome during Neural Differentiation · plain
“we employed a fluorescence-activated cell sorting (FACS) approach, which allowed us to purify G0G1 cells based on DNA content”
§ Multiscale 3D Genome Rewiring during Mouse Neural Development > Introduction
Load-bearingStrength:plain· not yet calibratedTests✓ Asserted: passes✓ Checkable: passes✓ Load-bearing: passes✓ Based: passesIt may state two separate claims as one.
- Also stated in: § Global Reorganization of the 3D Genome during Neural Differentiation · plain
None of the sources cited for this claim have been checked yet.
In the paper
“It is known that architectural proteins such as CTCF and cohesin play a role (Haarhuis et al., 2017, Nora et al., 2017, Phillips-Cremins et al., 2013)”
§ Multiscale 3D Genome Rewiring during Mouse Neural Development > Introduction
What the sources say
Strength:boosted· not yet calibratedCausal:correlational· not yet calibratedTests✓ Asserted: passes✓ Checkable: passes✗ Load-bearing: fails✓ Based: passesProbably not a substantial claim. The paper’s conclusions may not depend on it.
What the paper did — it cites no source for this, so there is none to check. The quote shows it is in the paper.
In the paper
“Biological replicates were highly correlated at all resolutions (Figure S1D) and for each different cell type (Figures S1E and S2A).”
§ Multiscale 3D Genome Rewiring during Mouse Neural Development > Results > Global Reorganization of the 3D Genome during Neural Differentiation
Tests✓ Asserted: passes✓ Checkable: passes✓ Load-bearing: passes✓ Based: passesIt may state two separate claims as one.
A conclusion the paper draws from its own results — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“In conclusion, a major genome-folding reprogramming occurs during neural differentiation with a progressive increase in compartment size, decreased interactions within the A compartment, and a concomitant increase in interactions between B-type domains.”
§ Multiscale 3D Genome Rewiring during Mouse Neural Development > Results > Global Reorganization of the 3D Genome during Neural Differentiation
Tests✓ Asserted: passes✓ Checkable: passes✓ Load-bearing: passes✓ Based: passesIt may state two separate claims as one.
- Rests on an assumption: Our understanding of the interaction dynamics at the smallest scales during developmental processes is currently limited.
- Rests on an assumption: The relation between loop extrusion models and transcription remains unclear.
None of the sources cited for this claim have been checked yet.
In the paper
“The deposition of chromatin marks is thought to contribute to this process (Dixon et al., 2015, Nora et al., 2012)”
§ Multiscale 3D Genome Rewiring during Mouse Neural Development > Introduction
What the sources say
Strength:hedged· not yet calibratedCausal:conditional· not yet calibratedTests✓ Asserted: passes✓ Checkable: passes✗ Load-bearing: fails✓ Based: passesProbably not a substantial claim. The paper’s conclusions may not depend on it.
A conclusion the paper draws from its own results — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“In summary, promoters of active genes are characterized by strong insulation, which is correlated with transcriptional activity, but is mostly CTCF independent.”
§ Multiscale 3D Genome Rewiring during Mouse Neural Development > Results > Active Gene Promoters and the Bodies of Exon-Rich Genes Interact at Multiple Genomic Scales
Tests✓ Asserted: passes✓ Checkable: passes✓ Load-bearing: passes✓ Based: passesIt may state two separate claims as one.
None of the sources cited for this claim have been checked yet.
In the paper
“Polycomb-mediated interactions have been previously reported in mouse ESs using a Capture-C approach (Schoenfelder et al., 2015b) and are a prominent feature in Drosophila (Bantignies et al., 2011).”
§ Multiscale 3D Genome Rewiring during Mouse Neural Development > Results > Polycomb-Mediated Interactions Are Disrupted Independently of H3K27me3 during Neural Differentiation
What the sources say
- Not checked yetcites Schoenfelder et al., 2015b
- Not checked yetcites Bantignies et al., 2011 source
Strength:plain· not yet calibratedTests✓ Asserted: passes✓ Checkable: passes✗ Load-bearing: fails✓ Based: passesProbably not a substantial claim. The paper’s conclusions may not depend on it. It may state two separate claims as one.
A conclusion the paper draws from its own results — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“Active Tss maintain contacts with the gene body and, contrary to CTCF interactions, can interact with other transcribed Tss across TAD boundaries.”
§ Multiscale 3D Genome Rewiring during Mouse Neural Development > Results > Active Gene Promoters and the Bodies of Exon-Rich Genes Interact at Multiple Genomic Scales
Tests✓ Asserted: passes✓ Checkable: passes✓ Load-bearing: passes✓ Based: passesIt may state two separate claims as one.
In the paper
“As many as 40–50% of the CTCF sites may change in different cell types (Chen et al., 2012).”
§ Multiscale 3D Genome Rewiring during Mouse Neural Development > Results > Dynamic CTCF-Based Loops and Insulation during Neural Differentiation
What the sources say
- Not checked yetcites Chen et al., 2012 source
Strength:hedged· not yet calibratedCausal:conditional· not yet calibratedTests✓ Asserted: passes✓ Checkable: passes✗ Load-bearing: fails✓ Based: passesProbably not a substantial claim. The paper’s conclusions may not depend on it.
None of the sources cited for this claim have been checked yet.
In the paper
“Chromatin insulation occurs at multiple levels and leads to a hierarchical 3D nuclear organization, whereby smaller, less insulated regions (called also sub-TADs [Flavahan et al., 2016, Phillips-Cremins et al., 2013] or contact domains [Rao et al., 2014]) are nested inside TADs, which are usually bigger and more strongly insulated (Dixon et al., 2012, Nora et al., 2012, Sexton et al., 2012).”
§ Multiscale 3D Genome Rewiring during Mouse Neural Development > Results > Dynamic CTCF-Based Loops and Insulation during Neural Differentiation
What the sources say
Tests✓ Asserted: passes✓ Checkable: passes✓ Load-bearing: passes✓ Based: passesIt may state two separate claims as one.
None of the sources cited for this claim have been checked yet.
In the paper
“However, very few public chromatin immunoprecipitation sequencing (ChIP-seq) profiles exist, and most of those have been performed in the developing mouse neocortex (Bayam et al., 2015, Notwell et al., 2016, Sun et al., 2015).”
§ Multiscale 3D Genome Rewiring during Mouse Neural Development > Results > Cell-Type Specific Chromatin Folding Is Organized around the Neural Transcription Factors Pax6, NeuroD2, and Tbr1 In Vivo
What the sources say
Load-bearingStrength:plain· not yet calibratedTests✓ Asserted: passes✓ Checkable: passes✓ Load-bearing: passes✓ Based: passesIt may state two separate claims as one.
What the paper did — it cites no source for this, so there is none to check. The quote shows it is in the paper.
In the paper
“We performed RNA-seq and verified our approach using known markers for neural progenitors (Nestin) and differentiating neurons (Dcx) (Figure S7D).”
§ Multiscale 3D Genome Rewiring during Mouse Neural Development > Results > Cell-Type Specific Chromatin Folding Is Organized around the Neural Transcription Factors Pax6, NeuroD2, and Tbr1 In Vivo
Load-bearingStrength:plain· not yet calibratedTests✓ Asserted: passes✓ Checkable: passes✓ Load-bearing: passes✓ Based: passesThe quote only partly states this claim.
What the paper did — it cites no source for this, so there is none to check. The quote shows it is in the paper.
In the paper
“Pearson correlation coefficient (Figure S7E), comparison of the eigenvector values, insulation score, and contact probability (Figures S7G and S8A) confirmed the high quality of the data and that, importantly, samples group together based on cell type.”
§ Multiscale 3D Genome Rewiring during Mouse Neural Development > Results > Cell-Type Specific Chromatin Folding Is Organized around the Neural Transcription Factors Pax6, NeuroD2, and Tbr1 In Vivo
Tests✓ Asserted: passes✓ Checkable: passes✓ Load-bearing: passes✓ Based: passesIt may state two separate claims as one.
In the paper
“Pax6 is one of the few “master regulator” neural TFs with a well-known role in cortical development (Manuel et al., 2015).”
§ Multiscale 3D Genome Rewiring during Mouse Neural Development > Results > Cell-Type Specific Chromatin Folding Is Organized around the Neural Transcription Factors Pax6, NeuroD2, and Tbr1 In Vivo
What the sources say
- Not checked yetcites Manuel et al., 2015 source
Strength:boosted· not yet calibratedTests✓ Asserted: passes✓ Checkable: passes✗ Load-bearing: fails✓ Based: passesProbably not a substantial claim. The paper’s conclusions may not depend on it.
A conclusion the paper draws from its own results — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“These results suggest that E-P interactions are highly dynamic and cell-type specific.”
§ Multiscale 3D Genome Rewiring during Mouse Neural Development > Results > Enhancer-Promoter Contacts Are Mostly Cell-Type Specific and Are Generally Established Concomitantly with Gene Expression
Tests✓ Asserted: passes✓ Checkable: passes✓ Load-bearing: passes✓ Based: passesIt may state two separate claims as one.
A conclusion the paper draws from its own results — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“Finally, E-P interactions are highly dynamic and are usually established concomitantly with gene expression.”
§ Multiscale 3D Genome Rewiring during Mouse Neural Development > Discussion
Tests✓ Asserted: passes✓ Checkable: passes✓ Load-bearing: passes✓ Based: passesIt may state two separate claims as one.
What the paper did — it cites no source for this, so there is none to check. The quote shows it is in the paper.
In the paper
“Boundaries within 10Kb of each other were merged and only boundaries, which were detected in at least 3 biological replicates, were retained.”
§ Multiscale 3D Genome Rewiring during Mouse Neural Development > STAR★Methods > Quantification and Statistical Analysis
Load-bearingStrength:plain· not yet calibratedTests✓ Asserted: passes✓ Checkable: passes✓ Load-bearing: passes✓ Based: passesProbably not a substantial claim.
The paper relies on this without support.
Our understanding of the interaction dynamics at the smallest scales during developmental processes is currently limited.
“However, our understanding of the interaction dynamics at the smallest scales during developmental processes is currently limited.”
The paper relies on this without support.
The relation between loop extrusion models and transcription remains unclear.
“However, the relation between such models and transcription remains unclear.”
The paper relies on this without support.
The mechanisms contributing to developmentally regulated TAD borders remain poorly understood.
“yet the mechanisms contributing to developmentally regulated borders remain poorly understood.”
The paper relies on this without support.
The majority of strong Polycomb-bound regions are on gene promoters.
“As the majority of strong Polycomb-bound regions are on gene promoters, we examined whether their interaction might depend on paused Pol II that is located at bivalent gene promoters (Min et al., 2011).”
The paper relies on this without support.
Enhancer-promoter contacts have been difficult to observe in Hi-C, and their strength relative to surrounding regions is unclear.
“Enhancer-promoter (E-P) contacts have been difficult to observe in Hi-C, and it is unclear how strong they are compared to the surrounding regions.”
The paper relies on this without support.
The in vitro differentiation system recapitulates some aspects of cortical development but not others such as neuronal migration and morphogen signaling.
“Furthermore, although the in vitro system we employed recapitulates some aspects of cortical development, other features, such as neuronal migration and morphogen signaling, are not.”
The paper relies on this without support.
The vast majority of ultra-close cis Hi-C contacts (separated by less than 1 kb) originate from non-digested DNA.
“Contacts separated by less than 1kb were not considered for subsequent analysis, as the vast majority of this ultra-close cis contacts originate from non-digested DNA.”
Claims other papers make about this one
Each is checked against this paper’s own text: does it say what the citing paper says it does?
The source backs part of the claim, not all of it — or backs it for a different population, condition or comparison.
In the citing paper
“The Sox2 gene has an essential enhancer, the Sox2 Control Region (SCR), which was found by 3C-derived techniques to loop to the Sox2 promoter (for example, [379, 401]).”
From Transcriptional enhancers and their communication with gene promoters (2021) · cites this paper as [401]
Experimental — accuracy not yet measuredThe source backs part of the claim, not all of it — or backs it for a different population, condition or comparison.
In the citing paper
“active promoters and enhancers can likely give rise to TAD boundaries even in the absence of convergent CTCF sites [401].”
From Transcriptional enhancers and their communication with gene promoters (2021) · cites this paper as [401]
Experimental — accuracy not yet measuredThe cited source says what the claim attributes to it.
In the citing paper
“Interestingly, Hi-C data obtained using differentiated mouse neurons led us to detect chromatin interactions between HAR202 and the Npas3 promoter (Bonev et al. 2017; supplementary fig. S8, Supplementary Material online).”
From The Human Accelerated Region HAR202 Controls NPAS3 Expression in the Developing Forebrain Displaying Differential Enhancer Activity Between Modern and Archaic Human Sequences (2024) · cites this paper as Bonev et al. 2017
The cited source says what the claim attributes to it.
In the citing paper
“The majority of specific enhancer–promoter loops follow this pattern and are highly enriched within, compared with across, TAD boundaries [277, 401, 405].”
From Transcriptional enhancers and their communication with gene promoters (2021) · cites this paper as [401]
In the citing paper
“The 3D genome plays an important role in neuronal gene expression and function”
From Neuronal DNA double-strand breaks lead to genome structural variations and 3D genome disruption in neurodegeneration (2023) · cites this paper as [96]
In the citing paper
“5C maps from our mature primary cortical neurons were highly correlated with and exhibited similar loops as published Hi-C maps from ES cell-derived cortical neurons”
From Three-dimensional genome restructuring across timescales of activity-induced neuronal gene expression (2020) · cites this paper as [33]
In the citing paper
“We applied published methods17 to identify 24,937 loops in cortical neurons”
From Three-dimensional genome restructuring across timescales of activity-induced neuronal gene expression (2020) · cites this paper as [33]
Self-check
Percentages, sums and reported differences re-computed from the paper’s own numbers.
Each contradiction between two passages listed here was confirmed by an independent check.
Guide RNA is labeled for a different gene than the reported activation target
MinorThe experiment is described as activating Zfp608 and Sox4, but the methods label one of the guide RNAs "Zfp604." As written, the stated guide target does not match the gene used for the reported Zfp608 activation result.
“We used the CRISPR-dCas9 system (Konermann et al., 2015) to activate gene expression at the endogenous Zfp608 and Sox4 loci”
“Guide RNAs (Zfp604 – AGAAAGCGGAATGAGAAGTT and Sox4 - TTGCTCTGTAAATTGGAATG) were designed and cloned”
Deposited-data table labels the CN RNA sample as NPC
MinorThe table lists both complementary sorted populations as ncx_NPC, whereas the paper identifies Hes5-GFP−/Dcx-mRFP+ cells as ncx CN.
“| Strand specific total RNA from sorted Hes5-GFP-/Dcx-mRFP+ ncx_NPC cells | This study | GEO: GSE96107 |”
“GFP-/RFP+ (“ncx CN”) populations from the same embryonic brains”
In vivo sorting methods list the NPC population twice
MinorThe figure identifies GFP+/RFP− cells as NPCs and GFP−/RFP+ cells as CNs. The isolation methods instead list GFP+/RFP− and RFP−/GFP+-the same population in reversed notation-rather than the CN population.
“The appropriate gates to isolate GFP+/RFP- and RFP-/GFP+ cells were set as described in Figure S7B.”
“GFP+/RFP- (referred to as “ncx NPC” henceafter) and GFP-/RFP+ (“ncx CN”) populations from the same embryonic brains”
Cacna2d1 contact distance exceeds the stated map region
MinorThe text places the interacting Ring1B site approximately 500 kb downstream of the Cacna2d1 promoter, but the Figure S6J caption says its map shows an approximately 150-kb region around that promoter containing the interaction. A 150-kb region cannot contain both sites as described.
“a loop was formed specifically in NPCs between the Cacna2d1 promoter and another NPC-specific Ring1B site located ∼500 kb downstream in the gene body (Figure S6J).”
“(J) HiC contact maps showing ∼150Kb region around Cacna2d1 promoter. Note the appearance of NPC-specific Ring1B/H3K27me3 site inside Cacna2d1 gene body, which coincides with an interaction between this region and the Cacna2d1 promoter.”
Citations
Cites
A 3D Map of the Human Genome at Kilobase Resolution Reveals Principles of Chromatin Looping
Rao, S. S. P., Huntley, M. H., Durand, N. C., Stamenova, E. K., Bochkov, I. D., Robinson, J. T., Sanborn, A. L., Machol, I., Omer, A. D., Lander, E. S., et al. (2014) · Cell · doi:10.1016/j.cell.2014.11.021 · Cited by 9,212
Comprehensive Mapping of Long-Range Interactions Reveals Folding Principles of the Human Genome
Lieberman-Aiden, E., van Berkum, N. L., Williams, L., Imakaev, M., Ragoczy, T., Telling, A., Amit, I., Lajoie, B. R., Sabo, P. J., Dorschner, M. O., et al. (2009) · Science · doi:10.1126/science.1181369 · Cited by 8,898
Topological domains in mammalian genomes identified by analysis of chromatin interactions
Dixon, J. R., Selvaraj, S., Yue, F., Kim, A., Li, Y., Shen, Y., Hu, M., Liu, J. S., & Ren, B. (2012) · Nature · doi:10.1038/nature11082 · Cited by 6,829
Spatial partitioning of the regulatory landscape of the X-inactivation centre
Nora, E. P., Lajoie, B. R., Schulz, E. G., Giorgetti, L., Okamoto, I., Servant, N., Piolot, T., van Berkum, N. L., Meisig, J., Sedat, J., et al. (2012) · Nature · doi:10.1038/nature11049 · Cited by 2,895
Genome-scale transcriptional activation by an engineered CRISPR-Cas9 complex
Konermann, S., Brigham, M. D., Trevino, A. E., Joung, J., Abudayyeh, O. O., Barcena, C., Hsu, P. D., Habib, N., Gootenberg, J. S., Nishimasu, H., et al. (2015) · Nature · doi:10.1038/nature14136 · Cited by 2,825
Disruptions of Topological Chromatin Domains Cause Pathogenic Rewiring of Gene-Enhancer Interactions
Lupiáñez, D. G., Kraft, K., Heinrich, V., Krawitz, P., Brancati, F., Klopocki, E., Horn, D., Kayserili, H., Opitz, J. M., Laxova, R., et al. (2015) · Cell · doi:10.1016/j.cell.2015.04.004 · Cited by 2,132
Formation of chromosomal domains by loop extrusion
Fudenberg, G., Imakaev, M., Lu, C., Goloborodko, A., Abdennur, N., & Mirny, L. A. (2016) · Cell Reports · doi:10.1016/j.celrep.2016.04.085 · Cited by 2,003
Three-dimensional folding and functional organization principles of the Drosophila genome
Sexton, T., Yaffe, E., Kenigsberg, E., Bantignies, F., Leblanc, B., Hoichman, M., Parrinello, H., Tanay, A., & Cavalli, G. (2012) · Cell · doi:10.1016/j.cell.2012.01.010 · Cited by 1,983
Self-citationMediator and cohesin connect gene expression and chromatin architecture
Kagey, M. H., Newman, J. J., Bilodeau, S., Zhan, Y., Orlando, D. A., van Berkum, N. L., Ebmeier, C. C., Goossens, J., Rahl, P. B., Levine, S. S., et al. (2010) · Nature · doi:10.1038/nature09380 · Cited by 1,939
Sanborn, A. L., Rao, S. S. P., Huang, S.-C., Durand, N. C., Huntley, M. H., Jewett, A. I., Bochkov, I. D., Chinnappan, D., Cutkosky, A., Li, J., et al. (2015) · Proceedings of the National Academy of Sciences · doi:10.1073/pnas.1518552112 · Cited by 1,730
Flagged first, then by citations
1 of the 53 references couldn’t be matched to a known paper.
Cited by
Sorted by citations
HiGlass: web-based visual exploration and analysis of genome interaction maps
Kerpedjiev, P., Abdennur, N. A., Lekschas, F., McCallum, C., Dinkla, K., Strobelt, H., Luber, J. M., Ouellette, S., Azhir, A., Kumar, N., et al. (2018) · Genome biology · doi:10.1186/s13059-018-1486-1 · Cited by 2,430
Organizational principles of 3D genome architecture
Rowley, M. J., & Corces, V. G. (2018) · Nature Reviews Genetics · doi:10.1038/s41576-018-0060-8 · Cited by 1,171
Long-range enhancer–promoter contacts in gene expression control
Schoenfelder, S., & Fraser, P. (2019) · Nature Reviews Genetics · doi:10.1038/s41576-019-0128-0 · Cited by 1,102
The role of 3D genome organization in development and cell differentiation
Zheng, H., & Xie, W. (2019) · Nature Reviews Molecular Cell Biology · doi:10.1038/s41580-019-0132-4 · Cited by 742
The Self-Organizing Genome: Principles of Genome Architecture and Function
Misteli, T. (2020) · Cell · doi:10.1016/j.cell.2020.09.014 · Cited by 742
“…features and by interaction mapping in numerous differentiation and development processes, including hematopoiesis, cardiogenesis, ESC differentiation, mouse development and senescence (Bertero et al., 2019; Bonev et al., 2017; Paulsen et al., 2019; Rajapakse et al., 2009; Sati et al., 2020).”
BackgroundInfluentialResolving the 3D Landscape of Transcription-Linked Mammalian Chromatin Folding
Hsieh, T.-H. S., Cattoglio, C., Slobodyanyuk, E., Hansen, A. S., Rando, O. J., Tjian, R., & Darzacq, X. (2020) · Molecular Cell · doi:10.1016/j.molcel.2020.03.002 · Cited by 661
Developmental enhancers and chromosome topology
Furlong, E. E. M., & Levine, M. (2018) · Science · doi:10.1126/science.aau0320 · Cited by 641
Ultrastructural Details of Mammalian Chromosome Architecture
Krietenstein, N., Abraham, S., Venev, S. V., Abdennur, N., Gibcus, J., Hsieh, T.-H. S., Parsi, K. M., Yang, L., Maehr, R., Mirny, L. A., et al. (2020) · Molecular Cell · doi:10.1016/j.molcel.2020.03.003 · Cited by 622
Principles of genome folding into topologically associating domains
Szabo, Q., Bantignies, F., & Cavalli, G. (2019) · Science Advances · doi:10.1126/sciadv.aaw1668 · Cited by 631
Self-citationIntrinsic mechanisms of neuronal axon regeneration
Mahar, M., & Cavalli, V. (2018) · Nature reviews. Neuroscience · doi:10.1038/s41583-018-0001-8 · Cited by 611
Wang, Y., Song, F., Zhang, B., Zhang, L., Xu, J., Kuang, D., Li, D., Choudhary, M. N. K., Li, Y., Hu, M., et al. (2018) · Genome biology · doi:10.1186/s13059-018-1519-9 · Cited by 559
Transcription factors and 3D genome conformation in cell-fate decisions
Stadhouders, R., Filion, G. J. P., & Graf, T. (2019) · Nature · doi:10.1038/s41586-019-1182-7 · Cited by 530
Dynamics of CTCF- and cohesin-mediated chromatin looping revealed by live-cell imaging
Gabriele, M., Brandão, H. B., Grosse-Holz, S., Jha, A., Dailey, G. M., Cattoglio, C., Hsieh, T.-H. S., Mirny, L., Zechner, C., & Hansen, A. S. (2022) · Science · doi:10.1126/science.abn6583 · Cited by 506
Methods for mapping 3D chromosome architecture
Kempfer, R., & Pombo, A. (2019) · Nature Reviews Genetics · doi:10.1038/s41576-019-0195-2 · Cited by 533
The molecular principles of gene regulation by Polycomb repressive complexes
Blackledge, N. P., & Klose, R. J. (2021) · Nature Reviews Molecular Cell Biology · doi:10.1038/s41580-021-00398-y · Cited by 500
Single-cell CUT&Tag profiles histone modifications and transcription factors in complex tissues
Bartosovic, M., Kabbe, M., & Castelo-Branco, G. (2021) · Nature Biotechnology · doi:10.1038/s41587-021-00869-9 · Cited by 483
Visualizing DNA folding and RNA in embryos at single-cell resolution
Mateo, L. J., Murphy, S. E., Hafner, A., Cinquini, I. S., Walker, C. A., & Boettiger, A. N. (2019) · Nature · doi:10.1038/s41586-019-1035-4 · Cited by 446
Integrated spatial genomics reveals global architecture of single nuclei
Takei, Y., Yun, J., Zheng, S., Ollikainen, N., Pierson, N. G., White, J. A., Shah, S., Thomassie, J., Suo, S., Eng, C.-H. L., et al. (2021) · Nature · doi:10.1038/s41586-020-03126-2 · Cited by 407
Hsieh, T.-H. S., Cattoglio, C., Slobodyanyuk, E., Hansen, A. S., Darzacq, X., & Tjian, R. (2022) · Nature Genetics · doi:10.1038/s41588-022-01223-8 · Cited by 406
Understanding 3D genome organization by multidisciplinary methods
Jerković, I., & Cavalli, G. (2021) · Nature Reviews Molecular Cell Biology · doi:10.1038/s41580-021-00362-w · Cited by 413
Self-citationZhang, Y., Li, T., Preißl, S., Amaral, M. L., Grinstein, J. D., Farah, E. N., Destici, E., Qiu, Y., Hu, R., Lee, A. Y., et al. (2019) · Nature Genetics · doi:10.1038/s41588-019-0479-7 · Cited by 384
Live-cell imaging reveals enhancer-dependent Sox2 transcription in the absence of enhancer proximity
Alexander, J. M., Guan, J., Li, B., Maliskova, L., Song, M., Shen, Y., Huang, B., Lomvardas, S., & Weiner, O. D. (2019) · eLife · doi:10.7554/elife.41769 · Cited by 346
Epigenetic silencing by SETDB1 suppresses tumour intrinsic immunogenicity
Griffin, G. K., Wu, J., Iracheta-Vellve, A., Patti, J. C., Hsu, J., Davis, T., Dele-Oni, D., Du, P. P., Halawi, A. G., Ishizuka, J. J., et al. (2021) · Nature · doi:10.1038/s41586-021-03520-4 · Cited by 370
On the existence and functionality of topologically associating domains
Beagan, J. A., & Phillips‐Cremins, J. E. (2020) · Nature Genetics · doi:10.1038/s41588-019-0561-1 · Cited by 381
Organization of Chromosomal DNA by SMC Complexes
Yatskevich, S., Rhodes, J., & Nasmyth, K. (2019) · Annual Review of Genetics · doi:10.1146/annurev-genet-112618-043633 · Cited by 349
Simultaneous profiling of 3D genome structure and DNA methylation in single human cells
Lee, D.-S., Luo, C., Zhou, J., Chandran, S., Rivkin, A., Bartlett, A., Nery, J. R., Fitzpatrick, C., O’Connor, C., Dixon, J. R., et al. (2019) · Nature Methods · doi:10.1038/s41592-019-0547-z · Cited by 340
MCM2 promotes symmetric inheritance of modified histones during DNA replication
Petryk, N., Dalby, M., Wenger, A., Stromme, C. B., Strandsby, A., Andersson, R., & Groth, A. (2018) · Science · doi:10.1126/science.aau0294 · Cited by 294
LHX2- and LDB1-mediated trans interactions regulate olfactory receptor choice
Monahan, K. D., Horta, A., & Lomvardas, S. (2019) · Nature · doi:10.1038/s41586-018-0845-0 · Cited by 318
“Pooled data from publicly available data sets is shown for ES cells 72 , B cells 15 , and cortical neurons 73 . f , same as e, but showing the median fraction of HiC contacts made to trans OR clusters for OR cluster regions divided into 50 Kb bins. g , Machine learning Hidden Markov Model (HMM)…”
Cai, Y., Zhang, Y., Loh, Y. P., Tng, J. Q., Lim, M. C., Cao, Z., Raju, A., Lieberman Aiden, E., Li, S., Manikandan, L., et al. (2021) · Nature Communications · doi:10.1038/s41467-021-20940-y · Cited by 321
The relationship between genome structure and function
Oudelaar, A. M., & Higgs, D. R. (2021) · Nature Reviews Genetics · doi:10.1038/s41576-020-00303-x · Cited by 304
The epigenetic basis of cellular heterogeneity
Carter, B. C., & Zhao, K. (2020) · Nature Reviews Genetics · doi:10.1038/s41576-020-00300-0 · Cited by 324
Promoter-proximal CTCF binding promotes distal enhancer-dependent gene activation
Kubo, N., Ishii, H., Xiong, X., Bianco, S., Meitinger, F., Hu, R., Hocker, J. D., Conte, M., Gorkin, D., Yu, M., et al. (2021) · Nature Structural & Molecular Biology · doi:10.1038/s41594-020-00539-5 · Cited by 289
Emerging Evidence of Chromosome Folding by Loop ExtrusionPreprint
Fudenberg, G., Abdennur, N. A., Imakaev, M., Goloborodko, A. A., & Mirny, L. A. (2017) · Cold Spring Harbor Symposia on Quantitative Biology · doi:10.1101/sqb.2017.82.034710 · Cited by 298
Control of DNA replication timing in the 3D genome
Marchal, C., Sima, J., & Gilbert, D. M. (2019) · Nature Reviews Molecular Cell Biology · doi:10.1038/s41580-019-0162-y · Cited by 308
Predicting 3D genome folding from DNA sequence with Akita
Fudenberg, G., Kelley, D. R., & Pollard, K. S. (2020) · Nature Methods · doi:10.1038/s41592-020-0958-x · Cited by 300
TADs are 3D structural units of higher-order chromosome organization in Drosophila
Szabo, Q., Jost, D., Chang, J., Cattoni, D. I., Papadopoulos, G. L., Bonev, B., Sexton, T., Gurgo, J., Jacquier, C., Nöllmann, M., et al. (2018) · Science Advances · doi:10.1126/sciadv.aar8082 · Cited by 285
“Finally, the fact that TAD identity and architecture depend on cell fate regulation (15, 37) calls for further analysis in different cell types and species to generalize these findings and”
BackgroundSelf-citationDistinct Classes of Chromatin Loops Revealed by Deletion of an RNA-Binding Region in CTCF
Hansen, A. S., Hsieh, T.-H. S., Cattoglio, C., Pustova, I., Saldaña-Meyer, R., Reinberg, D., Darzacq, X., & Tjian, R. (2019) · Molecular Cell · doi:10.1016/j.molcel.2019.07.039 · Cited by 279
Wolff, J., Bhardwaj, V., Nothjunge, S., Richard, G., Renschler, G., Gilsbach, R., Manke, T., Backofen, R., Ramírez, F., & Grüning, B. (2018) · Nucleic Acids Res. · doi:10.1093/nar/gky504 · Cited by 248
“Furthermore, HiC has allowed identification of chromatin loops (4,5), as well as enhancer–promoter interactions (6,7) and their influence on gene expression (8,9).”
BackgroundMechanisms and Functions of Chromosome Compartmentalization
Hildebrand, E. M., & Dekker, J. (2020) · Trends in Biochemical Sciences · doi:10.1016/j.tibs.2020.01.002 · Cited by 284
“In addition, cells derived from different tissues have been shown to have very different compartment strengths, providing a natural set of conditions to analyze the quantitative effects of compartment formation on gene activity [46, 66].”
BackgroundRoayaei Ardakany, A., Gezer, H. T., Lonardi, S., & Ay, F. (2020) · Genome Biology · doi:10.1186/s13059-020-02167-0 · Cited by 250
Synergy between Variant PRC1 Complexes Defines Polycomb-Mediated Gene Repression
Fursova, N. A., Blackledge, N. P., Nakayama, M., Ito, S., Koseki, Y., Farcas, A. M., King, H. W., Koseki, H., & Klose, R. J. (2019) · Molecular Cell · doi:10.1016/j.molcel.2019.03.024 · Cited by 267
“This raises an interesting question: why are canonical PRC1 complexes recruited to sites where variant PRC1 complexes predominate in gene repression? One explanation may be that canonical PRC1 complexes canmediate long-range interactions between Polycomb repressed genes (Boettiger et al., 2016; Bonev et al., 2017; Eag…”
BackgroundRegion Capture Micro-C reveals coalescence of enhancers and promoters into nested microcompartments
Goel, V. Y., Huseyin, M. K., & Hansen, A. S. (2023) · Nature Genetics · doi:10.1038/s41588-023-01391-1 · Cited by 271
Kruse, K., Hug, C. B., & Vaquerizas, J. M. (2020) · Genome biology · doi:10.1186/s13059-020-02215-9 · Cited by 242
The role of transcription in shaping the spatial organization of the genome
van Steensel, B., & Furlong, E. E. M. (2019) · Nature Reviews Molecular Cell Biology · doi:10.1038/s41580-019-0114-6 · Cited by 247
X-Chromosome Inactivation: A Crossroads Between Chromosome Architecture and Gene Regulation
Galupa, R., & Heard, É. (2018) · Annual Review of Genetics · doi:10.1146/annurev-genet-120116-024611 · Cited by 257
Transcription shapes 3D chromatin organization by interacting with loop extrusion
Banigan, E. J., Tang, W., van den Berg, A. A., Stocsits, R. R., Wutz, G., Brandão, H. B., Busslinger, G. A., Peters, J., & Mirny, L. A. (2023) · Proceedings of the National Academy of Sciences · doi:10.1073/pnas.2210480120 · Cited by 238
“3A and (20, 74)) or between sites of convergent transcription in both yeast (32, 75) and mammalian cells (Fig.”
BackgroundTwo major mechanisms of chromosome organization
Mirny, L. A., Imakaev, M., & Abdennur, N. A. (2019) · Current Opinion in Cell Biology · doi:10.1016/j.ceb.2019.05.001 · Cited by 232
Comparison of computational methods for the identification of topologically associating domains
Zufferey, M., Tavernari, D., Oricchio, E., & Ciriello, G. (2018) · Genome biology · doi:10.1186/s13059-018-1596-9 · Cited by 234
Evaluating Enhancer Function and Transcription
Field, A. R., & Adelman, K. (2020) · Annual Review of Biochemistry · doi:10.1146/annurev-biochem-011420-095916 · Cited by 227
Three-dimensional chromatin landscapes in T cell acute lymphoblastic leukemia
Kloetgen, A., Thandapani, P., Ntziachristos, P., Ghebrechristos, Y. E., Nomikou, S., Lazaris, C., Chen, X., Hu, H., Bakogianni, S., Wang, J., et al. (2020) · Nature Genetics · doi:10.1038/s41588-020-0602-9 · Cited by 219
“…expression, recent studies tracking 3D chromatin modifications during developmental processes such as embryonic stem cell differentiation and neural development identified significant changes in interactions within (sub-)TADs that correlated with transcriptional levels and epigenetic states 53,54 .”
DeepC: predicting 3D genome folding using megabase-scale transfer learning
Schweßinger, R., Gosden, M. E., Downes, D. J., Brown, R. C., Oudelaar, A. M., Telenius, J. M., Teh, Y. W., Lunter, G. A., & Hughes, J. R. (2020) · Nature Methods · doi:10.1038/s41592-020-0960-3 · Cited by 223
“Four replicates of mouse ES cell data 21 were retrieved as raw fastqs from (GSE96107).”
BackgroundMethodChromatin plasticity: A versatile landscape that underlies cell fate and identity
Yadav, T., Quivy, J., & Almouzni, G. (2018) · Science · doi:10.1126/science.aat8950 · Cited by 228
Coolpup.py: versatile pile-up analysis of Hi-C data
Flyamer, I. M., Illingworth, R. S., & Bickmore, W. A. (2020) · Bioinformatics · doi:10.1093/bioinformatics/btaa073 · Cited by 220
“py to publicly available Hi-C data (Bonev et al., 2017; Nora et al., 2017) using distiller (https://github.com/mirnylab/distiller-nf) to obtain .cool files filtered with a map quality (mapq) of 30. We used these data at 5 kb resolution. In addition .cool files for single-nucleus Hi-C (snHi-C), together with coordinate…”
MethodInfluentialNeuron-specific signatures in the chromosomal connectome associated with schizophrenia risk
Rajarajan, P., Borrman, T., Liao, W., Schrode, N., Flaherty, E., Casiño, C., Powell, S., Yashaswini, C., LaMarca, E. A., Kassim, B., et al. (2018) · Science · doi:10.1126/science.aat4311 · Cited by 219
“In addition, we reanalyzed Hi-C datasets generated from a mouse model of neural differentiation, consisting of mouse embryonic stem cell (mESCs), mESCderived NPCs (mNPC), and cortical neurons (mCN) differentiated from the mNPCs via inhibition of the Sonic Hedgehog (SHH) pathway (21).”
BackgroundInfluentialThe Bivalent Genome: Characterization, Structure, and Regulation
Blanco, E., González-Ramírez, M., Alcaine-Colet, A., Aranda, S., & Croce, L. D. (2019) · Trends in Genetics · doi:10.1016/j.tig.2019.11.004 · Cited by 226
Gatchalian, J., Malik, S., Ho, J., Lee, D.-S., Kelso, T. W. R., Shokhirev, M. N., Dixon, J. R., & Hargreaves, D. C. (2018) · Nature Communications · doi:10.1038/s41467-018-07528-9 · Cited by 216
Molecular basis of CTCF binding polarity in genome folding
Nora, E. P., Caccianini, L., Fudenberg, G., So, K., Kameswaran, V., Nagle, A., Uebersohn, A., Hajj, B., Saux, A. L., Coulon, A., et al. (2020) · Nature Communications · doi:10.1038/s41467-020-19283-x · Cited by 206
Cell-type specialization is encoded by specific chromatin topologies
Winick‐Ng, W., Kukalev, A., Harabula, I., Zea-Redondo, L., Szabó, D., Meijer, M., Serebreni, L., Zhang, Y., Bianco, S., Chiariello, A. M., et al. (2021) · Nature · doi:10.1038/s41586-021-04081-2 · Cited by 214
“We have shown that Hi-C derived loops from mESCs and cortical PGNs (Bonev et al. 2017) are also strong contacts in GAM data from mESC and hippocampal PGNs (see below Rev.1 point 16).”
BackgroundMethodResultInfluentialMcCord, R. P., Kaplan, N., & Giorgetti, L. (2020) · Molecular Cell · doi:10.1016/j.molcel.2019.12.021 · Cited by 220
“Above-background interactions are certainly significant with respect to a null model where only random collisions occur (Figure 6B), and very often correlate with CTCF loops, interactions between active genes, or interactions between genes and their potential regulatory sequences (Bonev et al. 2017; Hsieh et al. 2019;…”
BackgroundInfluentialRobust single-cell Hi-C clustering by convolution- and random-walk-based imputation
Zhou, J., Ma, J., Chen, Y., Cheng, C., Bao, B., Peng, J., Sejnowski, T. J., Dixon, J. R., & Ecker, J. R. (2019) · Proceedings of the National Academy of Sciences · doi:10.1073/pnas.1901423116 · Cited by 180
“(30) examined three mouse cell types [embryonic stem cells (ESCs), neural progenitor cells (NPCs), and cortical neurons (CNs)].”
BackgroundInfluentialMechanisms of Interplay between Transcription Factors and the 3D Genome
Kim, S., & Shendure, J. (2019) · Molecular Cell · doi:10.1016/j.molcel.2019.08.010 · Cited by 218
“Toward assessing whether this is a universal phenomenon, recent technical advances have enabled increasingly comprehensive and high-resolution views of chromosome conformation (Bonev et al., 2017; Lieberman-Aiden et al., 2009; Rao et al., 2017).”
BackgroundMcArthur, E., & Capra, J. A. (2021) · The American Journal of Human Genetics · doi:10.1016/j.ajhg.2021.01.001 · Cited by 207
Miron, E., Oldenkamp, R., Brown, J. M., Pinto, D. M. S., Xu, C. S., Faria, A. R., Shaban, H. A., Rhodes, J. D. P., Innocent, C., de Ornellas, S., et al. (2020) · Science Advances · doi:10.1126/sciadv.aba8811 · Cited by 200
“(A) Hi-C heatmap from mouse ESCs (67) showing the interaction frequency around the 700kb TAD probe (probe H, red bars), (19) used in this study for RASER-FISH experiments.”
Tan, L., Ma, W., Wu, H., Zheng, Y., Xing, D., Chen, R., Li, X., Daley, N., Deisseroth, K. A., & Xie, X. S. (2021) · Cell · doi:10.1016/j.cell.2020.12.032 · Cited by 193
Regulatory Landscaping: How Enhancer-Promoter Communication Is Sculpted in 3D
Robson, M. I., Ringel, A. R., & Mundlos, S. (2019) · Molecular Cell · doi:10.1016/j.molcel.2019.05.032 · Cited by 203
Regulation of single-cell genome organization into TADs and chromatin nanodomains
Szabo, Q., Donjon, A., Jerković, I., Papadopoulos, G. L., Cheutin, T., Bonev, B., Nora, E. P., Bruneau, B. G., Bantignies, F., & Cavalli, G. (2020) · Nature Genetics · doi:10.1038/s41588-020-00716-8 · Cited by 194
“Publicly available ESC and NPC ChIP-seq data for H3K4me1, H3K4me3, H3K27ac and H3K27me3 marks, ATAC-seq and RNA-seq data used in this study are listed in Supplementary Table 2 27,49,50 .”
InfluentialSelf-citationHistone H3.3G34-Mutant Interneuron Progenitors Co-opt PDGFRA for Gliomagenesis
Chen, C. C. L., Deshmukh, S., Jessa, S., Hadjadj, D., Lisi, V., Andrade, A. F., Faury, D., Jawhar, W., Dali, R., Suzuki, H., et al. (2020) · Cell · doi:10.1016/j.cell.2020.11.012 · Cited by 199
“Publicly available Hi-C datasets on murine embryonic stem cells were downloaded from GEO (GSE96107)(Bonev et al., 2017), and processed as described above.”
MethodDynamic 3D chromatin architecture contributes to enhancer specificity and limb morphogenesis
Kragesteen, B. K., Spielmann, M., Paliou, C., Heinrich, V., Schöpflin, R., Esposito, A., Annunziatella, C., Bianco, S., Chiariello, A. M., Jerković, I., et al. (2018) · Nature Genetics · doi:10.1038/s41588-018-0221-x · Cited by 190
Rodríguez-Carballo, E., Lopez‐Delisle, L., Zhan, Y., Fabre, P. J., Beccari, L. L., El-Idrissi, I., Huynh, T. H. N., Özadam, H., Dekker, J., & Duboule, D. (2017) · Genes & Development · doi:10.1101/gad.307769.117 · Cited by 180
“Active versus inactive TADs and loop extrusion Upon TAD functional activation, specific changes were observed in the interaction profiles, reflecting several states of configurations in chromatin architecture as reported earlier (Li et al. 2012; Sanyal et al. 2012; Berlivet et al. 2013; Rao et al. 2014; Dixon et al. 2…”
MethodKey role for CTCF in establishing chromatin structure in human embryos
Chen, X., Ke, Y., Wu, K., Zhao, H., Sun, Y., Gao, L., Liu, Z., Zhang, J., Tao, W., Hou, Z., et al. (2019) · Nature · doi:10.1038/s41586-019-1812-0 · Cited by 190
Cohesin Disrupts Polycomb-Dependent Chromosome Interactions in Embryonic Stem Cells
Rhodes, J. D. P., Feldmann, A., Hernández-Rodríguez, B., Díaz, N., Brown, J. M., Fursova, N. A., Blackledge, N. P., Prathapan, P., Dobrinic, P., Huseyin, M. K., et al. (2020) · Cell Reports · doi:10.1016/j.celrep.2019.12.057 · Cited by 187
“Polycomb Mediates Interactions that Persist in the Absence of Cohesin In ESCs, it is known that polycomb chromatin domains can associate with each other, even over very long distances (Bonev et al., 2017; Denholtz et al., 2013; Joshi et al., 2015; Schoenfelder et al., 2015).”
BackgroundIdentifying cis Elements for Spatiotemporal Control of Mammalian DNA Replication
Sima, J., Chakraborty, A., Dileep, V., Michalski, M., Klein, K. N., Holcomb, N. P., Turner, J. L., Paulsen, M. T., Rivera‐Mulia, J. C., Trevilla‐García, C., et al. (2018) · Cell · doi:10.1016/j.cell.2018.11.036 · Cited by 188
“The Dppa2/4 domain corresponds to a TAD whose boundaries contain CTCF and cohesin binding sites (Nora et al., 2017; Yue et al., 2014; Dowen et al., 2014; Mumbach et al., 2016) and also align with compartment boundaries (Bonev et al., 2017).”
InfluentialGiammartino, D. C. D., Kloetgen, A., Polyzos, A., Liu, Y., Kim, D., Murphy, D., Abuhashem, A., Cavaliere, P., Aronson, B. E., Shah, V., et al. (2019) · Nature Cell Biology · doi:10.1038/s41556-019-0390-6 · Cited by 179
Preformed chromatin topology assists transcriptional robustness of Shh during limb development
Paliou, C., Guckelberger, P., Schöpflin, R., Heinrich, V., Esposito, A., Chiariello, A. M., Bianco, S., Annunziatella, C., Helmuth, J., Haas, S., et al. (2019) · Proceedings of the National Academy of Sciences · doi:10.1073/pnas.1900672116 · Cited by 163
“Transcriptionally active gene promoters have been shown to interact over a large distance independently of CTCF and thereby suggested to be drivers of genome architecture (5).”
BackgroundDistinct roles of cohesin-SA1 and cohesin-SA2 in 3D chromosome organization
Kojic, A., Cuadrado, A., Koninck, M. D., Giménez-Llorente, D., Rodríguez-Corsino, M., Goméz-López, G., Dily, F. L., Martí-Renom, M. A., & Losada, A. (2018) · Nature Structural & Molecular Biology · doi:10.1038/s41594-018-0070-4 · Cited by 183
Thiecke, M. J., Wutz, G., Muhar, M., Tang, W., Bevan, S., Malysheva, V., Stocsits, R., Neumann, T., Zuber, J., Fraser, P., et al. (2020) · Cell Reports · doi:10.1016/j.celrep.2020.107929 · Cited by 177
Linking genome structures to functions by simultaneous single-cell Hi-C and RNA-seq
Liu, Z., Chen, Y., Xia, Q., Liu, M., Xu, H., Chi, Y., Deng, Y., & Xing, D. (2023) · Science · doi:10.1126/science.adg3797 · Cited by 174
4D Genome Rewiring during Oncogene-Induced and Replicative Senescence
Sati, S., Bonev, B., Szabo, Q., Jost, D., Bensadoun, P., Serra, F., Loubiere, V., Papadopoulos, G. L., Rivera-Mulia, J.-C., Fritsch, L., et al. (2020) · Molecular Cell · doi:10.1016/j.molcel.2020.03.007 · Cited by 170
“Identification of A and B Compartments TADs were assigned to either the A or the B compartment as described (Bonev et al., 2017; Nagano et al., 2017).”
BackgroundMethodInfluentialSelf-citationReprogramming of Meiotic Chromatin Architecture during Spermatogenesis
Wang, Y., Wang, H., Zhang, Y., Du, Z., Si, W., Fan, S., Qin, D., Wang, M., Duan, Y., Li, L., et al. (2019) · Molecular Cell · doi:10.1016/j.molcel.2018.11.019 · Cited by 172
Bertero, A., Fields, P., Ramani, V., Bonora, G., Yardımcı, G. G., Reinecke, H., Pabon, L., Noble, W. S., Shendure, J., & Murry, C. E. (2019) · Nature Communications · doi:10.1038/s41467-019-09483-5 · Cited by 168
WAPL maintains a cohesin loading cycle to preserve cell-type-specific distal gene regulation
Liu, N. Q., Maresca, M., van den Brand, T., Braccioli, L., Schijns, M. M. G. A., Teunissen, H., Bruneau, B. G., Nora, E. P., & de Wit, E. (2021) · Nature Genetics · doi:10.1038/s41588-020-00744-4 · Cited by 162
A supervised learning framework for chromatin loop detection in genome-wide contact maps
Salameh, T. J., Wang, X., Song, F., Zhang, B., Wright, S. M., Khunsriraksakul, C., Ruan, Y., & Yue, F. (2020) · Nature Communications · doi:10.1038/s41467-020-17239-9 · Cited by 165
Cohesin is required for long-range enhancer action at the Shh locus
Kane, L., Williamson, I., Flyamer, I. M., Kumar, Y., Hill, R. E., Lettice, L. A., & Bickmore, W. A. (2022) · Nature Structural & Molecular Biology · doi:10.1038/s41594-022-00821-8 · Cited by 153
Bonetti, A., Agostini, F., Suzuki, A. M., Hashimoto, K., Pascarella, G., Gimenez, J., Roos, L., Nash, A. J., Ghilotti, M., Cameron, C. J. F., et al. (2020) · Nature Communications · doi:10.1038/s41467-020-14337-6 · Cited by 168
Rinzema, N. J., Sofiadis, K., Tjalsma, S. J. D., Verstegen, M. J. A. M., Oz, Y., Valdes-Quezada, C., Felder, A.-K., Filipovska, T., van der Elst, S., de Andrade dos Ramos, Z., et al. (2022) · Nature Structural & Molecular Biology · doi:10.1038/s41594-022-00787-7 · Cited by 166
Polycomb Group Proteins Regulate Chromatin Architecture in Mouse Oocytes and Early Embryos
Du, Z., Zheng, H., Kawamura, Y., Zhang, K., Gassler, J., Powell, S. T., Xu, Q., Lin, Z., Xu, K., Zhou, Q., et al. (2019) · Molecular Cell · doi:10.1016/j.molcel.2019.11.011 · Cited by 163
Topologically associating domain boundaries are required for normal genome function
Rajderkar, S., Barozzi, I., Zhu, Y., Hu, R., Zhang, Y., Li, B., Alcaina‐Caro, A., Fukuda-Yuzawa, Y., Kelman, G., Akeza, A., et al. (2023) · Communications Biology · doi:10.1038/s42003-023-04819-w · Cited by 172
“Both CTCF-mediated mechanisms and transcription can affect the formation and function of TADs, but neither seems to be individually suf fi cient nor universally required 7,11,23,24 .”
Kaaij, L. J. T., Mohn, F., van der Weide, R. H., de Wit, E., & Bühler, M. (2019) · Cell · doi:10.1016/j.cell.2019.08.007 · Cited by 161
Zhao, P. A., Sasaki, T., & Gilbert, D. M. (2020) · Genome biology · doi:10.1186/s13059-020-01983-8 · Cited by 168
Immediate and deferred epigenomic signatures of in vivo neuronal activation in mouse hippocampus
Fernandez-Albert, J., Lipinski, M., Lopez-Cascales, M. T., Rowley, M. J., Martin-Gonzalez, A. M., del Blanco, B., Corces, V. G., & Barco, A. (2019) · Nature Neuroscience · doi:10.1038/s41593-019-0476-2 · Cited by 166
Hi-C analyses with GENOVA: a case study with cohesin variants
van der Weide, R. H., van den Brand, T., Haarhuis, J. H. I., Teunissen, H., Rowland, B. D., & de Wit, E. (2021) · NAR Genomics and Bioinformatics · doi:10.1093/nargab/lqab040 · Cited by 161
“To visualise the changes in the compartment strength we generated saddle-plots, in which the amount of self-interaction of A- and B-compartments is quantified (34,50).”
MethodMarco, A., Meharena, H. S., Dileep, V., Raju, R. M., Davila-Velderrain, J., Zhang, A. L., Adaikkan, C., Young, J. Z., Gao, F., Kellis, M., et al. (2020) · Nature Neuroscience · doi:10.1038/s41593-020-00717-0 · Cited by 159
Independence of chromatin conformation and gene regulation during Drosophila dorsoventral patterning
Ing-Simmons, E., Vaid, R., Bing, X. Y., Levine, M., Mannervik, M., & Vaquerizas, J. M. (2021) · Nature Genetics · doi:10.1038/s41588-021-00799-x · Cited by 159
Phase separation of OCT4 controls TAD reorganization to promote cell fate transitions
Wang, J., Yu, H., Ma, Q., Zeng, P., Wu, D., Hou, Y., Liu, X., Jia, L., Sun, J., Chen, Y., et al. (2021) · Cell stem cell · doi:10.1016/j.stem.2021.04.023 · Cited by 164
The spatial organization of transcriptional control
Hafner, A., & Boettiger, A. N. (2022) · Nature Reviews Genetics · doi:10.1038/s41576-022-00526-0 · Cited by 158
Single-cell DNA methylation and 3D genome architecture in the human brain
Tian, W., Zhou, J., Bartlett, A., Zeng, Q., Liu, H., Castanon, R. G., Kenworthy, M., Altshul, J., Valadon, C., Aldridge, A., et al. (2023) · Science · doi:10.1126/science.adf5357 · Cited by 154
Mechanisms of Polycomb group protein function in cancer
Parreno, V., Martinez, A., & Cavalli, G. (2022) · Cell Research · doi:10.1038/s41422-021-00606-6 · Cited by 158
Self-citationGreenwald, W. W. Y., Li, H., Benaglio, P., Jakubosky, D. A., Matsui, H., Schmitt, A. D., Selvaraj, S., D’Antonio, M., D’Antonio‐Chronowska, A., Smith, E. N., et al. (2019) · Nature Communications · doi:10.1038/s41467-019-08940-5 · Cited by 144
Paulsen, J., Ali, T. M. L., Nekrasov, M., Delbarre, E., Baudement, M.-O., Kurscheid, S., Tremethick, D. J., & Collas, P. (2019) · Nature Genetics · doi:10.1038/s41588-019-0392-0 · Cited by 148
Chromosome organization by one-sided and two-sided loop extrusion
Banigan, E. J., van den Berg, A. A., Brandão, H. B., Marko, J. F., & Mirny, L. A. (2020) · eLife · doi:10.7554/elife.53558 · Cited by 146
“(a) A TAD in Hi-C of cortical neurons (Bonev et al., 2017), visualized by HiGlass (Kerpedjiev et al., 2018) at a resolution of 8 kb.”
Method
Metadata
- Authors
- Bonev, B., Mendelson Cohen, N., Szabo, Q., Fritsch, L., Papadopoulos, G. L., Lubling, Y., Xu, X., Lv, X., Hugnot, J.-P., Tanay, A., & Cavalli, G.
- Affiliations
- Centre National de la Recherche Scientifique (FR)
- Weizmann Institute of Science (IL)
- BGI Group (China) (CN)
- Inserm (FR)
- Corresponding author
- Bonev, Boyan
- Cavalli, Giacomo
- ORCID
- Venue
- Cell
- Publisher
- Elsevier BV
- Published
- 2017-10
- Volume
- 171
- Issue
- 3
- Pages
- 557-572.e24
- ISSN
- 0092-8674 (ISSN-L)
- PMC
- PMC5651218
- OpenAlex
- W2765567136
- Semantic Scholar
- 0728437b5553338297a6cc1bad9f15766a1e1c43
- Cited by
- 1,338
- References
- 53
- Citations by year
- 2026: 110 · 2025: 129 · 2024: 143 · 2023: 139 · 2022: 166 · 2021: 181 · 2020: 190 · 2019: 170 · 2018: 100 · 2017: 6
- FWCI
- 52.01
- Type
- journal article
- Language
- en
- Open access
- hybrid
- doi.org
- Locations
- Cell (publishedVersion, cc-by)
- PubMed Central (publishedVersion, cc-by)
- PubMed (publishedVersion)
- HAL (submittedVersion, cc-by)
- Funders
- European Research Council (232947)
- Israeli Science Foundation
- CNRS
- FP7 European Network of Excellence EpiGeneSys (676556)
- Agence Nationale de la Recherche (ANR-15-CE12-006-01)
- Fondation pour la Recherche Médicale (144186)
- INSERM and ITMO Cancer (PLBIO16-22)
- Laboratory of Excellence (ANR-10-LABX-12-01)
- Topics
- Life Sciences › Biochemistry, Genetics and Molecular Biology › Molecular Biology › Genomics and Chromatin Dynamics
- Life Sciences › Biochemistry, Genetics and Molecular Biology › Molecular Biology › Chromatin Remodeling and Cancer
- Life Sciences › Biochemistry, Genetics and Molecular Biology › Genetics › Chromosomal and Genetic Variations
- Keywords
- 3D genome organization, chromatin conformation, neuronal differentiation, topologically associating domains, long-range chromatin interactions, chromatin insulation, enhancer-promoter interactions
- MeSH terms
- CCCTC-Binding Factor, Animals, Chromatin, Enhancer Elements, Genetic, Exons, Promoter Regions, Genetic, Repressor Proteins, Transcription Factors, Gene Expression, Genome, Mice, Gene Regulatory Networks, Embryonic Stem Cells, Neurogenesis
About these checks
Registry, retraction, Cites and statistics results are computed, not judged, with one exception: a printed reference that no index lists is read once by a model before it counts as a citation error. Claims are extracted by a model and kept only when their quote appears verbatim in the text; each cited source is then checked, with a model’s help, for whether it says what the claim relies on. Those verdicts can be wrong — read the claim’s quote and the cited source before relying on one.
A language model drew the claims from the paper on 2026-10-10, under version 3 of the claim definition (model deepseek-v4.1-flash, prompt extract-v3).
A second model labelled each claim on 2026-10-10 (model jev-1.13-20260917, definition revision gold-guideline-v0.2).
Statistics and arithmetic are recomputed, not judged.
Confidence bands are shown only for fields calibrated on our annotated test set. None is calibrated yet, so no band is shown.
What counts as a claim ›How we measure confidence ›How we check this ›
Are you an author, or do you see a problem with this page? Request a review
