The DOI matches its Crossref record; 68 of the 70 references it cites were found in a registry or an index; 14 of the 16 sources its claims cite were checked for support.
L1 drives IFN in senescent cells and promotes age-associated inflammation
Open accessAbstract
Retrotransposable elements are deleterious at many levels, and the failure of host surveillance systems for these elements can thus have negative consequences. However, the contribution of retrotransposon activity to ageing and age-associated diseases is not known. Here we show that during cellular senescence, L1 (also known as LINE-1) retrotransposable elements become transcriptionally derepressed and activate a type-I interferon (IFN-I) response. The IFN-I response is a phenotype of late senescence and contributes to the maintenance of the senescence-associated secretory phenotype. The IFN-I response is triggered by cytoplasmic L1 cDNA, and is antagonized by inhibitors of the L1 reverse transcriptase. Treatment of aged mice with the nucleoside reverse transcriptase inhibitor lamivudine downregulated IFN-I activation and age-associated inflammation (inflammaging) in several tissues. We propose that the activation of retrotransposons is an important component of sterile inflammation that is a hallmark of ageing, and that L1 reverse transcriptase is a relevant target for the treatment of age-associated disorders.
Overview
Integrity signals
Registry
Cites
Statistics
Verification
Claims the paper makes
27 Own result · 23 Own method · 9 Own interpretation · 8 Supported · 2 Partly supported · 2 No full text of the sources · 1 No basis given · accuracy not yet measured
Every source the paper cites for this claim was checked and supports it.
In the paper
“L1 elements can stimulate an IFN-I response9.”
§ LINE-1 derepression in senescent cells triggers interferon and inflammaging > Activation of L1 and interferon in cellular senescence
What the sources say
- Supportedcites [9] Volkman, H. E. & Stetson, D. B. The enemy within: endogenous retroelements and autoimmune disease. Nat. Immunol. 15, 415–422 (2014). source
The section ‘The intersection of retroelement biology and innate immunity’ (page unavailable) reports that retroelement-derived DNA accumulates in Trex1-deficient cells, whose autoimmune response requires type I interferons; it also proposes innate sensing of those cDNAs as the mechanism. The section ‘The life and times of endogenous retroelements’ identifies L1 as an endogenous retroelement, supporting the qualified claim that L1 elements can stimulate an IFN-I response. (LLM, conf=0.86)
plaindirect- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: passes — The paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
- Supported
Every source the paper cites for this claim was checked and supports it.
In the paper
“pWA355 contains a functional, active L1RP element, whereas pWA366 contains L1RP(JM111), a mutated element carrying two missense mutations in ORF1 that is unable to retrotranspose.”
§ LINE-1 derepression in senescent cells triggers interferon and inflammaging > METHODS > Retrotransposition reporters.
What the sources say
- Supportedcites Xie et al. (2011)52 source
The Materials and Methods (Plasmids) explicitly calls the L1RP in pWA355 functional. The Results (A two-vector dual-luciferase assay for L1 retrotransposition) report a retrotransposition signal for pWA355 more than 100-fold above background, confirming that it is active. (LLM, conf=0.94)
plain- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: passes — The paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
- Supported
A result the paper reports from its own data — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“The IFN-I response is triggered by cytoplasmic L1 cDNA, and is antagonized by nucleoside reverse transcriptase inhibitors (NRTIs) that inhibit the L1 reverse transcriptase (RT).”
- Also stated in: § Consequences of L1 activation · plain
“L1 knockdown with shRNA or treatment of cells with 3TC significantly reduced interferon levels, as well as reducing the IFN-I response more broadly in both late senescent and 3X cells (Fig. 3b, Extended Data Fig. 7a).”
§ LINE-1 derepression in senescent cells triggers interferon and inflammaging > Abstract
plaindirect- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: passes — The paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
- Also stated in: § Consequences of L1 activation · plain
A result the paper reports from its own data — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“While some of these effects were statistically significant, they were dwarfed by a triple intervention of RB1 and TREX1 104knockdowns combined with FOXA1 overexpression (3X), which resulted in a massive induction of L1 and IFN-I expression (Fig. 2f, Extended Data Fig. 4g-i and 5c).”
§ LINE-1 derepression in senescent cells triggers interferon and inflammaging > Mechanisms of L1 activation
plaindirect- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: passes — The paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
A result the paper reports from its own data — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“Treatment of aged mice with the NRTI lamivudine downregulated IFN-I activation and age-associated inflammation in several tissues.”
- Also stated in: § Activation of L1 in human and mouse tissues · plain
“We treated old animals (26 months) for two-weeks with 3TC (administered in water at human therapeutic doses) and found a broad and significant downregulation the IFN-I response and alleviation of the SASP pro-inflammatory state (Fig. 4c, for the full dataset see Extended Data Fig. 9 and Supplementary Table 7).”
§ LINE-1 derepression in senescent cells triggers interferon and inflammaging > Abstract
plaindirect- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: passes — The paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
- Also stated in: § Activation of L1 in human and mouse tissues · plain
A result the paper reports from its own data — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“Note that the majority of changes in SASP genes occur early, whereas a large component of IFN-I changes is specific for late senescence.”
§ LINE-1 derepression in senescent cells triggers interferon and inflammaging > Extended Data
plaincorrelational- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: unclear — It is unclear whether the paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
A result the paper reports from its own data — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“Note the considerable evolution the transcriptome in late senescence, exemplified by large changes (especially upregulated) in differentially expressed genes as well as pathways.”
§ LINE-1 derepression in senescent cells triggers interferon and inflammaging > Extended Data
plaincorrelational- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: unclear — It is unclear whether the paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
A result the paper reports from its own data — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“Of the 96 total clones examined 37 mapped to L1.”
§ LINE-1 derepression in senescent cells triggers interferon and inflammaging > Extended Data
plain- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: passes — The paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
A result the paper reports from its own data — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“In (a) loss of Lamin B1 (senescence marker) was colocalized with IL-6 (SASP marker).”
§ LINE-1 derepression in senescent cells triggers interferon and inflammaging > Extended Data
plaincorrelationaln = 4- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: passes — The paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
A result the paper reports from its own data — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“Confirmation of full length L1 mRNA expression in all forms of senescence using RT-qPCR with primers for amplicons A and F on poly(A)-purified RNA.”
§ LINE-1 derepression in senescent cells triggers interferon and inflammaging > Extended Data
boostedcorrelationaln = 3- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: passes — The paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
- Probably not a substantial claim. 36
- It may state two separate claims as one. 19
Every source the paper cites for this claim was checked and supports it.
In the paper
“Some NRTIs developed against HIV have been found to also inhibit L1 RT activity15.”
§ LINE-1 derepression in senescent cells triggers interferon and inflammaging > Consequences of L1 activation
What the sources say
- Supportedcites [15] Dai, L., Huang, Q. & Boeke, J. D. Effect of reverse transcriptase inhibitors on LINE-1 and Ty1 reverse transcriptase activities and on LINE-1 retrotransposition. BMC Biochem. 12, 18 (2011). source
The Results section ('Effect of RT inhibitors on activities of different reverse transcriptases') reports that all four tested triphosphate NRTIs markedly inhibited L1 RT activity at nanomolar concentrations. This directly supports the claim that some NRTIs used against HIV also inhibit L1 RT activity. (LLM, conf=0.94)
plaindirect- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: fails — The paper’s conclusions may not depend on it.
- Based: passes — The paper gives a reason why it holds.
Probably not a substantial claim. The paper’s conclusions may not depend on it.
- Supported
Every source the paper cites for this claim was checked and supports it.
In the paper
“As this model would predict, knockdown of the cytosolic DNA sensing pathway components cGAS or STING17 inhibited the IFN-I response in both late senescent and 3X cells (Extended Data Fig. 5l and Fig. 7c, d), and also downregulated the SASP response in late senescent cells (Extended Data Fig. 7e).”
§ LINE-1 derepression in senescent cells triggers interferon and inflammaging > Consequences of L1 activation
What the sources say
- Supportedcites [17] Dhanwani, R., Takahashi, M. & Sharma, S. Cytosolic sensing of immuno-stimulatory DNA, the enemy within. Curr. Opin. Immunol. 50, 82–87 (2018). source
The citation is attached to the identification of cGAS and STING as components of the cytosolic DNA-sensing pathway. The Conclusions describe cGAS–STING–IRF3 as a mechanism for triggering IFN-I responses; the knockdown results are attributed to the citing paper's own figures, not to this review. (LLM, conf=0.93)
plaindirect- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: passes — The paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
It may state two separate claims as one.
- Supported
The cited sources support only part of this claim — read each source’s verdict below.
In the paper
“The initiation of L1 transcription is known to be imprecise, with the majority of start sites occurring +/−50 bp of the consensus start site, and a subset as far down as +180 bp68.”
§ LINE-1 derepression in senescent cells triggers interferon and inflammaging > Extended Data
What the sources say
- Partly supportedcites [68] Rangwala, S. H., Zhang, L. & Kazazian, H. H., Jr. Many LINE1 elements contribute to the transcriptome of human somatic cells. Genome Biol. 10, R100 (2009). sourceExperimental — accuracy not yet measured
The Results section on L1 expression tags reports variable 5′ start sites, with 50% (170) within ±50 nucleotides of the consensus start—not a majority. The Results and Discussion describe other starts more than 100 nucleotides upstream, but do not establish a subset starting at +180 bp. The paper’s 182-nucleotide figure concerns transcript termination beyond the 3′ end, not initiation. (LLM, conf=0.88)
boosted- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: fails — The paper’s conclusions may not depend on it.
- Based: passes — The paper gives a reason why it holds.
Probably not a substantial claim. The paper’s conclusions may not depend on it. It may state two separate claims as one.
- Partly supported
Every source the paper cites for this claim was checked and supports it.
In the paper
“The binding of YY1 to the L1 promoter has been documented69 and was used as a positive control.”
§ LINE-1 derepression in senescent cells triggers interferon and inflammaging > Extended Data
What the sources say
- Supportedcites [69] Athanikar, J. N., Badge, R. M. & Moran, J. V. A. A YY1-binding site is required for accurate human LINE-1 transcription initiation. Nucleic Acids Res. 32, 3846–3855 (2004). source
The Results describe a YY1-binding site in the L1 5′-UTR promoter and state that scrambling its sequence produces a mutant that can no longer bind YY1. This supports the cited statement that YY1 binding to the L1 promoter has been documented; the positive-control use is the citing authors’ own procedure. (LLM, conf=0.90)
plaincorrelational- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: fails — The paper’s conclusions may not depend on it.
- Based: passes — The paper gives a reason why it holds.
Probably not a substantial claim. The paper’s conclusions may not depend on it.
- Supported
Every source the paper cites for this claim was checked and supports it.
In the paper
“Hence, NRTIs can be categorized as “senostatic” agents, to contrast them from “senolytic” treatments that remove senescent cells from tissues21,22.”
§ LINE-1 derepression in senescent cells triggers interferon and inflammaging > Activation of L1 in human and mouse tissues
What the sources say
- Supportedcites [21] Chang, J. et al. Clearance of senescent cells by ABT263 rejuvenates aged hematopoietic stem cells in mice. Nat. Med. 22, 78–83 (2016). source
The Abstract describes ABT263 as a senolytic drug that selectively kills senescent cells and reports that oral treatment depleted them in mice. This supports the cited description of senolytic treatments as removing senescent cells from tissues. The categorization of NRTIs as senostatic is the citing authors’ conclusion, not a finding attributed to this source. (LLM, conf=0.92)
- Supportedcites [22] Zhu, Y. et al. The Achilles’ heel of senescent cells: from transcriptome to senolytic drugs. Aging Cell 14, 644–658 (2015). source
The Discussion describes senolytic agents as drugs that selectively eliminate senescent cells, supporting the contrast for which this paper is cited. The classification of NRTIs as senostatic is the citing authors’ own conclusion, not a claim this citation needs to establish. (LLM, conf=0.92)
plain- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: passes — The paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
Probably not a substantial claim.
- Supported
Every source the paper cites for this claim was checked and supports it.
In the paper
“pWA355 contains a functional, active L1RP element, whereas pWA366 contains L1RP(JM111), a mutated element carrying two missense mutations in ORF1 that is unable to retrotranspose.”
§ LINE-1 derepression in senescent cells triggers interferon and inflammaging > METHODS > Retrotransposition reporters.
What the sources say
- Supportedcites Xie et al. (2011)52 source
The Plasmids section says pWA366 was made by replacing the functional L1RP in pWA355 with L1RP/JM111. The Figure 1 caption identifies JM111 as carrying two missense mutations in ORF1, and the Results describe the pWA366 control as retrotransposition-defective. Page numbers are not available in our copy. (LLM, conf=0.93)
plain- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: passes — The paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
Probably not a substantial claim. It may state two separate claims as one.
- Supported
The cited sources support only part of this claim — read each source’s verdict below.
In the paper
“Longer term treatments (from 20 to 26 months of age) were effective at opposing several known phenotypes of aging: macrophage infiltration of tissues, a hallmark of chronic inflammation23,25, glomerulosclerosis of the kidney26 and skeletal muscle atrophy27 (Fig. 4e).”
§ LINE-1 derepression in senescent cells triggers interferon and inflammaging > Activation of L1 in human and mouse tissues
What the sources say
- Supportedcites [23] Tchkonia, T. et al. Fat tissue, aging, and cellular senescence. Aging Cell 9, 667–684 (2010). source
The citation is attached to the description of macrophage infiltration as a feature of inflammation, not to the reported 3TC treatment effect. In the Obesity section (page unavailable), the paper describes macrophage infiltration in inflamed fat tissue and says activated macrophages drive further infiltration and inflammation. (LLM, conf=0.86)
- Supportedcites [25] Frasca, D. & Blomberg, B. B. Inflammaging decreases adaptive and innate immune responses in mice and humans. Biogerontology 17, 7–19 (2016). source
The citation is attached to the description of tissue macrophage infiltration as a feature of chronic inflammation, not to the reported 3TC treatment effect. In “Other contributors to inflammaging” (page unavailable), the source describes immune-cell infiltration of adipose tissue as contributing to chronic inflammation and discusses macrophages in inflamed tissue. It does not report the 20-to-26-month treatment or the kidney and muscle outcomes. (LLM, conf=0.84)
- Supportedcites [26] Baker, D. J. et al. Naturally occurring p16Ink4a-positive cells shorten healthy lifespan. Nature 530, 184–189 (2016). source
Citation 26 is attached to glomerulosclerosis of the kidney as an aging phenotype, not to the citing paper’s 3TC treatment result. The section “Renal epithial cell senescence and glomerulosclerosis” states that aged kidneys develop sclerotic glomeruli and reports increased glomerulosclerosis between 12 and 18 months in control mice. (LLM, conf=0.91)
- Could not verifycites [27] Baker, D. J. et al. Clearance of p16Ink4a-positive senescent cells delays ageing-associated disorders. Nature 479, 232–236 (2011). sourceExperimental — accuracy not yet measured
Citation 26 is attached to glomerulosclerosis of the kidney. Our copy’s account of late-life treatment reports effects in skeletal muscle and fat, but does not address glomerulosclerosis (main text, Fig. 4 discussion; page unavailable). Searches for glomerulosclerosis, kidney, 3TC, and treatment at 20–26 months found no supporting passage. (LLM, conf=0.75)
plaindirect- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: passes — The paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
It may state two separate claims as one.
- Supported
Every source the paper cites for this claim was checked and supports it.
In the paper
“The absolute average retrotransposition frequency (percentage of GFP-positive cells) was 4.1, which matches the published values for the reporter used (pLD143)53.”
§ LINE-1 derepression in senescent cells triggers interferon and inflammaging > Extended Data
What the sources say
- Supportedcites [53] An, W. et al. Characterization of a synthetic human LINE-1 retrotransposon ORFeus-Hs. Mob. DNA 2, 2 (2011). source
Table 1 in Results reports a retrotransposition frequency of 3.8 ± 0.3% for pLD143, measured as the percentage of EGFP-positive cells. The citing paper's 4.1% is its own measurement; it is consistent with the published value rather than a number reported by the source. (LLM, conf=0.90)
plain- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: fails — The paper’s conclusions may not depend on it.
- Based: passes — The paper gives a reason why it holds.
Probably not a substantial claim. The paper’s conclusions may not depend on it. It may state two separate claims as one.
- Supported
A result the paper reports from its own data — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“We show that the expression of three regulators, RB1, FOXA1 and TREX1 changes during senescence, and that these changes are both sufficient and necessary to allow the transcriptional activation of L1s (Fig. 4g).”
§ LINE-1 derepression in senescent cells triggers interferon and inflammaging > Activation of L1 in human and mouse tissues
boosteddirect- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: passes — The paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
It may state two separate claims as one.
A result the paper reports from its own data — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“Here we show that during cellular senescence LINE-1 elements (L1s) become transcriptionally derepressed and activate a type-I interferon (IFN-I) response.”
- Also stated in: § Activation of L1 and interferon in cellular senescence · plain
“We show here that L1 transcription is activated exponentially during replicative senescence (RS) of human fibroblasts, increasing 4–5-fold by 16 weeks after cessation of proliferation, which we refer to as late senescence (Fig. 1a, Extended Data Fig. 1a-e).”
§ LINE-1 derepression in senescent cells triggers interferon and inflammaging > Abstract
plaindirect- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: passes — The paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
It may state two separate claims as one.
- Also stated in: § Activation of L1 and interferon in cellular senescence · plain
A result the paper reports from its own data — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“Hence, a fraction of senescent cells in normal human individuals display activation of L1, consistent with these events accumulating during the progression of senescence.”
§ LINE-1 derepression in senescent cells triggers interferon and inflammaging > Activation of L1 in human and mouse tissues
plaincorrelational- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: passes — The paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
It may state two separate claims as one.
A result the paper reports from its own data — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“Note that the upregulation of IFN-I is significant for EP_SEN-L and SEN-E_SEN-L but not for EP_SEN-E, and that the upregulation of SASP is significant for EP_SEN-E and EP_SEN-L but not SEN-E_SEN-L.”
§ LINE-1 derepression in senescent cells triggers interferon and inflammaging > Extended Data
plainn = 3- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: unclear — It is unclear whether the paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
It may state two separate claims as one.
A result the paper reports from its own data — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“Among the 658 mappable clones 224 unique elements were represented (Supplementary Table 3).”
§ LINE-1 derepression in senescent cells triggers interferon and inflammaging > Extended Data
plain- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: fails — The paper’s conclusions may not depend on it.
- Based: passes — The paper gives a reason why it holds.
Probably not a substantial claim. The paper’s conclusions may not depend on it.
A result the paper reports from its own data — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“In no instance was expression at 5 months + 3TC significantly different from the no drug control, therefore these data are not shown in the figure”
§ LINE-1 derepression in senescent cells triggers interferon and inflammaging > Extended Data
plainn = 8- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: unclear — It is unclear whether the paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
It may state two separate claims as one.
A result the paper reports from its own data — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“The remaining 50 mappable clones contained L1 sequences and were aligned to the L1HS consensus using a setting of >95% identity at positions 1–450”
§ LINE-1 derepression in senescent cells triggers interferon and inflammaging > METHODS > Identification of expressed L1 elements by long-range RT-PCR and 5’RACE.
plain- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: fails — The paper’s conclusions may not depend on it.
- Based: passes — The paper gives a reason why it holds.
Probably not a substantial claim. The paper’s conclusions may not depend on it.
A result the paper reports from its own data — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“Notably, we found that several IFN-I response genes (Ifn-α, Irf7, Oas1) as well as pro-inflammatory and SASP markers (Il-6, Mmp3, Pai1) were upregulated in tissues of old mice (Fig. 4c, Extended Data Fig. 9).”
§ LINE-1 derepression in senescent cells triggers interferon and inflammaging > Activation of L1 in human and mouse tissues
plaincorrelational- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: passes — The paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
It may state two separate claims as one.
A result the paper reports from its own data — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“658 clones could be thus mapped, 51 additional clones contained at least 1 mismatch and thus likely represent elements that are polymorphic in the cell line, and 58 were cloning artifacts.”
§ LINE-1 derepression in senescent cells triggers interferon and inflammaging > Extended Data
hedged- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: fails — The paper’s conclusions may not depend on it.
- Based: passes — The paper gives a reason why it holds.
Probably not a substantial claim. The paper’s conclusions may not depend on it.
A result the paper reports from its own data — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“Note that the SASP gene set is upregulated early whereas the IFN-I gene set is upregulated late.”
§ LINE-1 derepression in senescent cells triggers interferon and inflammaging > Extended Data
plaincorrelationaln = 3- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: passes — The paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
It may state two separate claims as one.
A result the paper reports from its own data — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“The RNA-DNA signal in senescent cells largely colocalized with the ORF1 signal and was lost after RNase A treatment.”
§ LINE-1 derepression in senescent cells triggers interferon and inflammaging > Extended Data
plaincorrelational- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: passes — The paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
It may state two separate claims as one.
The paper states this without a source or data behind it here, so there is nothing to check it against. The quote shows it is in the paper.
In the paper
“Several attempts using the same protocol on early passage proliferating cells did not yield any L1 clones.”
§ LINE-1 derepression in senescent cells triggers interferon and inflammaging > Extended Data
plain- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: fails — The paper’s conclusions may not depend on it.
- Based: passes — The paper gives a reason why it holds.
Probably not a substantial claim. The paper’s conclusions may not depend on it.
A result the paper reports from its own data — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“Note that the upregulation of IFN-I is significant for EP_SEN-L and SEN-E_SEN-L but not for EP_SEN-E, and that the upregulation of SASP is significant for EP_SEN-E and EP_SEN-L but not SEN-E_SEN-L.”
§ LINE-1 derepression in senescent cells triggers interferon and inflammaging > Extended Data
plainn = 3- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: passes — The paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
It may state two separate claims as one.
A result the paper reports from its own data — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“The ssDNA signal also colocalized with the ORF1 signal and was exposed by RNase treatment.”
§ LINE-1 derepression in senescent cells triggers interferon and inflammaging > Extended Data
plaincorrelational- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: passes — The paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
It may state two separate claims as one.
What the paper did — it cites no source for this, so there is none to check. The quote shows it is in the paper.
In the paper
“Sample sizes were based on previously published experiments and previous experience in which differences were observed.”
§ LINE-1 derepression in senescent cells triggers interferon and inflammaging > METHODS > Statistical treatments.
plain- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: fails — The paper’s conclusions may not depend on it.
- Based: passes — The paper gives a reason why it holds.
Probably not a substantial claim. The paper’s conclusions may not depend on it.
What the paper did — it cites no source for this, so there is none to check. The quote shows it is in the paper.
In the paper
“In each individual experiment all samples were processed in parallel and no blinding was introduced.”
§ LINE-1 derepression in senescent cells triggers interferon and inflammaging > METHODS > Mouse tissue specimens.
plain- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: fails — The paper’s conclusions may not depend on it.
- Based: passes — The paper gives a reason why it holds.
Probably not a substantial claim. The paper’s conclusions may not depend on it. It may state two separate claims as one.
What the paper did — it cites no source for this, so there is none to check. The quote shows it is in the paper.
In the paper
“The RNA-seq experiment was performed in three biological replicates.”
§ LINE-1 derepression in senescent cells triggers interferon and inflammaging > METHODS > RNA-seq.
plain- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: fails — The paper’s conclusions may not depend on it.
- Based: passes — The paper gives a reason why it holds.
Probably not a substantial claim. The paper’s conclusions may not depend on it.
What the paper did — it cites no source for this, so there is none to check. The quote shows it is in the paper.
In the paper
“Fields or sections of tissues for quantification were randomly selected and the scored, using methods as indicated for individual experiments.”
§ LINE-1 derepression in senescent cells triggers interferon and inflammaging > METHODS > Statistical treatments.
plain- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: fails — The paper’s conclusions may not depend on it.
- Based: passes — The paper gives a reason why it holds.
Probably not a substantial claim. The paper’s conclusions may not depend on it.
What the paper did — it cites no source for this, so there is none to check. The quote shows it is in the paper.
In the paper
“All attempts at replication were successful.”
§ LINE-1 derepression in senescent cells triggers interferon and inflammaging > METHODS > Statistical treatments.
plain- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: fails — The paper’s conclusions may not depend on it.
- Based: passes — The paper gives a reason why it holds.
Probably not a substantial claim. The paper’s conclusions may not depend on it.
What the paper did — it cites no source for this, so there is none to check. The quote shows it is in the paper.
In the paper
“The Brown investigators were blinded to everything except the age and sex of the subjects.”
§ LINE-1 derepression in senescent cells triggers interferon and inflammaging > METHODS > Human tissue specimens.
plain- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: fails — The paper’s conclusions may not depend on it.
- Based: passes — The paper gives a reason why it holds.
Probably not a substantial claim. The paper’s conclusions may not depend on it.
What the paper did — it cites no source for this, so there is none to check. The quote shows it is in the paper.
In the paper
“The successful knock out of IFNAR1 and IFNAR2 was verified in 4 out of the 24 expanded clonal cell lines.”
§ LINE-1 derepression in senescent cells triggers interferon and inflammaging > METHODS > Generation and analysis of CRISPR-Cas9 knockouts.
plainn = 24- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: fails — The paper’s conclusions may not depend on it.
- Based: passes — The paper gives a reason why it holds.
Probably not a substantial claim. The paper’s conclusions may not depend on it.
- Rests on an assumption: Absence of nuclear translocation of phospho-STAT2 and IRF9 after interferon treatment signifies lack of IFN-I responsiveness and loss of IFNAR function.
What the paper did — it cites no source for this, so there is none to check. The quote shows it is in the paper.
In the paper
“No statistical test was used to pre-determine sample size.”
§ LINE-1 derepression in senescent cells triggers interferon and inflammaging > METHODS > Statistical treatments.
plain- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: fails — The paper’s conclusions may not depend on it.
- Based: passes — The paper gives a reason why it holds.
Probably not a substantial claim. The paper’s conclusions may not depend on it.
What the paper did — it cites no source for this, so there is none to check. The quote shows it is in the paper.
In the paper
“Three independent experiments were performed for each construct.”
§ LINE-1 derepression in senescent cells triggers interferon and inflammaging > METHODS > Retrotransposition reporters.
plain- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: fails — The paper’s conclusions may not depend on it.
- Based: passes — The paper gives a reason why it holds.
Probably not a substantial claim. The paper’s conclusions may not depend on it.
What the paper did — it cites no source for this, so there is none to check. The quote shows it is in the paper.
In the paper
“There were no findings that were not replicated or could not be reproduced.”
§ LINE-1 derepression in senescent cells triggers interferon and inflammaging > METHODS > Statistical treatments.
plain- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: fails — The paper’s conclusions may not depend on it.
- Based: passes — The paper gives a reason why it holds.
Probably not a substantial claim. The paper’s conclusions may not depend on it.
What the paper did — it cites no source for this, so there is none to check. The quote shows it is in the paper.
In the paper
“The investigators were also blinded when scoring glomerulosclerosis and muscle fiber diameter.”
§ LINE-1 derepression in senescent cells triggers interferon and inflammaging > METHODS > Statistical treatments.
plain- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: fails — The paper’s conclusions may not depend on it.
- Based: passes — The paper gives a reason why it holds.
Probably not a substantial claim. The paper’s conclusions may not depend on it.
What the paper did — it cites no source for this, so there is none to check. The quote shows it is in the paper.
In the paper
“The investigators were blinded when quantifying immunofluorescence results.”
§ LINE-1 derepression in senescent cells triggers interferon and inflammaging > METHODS > Statistical treatments.
plain- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: fails — The paper’s conclusions may not depend on it.
- Based: passes — The paper gives a reason why it holds.
Probably not a substantial claim. The paper’s conclusions may not depend on it.
A conclusion the paper draws from its own results — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“658 clones could be thus mapped, 51 additional clones contained at least 1 mismatch and thus likely represent elements that are polymorphic in the cell line, and 58 were cloning artifacts.”
§ LINE-1 derepression in senescent cells triggers interferon and inflammaging > Extended Data
hedged- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: fails — The paper’s conclusions may not depend on it.
- Based: passes — The paper gives a reason why it holds.
Probably not a substantial claim. The paper’s conclusions may not depend on it. It may state two separate claims as one.
What the paper did — it cites no source for this, so there is none to check. The quote shows it is in the paper.
In the paper
“All conditions were run in triplicate.”
§ LINE-1 derepression in senescent cells triggers interferon and inflammaging > METHODS > PCR arrays.
plain- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: fails — The paper’s conclusions may not depend on it.
- Based: passes — The paper gives a reason why it holds.
Probably not a substantial claim. The paper’s conclusions may not depend on it.
What the paper did — it cites no source for this, so there is none to check. The quote shows it is in the paper.
In the paper
“Briefly, 40 glomeruli per animal were assessed in a blinded fashion and assigned scores of 1–4: score of 1, <25% sclerosis; 2, 25–50% sclerosis; 3, 50–75% sclerosis; 4, >75% sclerosis.”
§ LINE-1 derepression in senescent cells triggers interferon and inflammaging > METHODS > Mouse tissue specimens.
plainn = 40- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: fails — The paper’s conclusions may not depend on it.
- Based: passes — The paper gives a reason why it holds.
Probably not a substantial claim. The paper’s conclusions may not depend on it. It may state two separate claims as one.
In the paper
“The outputs were then corrected for multiple comparisons by adjusting the nominal p value using Benjamini-Hochberg method47.”
§ LINE-1 derepression in senescent cells triggers interferon and inflammaging > METHODS > RNA-seq.
What the sources say
- Not checked — no full text of the sourcecites [47] Benjamini, Y. & Hochberg, Y. Controlling the false discovery rate: a practical and powerful approach to multiple testing. J. R. Stat. Soc. B 57, 289–300 (1995). source
plain- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: fails — The paper’s conclusions may not depend on it.
- Based: passes — The paper gives a reason why it holds.
Probably not a substantial claim. The paper’s conclusions may not depend on it.
What the paper did — it cites no source for this, so there is none to check. The quote shows it is in the paper.
In the paper
“No samples were excluded.”
§ LINE-1 derepression in senescent cells triggers interferon and inflammaging > METHODS > Statistical treatments.
plain- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: fails — The paper’s conclusions may not depend on it.
- Based: passes — The paper gives a reason why it holds.
Probably not a substantial claim. The paper’s conclusions may not depend on it.
What the paper did — it cites no source for this, so there is none to check. The quote shows it is in the paper.
In the paper
“All microscope settings and exposure times were set to collect images below saturation and were kept constant for all images taken in one experiment.”
§ LINE-1 derepression in senescent cells triggers interferon and inflammaging > METHODS > Human tissue specimens.
plain- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: fails — The paper’s conclusions may not depend on it.
- Based: passes — The paper gives a reason why it holds.
Probably not a substantial claim. The paper’s conclusions may not depend on it. It may state two separate claims as one.
What the paper did — it cites no source for this, so there is none to check. The quote shows it is in the paper.
In the paper
“The remaining 7 shRNAs produced no or minimal knockdown.”
§ LINE-1 derepression in senescent cells triggers interferon and inflammaging > METHODS > Lentiviral vectors.
plain- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: fails — The paper’s conclusions may not depend on it.
- Based: passes — The paper gives a reason why it holds.
Probably not a substantial claim. The paper’s conclusions may not depend on it.
A conclusion the paper draws from its own results — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“658 clones could be thus mapped, 51 additional clones contained at least 1 mismatch and thus likely represent elements that are polymorphic in the cell line, and 58 were cloning artifacts.”
§ LINE-1 derepression in senescent cells triggers interferon and inflammaging > Extended Data
plain- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: fails — The paper’s conclusions may not depend on it.
- Based: passes — The paper gives a reason why it holds.
Probably not a substantial claim. The paper’s conclusions may not depend on it.
What the paper did — it cites no source for this, so there is none to check. The quote shows it is in the paper.
In the paper
“For knockdown of L1 we designed and tested 9 shRNAs, of which two (shL1_11 to ORF1, AAGACACATGCACACGTATGT, and shL1_44 to ORF2 AAGACACATGCACACGTATGT) showed significant knockdown (Extended Data Fig. 5g) and were chosen for further work.”
§ LINE-1 derepression in senescent cells triggers interferon and inflammaging > METHODS > Lentiviral vectors.
plain- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: passes — The paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
Probably not a substantial claim.
What the paper did — it cites no source for this, so there is none to check. The quote shows it is in the paper.
In the paper
“Because of limiting material it was not possible to combine detection of p16 with TIFs in a 3 color experiment.”
§ LINE-1 derepression in senescent cells triggers interferon and inflammaging > Extended Data
plain- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: fails — The paper’s conclusions may not depend on it.
- Based: passes — The paper gives a reason why it holds.
Probably not a substantial claim. The paper’s conclusions may not depend on it.
What the paper did — it cites no source for this, so there is none to check. The quote shows it is in the paper.
In the paper
“The experiment was repeated 3 times with similar results.”
- Also stated in: § Extended Data · plain
“The experiment was repeated 3 times with similar results.”
- Also stated in: § Extended Data · plain
“The experiments shown in panels (a, b) was repeated 3 times independently with similar results.”
§ LINE-1 derepression in senescent cells triggers interferon and inflammaging > Extended Data
plainn = 3- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: fails — The paper’s conclusions may not depend on it.
- Based: passes — The paper gives a reason why it holds.
Probably not a substantial claim. The paper’s conclusions may not depend on it.
- Also stated in: § Extended Data · plain
What the paper did — it cites no source for this, so there is none to check. The quote shows it is in the paper.
In the paper
“The specimens used here were chosen randomly from left over material.”
§ LINE-1 derepression in senescent cells triggers interferon and inflammaging > Extended Data
plain- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: fails — The paper’s conclusions may not depend on it.
- Based: passes — The paper gives a reason why it holds.
Probably not a substantial claim. The paper’s conclusions may not depend on it.
What the paper did — it cites no source for this, so there is none to check. The quote shows it is in the paper.
In the paper
“Primer pairs for all genes were verified to be of equivalent efficiency.”
§ LINE-1 derepression in senescent cells triggers interferon and inflammaging > Extended Data
plain- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: fails — The paper’s conclusions may not depend on it.
- Based: passes — The paper gives a reason why it holds.
Probably not a substantial claim. The paper’s conclusions may not depend on it.
In the paper
“The TIF assay34 relies on a two-parameter (color) visualization of telomeres (using a FISH probe) and immunofluorescent detection of DNA damage foci (using antibody to 53BP1).”
§ LINE-1 derepression in senescent cells triggers interferon and inflammaging > Extended Data
What the sources say
- Not checked — no full text of the sourcecites [34] Herbig, U., Jobling, W. A., Chen, B. P., Chen, D. J. & Sedivy, J. M. Telomere shortening triggers senescence of human cells through a pathway involving ATM, p53, and p21CIP1, but not p16INK4a. Mol. Cell 14, 501–513 (2004). source
plain- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: fails — The paper’s conclusions may not depend on it.
- Based: passes — The paper gives a reason why it holds.
Probably not a substantial claim. The paper’s conclusions may not depend on it.
The authors state this as an assumption.
The contribution of RTE activity to aging and age-associated diseases is not known.
“However, the contribution of RTE activity to aging and age-associated diseases is not known.”
The paper relies on this without support.
Cellular senescence in cultured human fibroblasts is representative of senescence in vivo and of aging.
“The activation of endogenous L1 elements and the ensuing robust activation of an IFN-I response is a novel phenotype of senescent cells, including naturally occurring senescent cells in tissues.”
The paper relies on this without support.
Absence of nuclear translocation of phospho-STAT2 and IRF9 after interferon treatment signifies lack of IFN-I responsiveness and loss of IFNAR function.
“The absence of translocation signifies lack of IFN-I responsiveness and hence loss of IFNAR function.”
Claims other papers make about this one
Each is checked against this paper’s own text: does it say what the citing paper says it does?
The source backs part of the claim, not all of it — or backs it for a different population, condition or comparison.
In the citing paper
“Studies of these proteins indicate that repeated triggering of the RCM response disrupts youthful gene expression patterns and liberates retrotransposons, such as those silenced by SIRT1/SIRT6 (De Cecco et al., 2019; Oberdoerffer et al., 2008; Simon et al., 2019).”
From Loss of epigenetic information as a cause of mammalian aging (2023) · cites this paper as De Cecco et al., 2019
Experimental — accuracy not yet measuredThe source backs part of the claim, not all of it — or backs it for a different population, condition or comparison.
In the citing paper
“These include retrotransposable elements (for example, LINE-1), cytosolic mitochondrial DNA, or circular DNA—all of which can activate the cytosolic DNA-sensing (cGAS)-STING pathway, triggering the expression of pro-inflammatory genes79–81.”
From Cellular senescence and senolytics: the path to the clinic (2022) · cites this paper as [79]
Experimental — accuracy not yet measuredThe source backs part of the claim, not all of it — or backs it for a different population, condition or comparison.
In the citing paper
“numerous other senescence markers, such as p21, p16, SASP factors, and DNA damage, are found across populations of adipose tissue cells7,31,84–87 (Fig. 2 F).”
From Guidelines for minimal information on cellular senescence experimentation in vivo (2024) · cites this paper as [87]
Experimental — accuracy not yet measuredThe source backs part of the claim, not all of it — or backs it for a different population, condition or comparison.
In the citing paper
“Importantly, treatment with nucleoside reverse transcriptase inhibitor (NRTI) drugs that inhibit L1 reverse transcriptase, or a knockdown of L1 expression with shRNAs against active L1 families, decreased cytoplasmic L1 DNAs and ameliorated cGAS and IFN-I activation33, 34, 92.”
From The role of retrotransposable elements in ageing and age-associated diseases (2021) · cites this paper as [33]
Experimental — accuracy not yet measuredThe source backs part of the claim, not all of it — or backs it for a different population, condition or comparison.
In the citing paper
“Recently, cytoplasmic L1 DNA was found in normal cells in association with cellular senescence and aging33, 34.”
From The role of retrotransposable elements in ageing and age-associated diseases (2021) · cites this paper as [33]
Experimental — accuracy not yet measured
The source backs part of the claim, not all of it — or backs it for a different population, condition or comparison.
In the citing paper
“Retrotransposition is greatly diminished in non-dividing cells94, although low levels could be detected in senescent cells33 or neurons92, and it is possible that abortive products of these processes could accumulate.”
From The role of retrotransposable elements in ageing and age-associated diseases (2021) · cites this paper as [33]
Experimental — accuracy not yet measuredThe source backs part of the claim, not all of it — or backs it for a different population, condition or comparison.
In the citing paper
“Moreover, in very late replicative, stress, and OIS cells, the SASP becomes characterized by the expression of type-I interferons (IFN-I) (De Cecco et al. 2019).”
From Senescence and the SASP: many therapeutic avenues (2020) · cites this paper as De Cecco et al. 2019
Experimental — accuracy not yet measuredThe source backs part of the claim, not all of it — or backs it for a different population, condition or comparison.
In the citing paper
“while reverse transcription of LINE-1 RNA results in double-stranded cDNA that activates the cGAS/STING/interferon pathway 72 .”
From Hallmarks of aging: An expanding universe (2023) · cites this paper as [72]
Experimental — accuracy not yet measuredThe source backs part of the claim, not all of it — or backs it for a different population, condition or comparison.
In the citing paper
“SASP results from three features of senescent cells: (i) the transcriptional derepression of endogenous retroviruses, most notably LINE-1, which causes cytosolic leakage of double-stranded DNA and activates the cGAS/STING and TLR pathways 72 ;”
From Hallmarks of aging: An expanding universe (2023) · cites this paper as [72]
Experimental — accuracy not yet measuredThe cited source says what the claim attributes to it.
In the citing paper
“At 10-months post-treatment, the ICE mice had 6-fold fewer COX-positive myofibers (Figure S5G and S5H), about half the capillary to fiber ratio (Figure 4G and 4H), a loss of silencing at repetitive elements and the transcription of retrotransposons, paralleling normal aging (Das et al., 2019; De Cecco et al., 2019; Oberdoerffer et al., 2008; Wenz et al., 2009) (Figure S5I).”
From Loss of epigenetic information as a cause of mammalian aging (2023) · cites this paper as De Cecco et al., 2019
The cited source says what the claim attributes to it.
In the citing paper
“The SASP of senescent cells is not static; it can change over time78–80 and varies depending on the type of cells that became senescent and how senescence was induced16,44,59,60,81.”
From Cellular senescence and senolytics: the path to the clinic (2022) · cites this paper as [79]
Experimental — accuracy not yet measuredThe cited source says what the claim attributes to it.
In the citing paper
“the reactivation of transposable elements also contributes to mediate the non-cell-autonomous functions of senescent cells as detailed later62”
From Cellular senescence in ageing: from mechanisms to therapeutic opportunities (2021) · cites this paper as [62]
The cited source says what the claim attributes to it.
In the citing paper
“Senescent cells, especially when persisting for extended periods in culture or in vivo, display a profound activation of type I interferon response and downstream targets.”
From Cellular senescence in ageing: from mechanisms to therapeutic opportunities (2021) · cites this paper as [62]
The cited source says what the claim attributes to it.
In the citing paper
“Treatment with nucleoside reverse-transcriptase inhibitors, which inhibit retrotransposition of transposable elements, limits the senescence-associated detrimental effects of SASP and ameliorates chronic inflammation in aged animals62,119.”
From Cellular senescence in ageing: from mechanisms to therapeutic opportunities (2021) · cites this paper as [62]
The cited source says what the claim attributes to it.
In the citing paper
“This distinctively strong induction of type I interferon was found to be partly caused by reactivation of transposable elements and consequent to cGAS–STING activation62.”
From Cellular senescence in ageing: from mechanisms to therapeutic opportunities (2021) · cites this paper as [62]
The cited source says what the claim attributes to it.
In the citing paper
“Additional features of the senescent cell-cycle arrest include ribosome biogenesis defects and derepression of retrotransposons (De Cecco et al., 2019; Lessard et al., 2018).”
From Cellular Senescence: Defining a Path Forward (2019) · cites this paper as De Cecco et al., 2019
The cited source says what the claim attributes to it.
In the citing paper
“Moreover, an interferon type 1 response occurs as a later event and is driven in part by derepression of LINE-1 retrotransposable elements (De Cecco et al., 2019).”
From Cellular Senescence: Defining a Path Forward (2019) · cites this paper as De Cecco et al., 2019
The cited source says what the claim attributes to it.
In the citing paper
“Loss of these factors reduces heterochromatin at retrotransposons and allows their transcriptional derepression26, 29, 31, 33–35.”
From The role of retrotransposable elements in ageing and age-associated diseases (2021) · cites this paper as [33]
The cited source says what the claim attributes to it.
In the citing paper
“However, DNA methylation changes are early events in senescence73, whereas retrotransposon activation occurs only much later33.”
From The role of retrotransposable elements in ageing and age-associated diseases (2021) · cites this paper as [33]
The cited source says what the claim attributes to it.
In the citing paper
“Knockdown of RB1 and TREX1 combined with FOXA1 overexpression led to L1 derepression in human fibroblasts33.”
From The role of retrotransposable elements in ageing and age-associated diseases (2021) · cites this paper as [33]
The cited source says what the claim attributes to it.
In the citing paper
“De Cecco et al74 reported high transcription levels of the long‐interspersed element‐1 (LINE‐1, also known as L1), a retrotransposable element, in senescent cells.”
From Cellular senescence and senescence-associated secretory phenotype via the cGAS-STING signaling pathway in cancer (2020) · cites this paper as [74]
The cited source says what the claim attributes to it.
In the citing paper
“lamivudine reduces the late SASP response and ameliorates several phenotypes of aging in old mice, including kidney glomerulosclerosis, skeletal muscle atrophy, and tissue immune infiltrations (De Cecco et al. 2019).”
From Senescence and the SASP: many therapeutic avenues (2020) · cites this paper as De Cecco et al. 2019
The cited source says what the claim attributes to it.
In the citing paper
“LOAD neurons were treated with 3TC from PID16 to PID28, and the presence of single-stranded DNA (ssDNA), an intermediate product of retrotransposition and its amount has been served as an indicator for RTE synthesis (86), were reduced by ~50% at PID28 (Fig. 7A).”
From Modeling late-onset Alzheimer’s disease neuropathology via direct neuronal reprogramming (2024) · cites this paper as [86]
The cited source says what the claim attributes to it.
In the citing paper
“It was previously shown that dysregulation of retrotransposon elements (RTEs) in aging may trigger inflammatory responses (86–88)”
From Modeling late-onset Alzheimer’s disease neuropathology via direct neuronal reprogramming (2024) · cites this paper as [86]
The cited source says what the claim attributes to it.
In the citing paper
“Previous research has revealed DNA damage products5–7 and retroelement amplification52 as upstream triggers of cGAS in senescence.”
From cGAS–STING drives ageing-related inflammation and neurodegeneration (2023) · cites this paper as [52]
The check wasn’t confident either way, so it gives no verdict — never disputed.
In the citing paper
“Elimination of p16+ cells in the adipose tissue of transgenic mice reduces overall tissue senescence86,87”
From Guidelines for minimal information on cellular senescence experimentation in vivo (2024) · cites this paper as [87]
Experimental — accuracy not yet measuredThe check wasn’t confident either way, so it gives no verdict — never disputed.
In the citing paper
“(ii) the mitochondrial overproduction of ROS;”
From Hallmarks of aging: An expanding universe (2023) · cites this paper as [72]
Experimental — accuracy not yet measuredIn the citing paper
“This activation of L1 which is mediated by TREX1, RB1 and FOXA1 leads to accumulation of cDNA in the cytoplasm as L1 possesses high reverse transcriptase activity.”
From Mechanisms of Cellular Senescence: Cell Cycle Arrest and Senescence Associated Secretory Phenotype (2021) · cites this paper as De Cecco et al., 2019
In the citing paper
“The accumulated cDNA has been demonstrated to trigger cGAS/STING signaling pathway, leading to production of SASP factors (De Cecco et al., 2019).”
From Mechanisms of Cellular Senescence: Cell Cycle Arrest and Senescence Associated Secretory Phenotype (2021) · cites this paper as De Cecco et al., 2019
In the citing paper
“De Cecco et al. (2019) reported derepression of long-interspersed element-1 (L1 or LINE-1), the only human retrotransposable element capable of autonomous retrotransposition, in senescent cells.”
From Mechanisms of Cellular Senescence: Cell Cycle Arrest and Senescence Associated Secretory Phenotype (2021) · cites this paper as De Cecco et al., 2019
In the citing paper
“However, senomorphic treatment may require continuous administration and could potentially disrupt tissue homeostasis due to SASP blockade.”
From Senescence, brain inflammation, and oligomeric tau drive cognitive decline in Alzheimer's disease: Evidence from clinical and preclinical studies (2024) · cites this paper as [191]
In the citing paper
“but decreased p16Ink4a mRNA levels, a marker of late senescence, by 73% (Fig. 2i)”
From Exercise activates AMPK in mouse and human pancreatic islets to decrease senescence (2024) · cites this paper as [23]
In the citing paper
“Previous data have suggested that p16Ink4a is involved in maintaining senescence, whereas p21Cip1 is involved in establishing senescence23,39.”
From Exercise activates AMPK in mouse and human pancreatic islets to decrease senescence (2024) · cites this paper as [23]
In the citing paper
“Senescent cells accumulate in a range of tissues with age, secreting numerous pro‐inflammatory cytokines, chemokines, growth factors, and extracellular matrix (ECM) degrading proteins.[ 58 ]”
From Pathogenesis of sarcopenia and the relationship with fat mass: descriptive review (2022) · cites this paper as [58]
In the citing paper
“Transposons (“jumping genes”) can be produced within senescent cells that re-insert into senescent cell DNA, contributing to the senescent cell phenotype and exacerbating their SASP [24, 25].”
From Reducing Senescent Cell Burden in Aging and Disease (2020) · cites this paper as [25]
In the citing paper
“Senescence and the SASP are dynamic phenotypes that change over time (De Cecco et al., 2019; Hernandez-Segura et al., 2017).”
From Oxylipin biosynthesis reinforces cellular senescence and allows detection of senolysis (2021) · cites this paper as De Cecco et al., 2019
In the citing paper
“Indeed, a study demonstrated that the increase in L1 transcription observed during cellular senescence was mediated by decreased expression of RB1, a transcriptional repressor that promotes heterochromatinization of L1 elements, as well as increased expression of the transcriptional activator, FOXA1 (De Cecco et al., 2019).”
From Cytoplasmic DNA: sources, sensing, and role in aging and disease (2021) · cites this paper as De Cecco et al., 2019
In the citing paper
“Activation of retrotransposon has also been shown to contribute to age-associated chronic inflammation (De Cecco et al., 2019; Simon et al., 2019).”
From Cytoplasmic DNA: sources, sensing, and role in aging and disease (2021) · cites this paper as De Cecco et al., 2019
In the citing paper
“Reactivation of LINE-1 elements during late senescence is accompanied by accumulation of L1 cytoplasmic cDNA, due in part to a decrease in the levels of the exonuclease TREX1 (De Cecco et al., 2019), and activation of a cGAS-STING-dependent IFN-I response and pro-inflammatory phenotype (De Cecco et al., 2019).”
From Cytoplasmic DNA: sources, sensing, and role in aging and disease (2021) · cites this paper as De Cecco et al., 2019
In the citing paper
“In addition, NRTIs have been shown to abrogate the accumulation of cytoplasmic L1 DNA in senescent cells (De Cecco et al., 2019; Simon et al., 2019).”
From Cytoplasmic DNA: sources, sensing, and role in aging and disease (2021) · cites this paper as De Cecco et al., 2019
In the citing paper
“Inhibiting the synthesis of cytoplasmic L1 DNA, either by using nucleoside reverse transcriptase inhibitors (NRTIs) or by shRNA knockdown of L1, was sufficient to reduce the activation of IFN genes and the magnitude of the SASP, demonstrating that accumulation of L1 cDNA in the cytoplasm of senescent cells is an important contributor to the maintenance of the pro-inflammatory phenotype (De Cecco”
From Cytoplasmic DNA: sources, sensing, and role in aging and disease (2021) · cites this paper as De Cecco et al., 2019
In the citing paper
“Retrotransposons are known to be activated in senescent cells (De Cecco et al., 2019; Gorbunova et al., 2021).”
From Cytoplasmic DNA: sources, sensing, and role in aging and disease (2021) · cites this paper as De Cecco et al., 2019
In the citing paper
“Indeed, treating aged mice with NRTIs effectively reduced L1 cytoplasmic DNA and the ensuing inflammation in a variety of tissues (De Cecco et al., 2019; Simon et al., 2019), and improved a number of age-related phenotypes, such as tissue macrophage infiltration, glomerulosclerosis of the kidney, and skeletal muscle atrophy (De Cecco et al., 2019).”
From Cytoplasmic DNA: sources, sensing, and role in aging and disease (2021) · cites this paper as De Cecco et al., 2019
In the citing paper
“Interestingly, increased cytosolic L1 DNA and expression of IFN genes has been observed in a number of tissues of aged mice (De Cecco et al., 2019; Simon et al., 2019).”
From Cytoplasmic DNA: sources, sensing, and role in aging and disease (2021) · cites this paper as De Cecco et al., 2019
In the citing paper
“this activation only occurs late in senescence (a few months), versus CCF formation (a few days)”
From Cytoplasmic DNA: sources, sensing, and role in aging and disease (2021) · cites this paper as De Cecco et al., 2019
In the citing paper
“Senescent cells also display RT activation (De Cecco et al., 2019)”
From Cytoplasmic DNA: sources, sensing, and role in aging and disease (2021) · cites this paper as De Cecco et al., 2019
In the citing paper
“Alternatively, an increase in the transcription of long-interspersed element-1 (LINE-1 or L1), the only human retro-transposable element, during senescence could partly contribute to the accumulation of DNA fragments in the cytoplasm [177].”
From Mechanisms and Regulation of Cellular Senescence (2021) · cites this paper as [177]
In the citing paper
“As L1 displays high reverse transcriptase activity, its activation results in cDNA accumulation in the cytoplasm that reinforces cGAS signaling activation to produce the SASP response in senescent cells and chronic inflammation in aged mice [177,178].”
From Mechanisms and Regulation of Cellular Senescence (2021) · cites this paper as [177]
In the citing paper
“Indeed, genomic mosaicism by retro transposition of LINE-1 elements has been associated with the neuronal genome and the derepression of LINE-1 elements has been associated with senescence129–131.”
From Neuronal DNA double-strand breaks lead to genome structural variations and 3D genome disruption in neurodegeneration (2023) · cites this paper as [130]
In the citing paper
“p21 levels may also decrease in ‘late’ senescence or when senescence has been achieved [115,158], whereas high levels of p16 are thought to be maintained throughout senescence [158,159].”
From Untangling senescent and damage‐associated microglia in the aging and diseased brain (2023) · cites this paper as [158]
Self-check
Percentages, sums and reported differences re-computed from the paper’s own numbers.
Each contradiction between two passages listed here was confirmed by an independent check.
Rated minor: it would not touch a result — a value no result rests on, a p-value that stays on the same side of the significance level, or a conflict that is clerical, resolved elsewhere in the paper, or outside its own findings.
In the paper
§ LINE-1 derepression in senescent cells triggers interferon and inflammaging > Extended Data
“late senescent cells (16 weeks, point D in Extended Data Fig. 1a)”
§ LINE-1 derepression in senescent cells triggers interferon and inflammaging > METHODS > Lentiviral vectors.
“All the interventions in senescent cells were initiated by infecting cells at 12 weeks of senescence (point D in Extended Data Fig. 1a). Following appropriate drug selections cells were incubated until 16 weeks of senescence (point E in Extended Data Fig. 1a)”
Rated minor: it would not touch a result — a value no result rests on, a p-value that stays on the same side of the significance level, or a conflict that is clerical, resolved elsewhere in the paper, or outside its own findings.
In the paper
§ LINE-1 derepression in senescent cells triggers interferon and inflammaging > METHODS > PCR arrays.
“For any GOI to be considered significant the following filters were set: 1) >2-fold change in expression; 2) p-value >0.05.”
§ LINE-1 derepression in senescent cells triggers interferon and inflammaging > METHODS > Statistical treatments.
“For consistency of comparisons significance in all figures is denoted as follows: *P < 0.05, **P < 0.01.”
Rated minor: it would not touch a result — a value no result rests on, a p-value that stays on the same side of the significance level, or a conflict that is clerical, resolved elsewhere in the paper, or outside its own findings.
In the paper
§ LINE-1 derepression in senescent cells triggers interferon and inflammaging > METHODS > Lentiviral vectors.
“two (shL1_11 to ORF1, AAGACACATGCACACGTATGT, and shL1_44 to ORF2 AAGACACATGCACACGTATGT) showed significant knockdown”
§ LINE-1 derepression in senescent cells triggers interferon and inflammaging > Extended Data
“Knockdowns of L1 were performed with two distinct shRNAs (a, b) in senescent cells”
Citations
Cites
Controlling the False Discovery Rate: A Practical and Powerful Approach to Multiple Testing
Benjamini, Y., & Hochberg, Y. (1995) · Journal of the Royal Statistical Society Series B: Statistical Methodology · doi:10.1111/j.2517-6161.1995.tb02031.x · Cited by 109,482 · cited 1×
“The outputs were then corrected for multiple comparisons by adjusting the nominal p value using Benjamini-Hochberg method 47 .”
Subramanian, A., Tamayo, P., Mootha, V. K., Mukherjee, S., Ebert, B. L., Gillette, M. A., Paulovich, A., Pomeroy, S. L., Golub, T. R., Lander, E. S., et al. (2005) · Proceedings of the National Academy of Sciences · doi:10.1073/pnas.0506580102 · Cited by 53,625
MAFFT Multiple Sequence Alignment Software Version 7: Improvements in Performance and Usability
Katoh, K., & Standley, D. M. (2013) · Molecular Biology and Evolution · doi:10.1093/molbev/mst010 · Cited by 46,209 · cited 1×
“Multiple sequence alignments were calculated using MAFFT (Multiple Alignment using Fast Fourier Transform) with the L-INS-i algorithm (accurate for alignments of 200 sequences) 57 .”
Robinson, M. D., McCarthy, D. J., & Smyth, G. K. (2010) · Bioinformatics · doi:10.1093/bioinformatics/btp616 · Cited by 41,364
featureCounts: an efficient general purpose program for assigning sequence reads to genomic features
Liao, Y., Smyth, G. K., & Shi, W. (2014) · Bioinformatics · doi:10.1093/bioinformatics/btt656 · Cited by 27,219 · cited 1×
“Counts mapping to the genome were determined using featureCounts 43 .”
HISAT: a fast spliced aligner with low memory requirements
Kim, D., Langmead, B., & Salzberg, S. L. (2015) · Nature Methods · doi:10.1038/nmeth.3317 · Cited by 24,112
López-Otín, C., Blasco, M. A., Partridge, L., Serrano, M., & Kroemer, G. (2013) · Cell · doi:10.1016/j.cell.2013.05.039 · Cited by 14,982 · cited 1×
“Given Sterile inflammation, also known as inflammaging, is a hallmark of aging and a contributing factor to many age-related diseases 31,32 .”
Jalview Version 2—a multiple sequence alignment editor and analysis workbench
Waterhouse, A. M., Procter, J. B., Martin, D. M. A., Clamp, M. E., & Barton, G. J. (2009) · Bioinformatics · doi:10.1093/bioinformatics/btp033 · Cited by 10,349
Primer-BLAST: A tool to design target-specific primers for polymerase chain reaction
Ye, J., Coulouris, G., Zaretskaya, I., Cutcutache, I., Rozen, S., & Madden, T. (2012) · BMC Bioinformatics · doi:10.1186/1471-2105-13-134 · Cited by 6,369
Improved vectors and genome-wide libraries for CRISPR screening
Sanjana, N. E., Shalem, O., & Zhang, F. (2014) · Nature Methods · doi:10.1038/nmeth.3047 · Cited by 5,239 · cited 1×
“0 resource (Feng Zhang Lab, MIT, http://genome-engineering.org/gecko/?page_id=15) 59 , were tested and the following ones were chosen: IFNAR1 (HGLibA_29983) AACAGGAGCGATGAGTCTGTA; IFNAR2 (HGLibA_29985) GTGTATATCAGCCTCGTGTT.”
Research works printed but not linked: 1
- Kreiling, J. A. et al. in Human Retrotransposons in Health and Disease (ed. Cristofari, G.) 297–321 (Springer International, New York, 2017).
Cited by
Sorted by citations
Items 401–500 of 1,257
Metformin: From diabetes to cancer to prolongation of life
Sirtori, C. R., Castiglione, S., & Pavanello, C. (2024) · Pharmacological Research · doi:10.1016/j.phrs.2024.107367 · Cited by 38
Immune aging and infectious diseases
Chen, R., Zou, J., Chen, J., Wang, L., Kang, R., & Tang, D. (2024) · Chinese Medical Journal · doi:10.1097/cm9.0000000000003410 · Cited by 35
Activation and regulation of cGAS-STING signaling in cancer cells
Shim, A., Chen, Y., & Maciejowski, J. (2025) · Molecular Cell · doi:10.1016/j.molcel.2025.08.030 · Cited by 37
Rising from the ashes: cellular senescence in regeneration
Walters, H., & Yun, M. H. (2020) · Current Opinion in Genetics & Development · doi:10.1016/j.gde.2020.06.002 · Cited by 30
Chronic HIV Infection and Aging: Application of a Geroscience-Guided Approach
Masters, M. C., LANDAY, A. L., Robbins, P. D., Tchkonia, T., Kirkland, J. L., Kuchel, G. A., Niedernhofer, L. J., & Palella, F. J. (2022) · JAIDS Journal of Acquired Immune Deficiency Syndromes · doi:10.1097/qai.0000000000002858 · Cited by 32
Advances in cGAS-STING Signaling Pathway and Diseases
Yang, Y., Huang, Y., & Zeng, Z. (2022) · Frontiers in Cell and Developmental Biology · doi:10.3389/fcell.2022.800393 · Cited by 31
Carpintero-Fernández, P., Borghesan, M., Eleftheriadou, O., Pan‐Castillo, B., Fafián‐Labora, J., Mitchell, T. P., Yuste, A., Öğrünç, M., Nightingale, T. D., Mayán, M. D., et al. (2022) · Cell Death and Disease · doi:10.1038/s41419-022-04569-3 · Cited by 30
TDP-43 safeguards the embryo genome from L1 retrotransposition
Li, T. D., Murano, K., Kitano, T., Guo, Y., Negishi, L., & Siomi, H. (2022) · Science Advances · doi:10.1126/sciadv.abq3806 · Cited by 32
A Treg-specific long noncoding RNA maintains immune-metabolic homeostasis in aging liver
Ding, C., Yu, Z., Sefik, E., Zhou, J., Kaffe, E., Wang, G., Li, B., Flavell, R. A., Hu, W., Ye, Y., et al. (2023) · Nature Aging · doi:10.1038/s43587-023-00428-8 · Cited by 29
“Chronic inflammation often develops with aging due to proinflammatory responses directed toward self-antigens in older adults; thus, expanding autologous T reg cells in older adults is an actively sought research area for treating aging-associated diseases 63–65 .”
Denham, J. (2023) · Aging Cell · doi:10.1111/acel.13836 · Cited by 28
“This, in turn, promotes low- grade chronic inflammation via the senescence- associated secretory phenotype (De Cecco et al., 2019; Lasry & Ben- Neriah, 2015) which, in turn, accelerates telomere shortening and biological ageing (Jurk et al., 2014).”
BackgroundAn intronic LINE-1 regulates IFNAR1 expression in human immune cells
Buttler, C. A., Ramirez, D. M. C., Dowell, R. D., & Chuong, E. B. (2023) · Mobile DNA · doi:10.1186/s13100-023-00308-3 · Cited by 29
Targeting DNA damage in ageing: towards supercharging DNA repair
Bujarrabal-Dueso, A., Garinis, G. A., Robbins, P. D., Vijg, J., & Schumacher, B. (2025) · Nature Reviews Drug Discovery · doi:10.1038/s41573-025-01212-6 · Cited by 32
“In addition, induction of the retrotrans-poson LINE-1 transcription occurs in at least some SnCs, leading to an increase in the type 1 interferon response by the cytoplasmic LINE-1 complementary DNA 162,163 .”
Demethylation and derepression of genomic retroelements in the skeletal muscles of aged mice
Min, B., Jeon, K., Park, J. S., & Kang, Y. (2019) · Aging Cell · doi:10.1111/acel.13042 · Cited by 29
“…transcripts and their reverse‐transcribed products in skeletal muscles may trigger an innate immune response and chronic inflammation through inducing IFN‐α and IFN‐β gene expressions, as suggested before (Bourque et al., 2018; De Cecco et al., 2019; Kang, 2018; Simon et al., 2019).”
BackgroundOkuno, K., Cicalese, S. M., Elliott, K. J., Kawai, T., Hashimoto, T. N., & Eguchi, S. (2020) · International Journal of Molecular Sciences · doi:10.3390/ijms21186579 · Cited by 28
“These 6 kb, fully functional retrotransposons can replicate not only themselves and accumulates by age and aging-related diseases, but accumulation of Line1 cDNA triggers strong type I interferon response via activation of cGAS-STING leading to SASP [43].”
BackgroundFOXP3 + regulatory T cells and age‐related diseases
Deng, B., Zhang, W., Zhu, Y., Li, Y., Li, D., & Li, B. (2021) · FEBS Journal · doi:10.1111/febs.15743 · Cited by 31
Wang, J., Zhou, X., Yu, P., Yao, J., Guo, P., Xu, Q., Zhao, Y., Wang, G., Li, Q., Zhu, X., et al. (2025) · Nature Aging · doi:10.1038/s43587-025-00886-2 · Cited by 28
Zhou, Y., Nishiura, A., Morikuni, H., Deng, W., Tsujibayashi, T., Momota, Y., Azetsu, Y., Takami, M., Honda, Y., & Matsumoto, N. (2023) · International Journal of Oral Science · doi:10.1038/s41368-023-00228-1 · Cited by 29
Olan, I., Ando‐Kuri, M., Parry, A., Handa, T., Schoenfelder, S., Fraser, P., Ohkawa, Y., Kimurâ, H., Narita, M., & Narita, M. (2024) · Nature Communications · doi:10.1038/s41467-024-51153-8 · Cited by 31
Chronic Viral Mimicry Induction following p53 Loss Promotes Immune Evasion
Ishak, C. A., Marhon, S. A., Tchrakian, N., Hodgson, A., Yau, H. L., Gonzaga, I. M., Peralta, M., Lungu, I. M., Gomez, S., Liang, S., et al. (2025) · Cancer Discovery · doi:10.1158/2159-8290.cd-24-0094 · Cited by 28
Imai, S. (2025) · npj Aging · doi:10.1038/s41514-025-00192-6 · Cited by 30
Reactivation of retrotransposable elements is associated with environmental stress and ageing
Valle, F. D., Reddy, P., Aguirre-Vázquez, A., & Belmonte, J. C. I. (2025) · Nature Reviews Genetics · doi:10.1038/s41576-025-00829-y · Cited by 27
Wang, H., Yu, Y., Li, R., Zhang, H., Chen, Z., Sun, C., & Zhuang, J. (2025) · Acta Pharmaceutica Sinica B · doi:10.1016/j.apsb.2025.07.022 · Cited by 36
Metformin: Sentinel of the Epigenetic Landscapes That Underlie Cell Fate and Identity
Menéndez, J. A. (2020) · Biomolecules · doi:10.3390/biom10050780 · Cited by 27
Revelations About Aging and Disease from Unconventional Vertebrate Model Organisms
Zhao, Y., Seluanov, A., & Gorbunova, V. A. (2021) · Annual Review of Genetics · doi:10.1146/annurev-genet-071719-021009 · Cited by 29
“Many age-associated factors contribute to inflammaging, including cellular senescence, viral infections, microbiome bacteria, and self-products of cell damage including cytoplasmic nucleic acids (sterile inflammation) (34; 57; 158).”
BackgroundSelf-citationLocus-specific expression analysis of transposable elements
Schwarz, R. J., Koch, P., Wilbrandt, J., & Hoffmann, S. (2021) · Briefings in Bioinformatics · doi:10.1093/bib/bbab417 · Cited by 36
Deciphering RNA m 6 A regulation in aging: Perspectives on current advances and future directions
Wu, Z., Ren, J., & Liu, G. (2023) · Aging Cell · doi:10.1111/acel.13972 · Cited by 25
Repurposing nucleoside reverse transcriptase inhibitors (NRTIs) to slow aging
Brochard, T., McIntyre, R. L., Houtkooper, R. H., Seluanov, A., Gorbunova, V. A., & Janssens, G. E. (2023) · Ageing Research Reviews · doi:10.1016/j.arr.2023.102132 · Cited by 27
Self-citationWang, J., Liu, W., Huang, Y., Wang, G., Guo, X., Shi, D., Sun, T., Xiao, C., Zhang, C., Jiang, B., et al. (2024) · Advanced Science · doi:10.1002/advs.202401862 · Cited by 24
The dual role of cellular senescence in human tumor progression and therapy
Ma, L., Yu, J., Fu, Y., He, X., Ge, S., Jia, R., Zhuang, A., Yang, Z. H., & Fan, X. (2024) · MedComm · doi:10.1002/mco2.695 · Cited by 30
“52 Some studies have reported that a deficiency in brain and muscle ARNT-like protein 1 (BMAL1) causes L1-induced senescence in primate mesenchymal stem cells and mouse models, proving that BMAL1 is a potential heterochromatin stabilizer.”
BackgroundSun, Y., Wang, C., Wen, L., Ling, Z., Xia, J., Cheng, B., & Peng, J. (2024) · International Journal of Molecular Medicine · doi:10.3892/ijmm.2024.5445 · Cited by 28
The Interplay Among HIV, LINE-1, and the Interferon Signaling System
Zhao, X., Zhao, Y., Du, J., Gao, P., & Zhao, K. (2021) · Frontiers in Immunology · doi:10.3389/fimmu.2021.732775 · Cited by 28
Interplay between RNA interference and transposable elements in mammals
Cornec, A., & Poirier, E. Z. (2023) · Frontiers in Immunology · doi:10.3389/fimmu.2023.1212086 · Cited by 29
Counteracting Immunosenescence—Which Therapeutic Strategies Are Promising?
Hieber, C., Grabbe, S., & Bros, M. (2023) · Biomolecules · doi:10.3390/biom13071085 · Cited by 30
Pathological implication of CaMKII in NF-κB pathway and SASP during cardiomyocytes senescence
Li, T., Meng, Y., Ding, P., Wang, H., Liu, J., Xia, C., Chen, Y., & Li, J. (2022) · Mechanisms of Ageing and Development · doi:10.1016/j.mad.2022.111758 · Cited by 26
Advances in understanding LINE-1 regulation and function in the human genome
Li, X., & Liu, N. (2025) · Trends in Genetics · doi:10.1016/j.tig.2025.04.011 · Cited by 34
Chikuma, S., Yamanaka, S., Nakagawa, S., Ueda, M. T., Hayabuchi, H., Tokifuji, Y., Kanayama, M., Okamura, T., Arase, H., & Yoshimura, A. (2021) · The Journal of Immunology · doi:10.4049/jimmunol.2001003 · Cited by 26
Mao, Z., Liu, W., Huang, Y., Sun, T., Bao, K., Feng, J., Moskalev, A., Hu, Z., & Li, J. (2021) · Acta Pharmaceutica Sinica B · doi:10.1016/j.apsb.2021.08.007 · Cited by 27
Vannier, D., Shapeti, A., Chuffart, F., Planus, E., Manet, S., Rivier, P., Destaing, O., Albigès‐Rizo, C., Oosterwyck, H. V., & Faurobert, E. (2021) · Angiogenesis · doi:10.1007/s10456-021-09809-2 · Cited by 27
Cytosolic Self-DNA—A Potential Source of Chronic Inflammation in Aging
Akbari, M., Shanley, D. P., Bohr, V. A., & Rasmussen, L. J. (2021) · Cells · doi:10.3390/cells10123544 · Cited by 25
“Thus, increased cytosolic LINE-1 cDNA may be a source of cGAS-STING activation in senescent cells [86].”
BackgroundInterplay of cGAS with micronuclei: Regulation and diseases
Guo, X., Hintzsche, H., Xu, W., Ni, J., Xue, J., & Wang, X. (2022) · Mutation Research/Reviews in Mutation Research · doi:10.1016/j.mrrev.2022.108440 · Cited by 25
Okamura, K., Sato, M., Suzuki, T., & Nohara, K. (2022) · Toxicology and Applied Pharmacology · doi:10.1016/j.taap.2022.116231 · Cited by 26
Pini, L., Salvalaggio, A., Wennberg, A. M. V., Dimakou, A., Matteoli, M., & Corbetta, M. (2023) · Ageing Research Reviews · doi:10.1016/j.arr.2023.101867 · Cited by 26
Sakai, C., Ueda, K., Goda, K., Fujita, R., Maeda, J., Nakayama, S., Sotomaru, Y., Tashiro, S., Yoshizumi, M., Ishida, T., et al. (2023) · Scientific Reports · doi:10.1038/s41598-023-43848-7 · Cited by 28
Pabis, K., Barardo, D., Sirbu, O., Selvarajoo, K., Gruber, J., & Kennedy, B. K. (2024) · eLife · doi:10.7554/elife.87811.3 · Cited by 25
SAFB restricts contact domain boundaries associated with L1 chimeric transcription
Hong, Y., Bie, L., Zhang, T., Yan, X., Jin, G., Chen, Z., Wang, Y., Li, X., Pei, G., Zhang, Y., et al. (2024) · Molecular Cell · doi:10.1016/j.molcel.2024.03.021 · Cited by 27
Dasgupta, N., Lei, X., Shi, C. H., Arnold, R., Teneche, M. G., Miller, K. N., Rajesh, A., Davis, A. E. M., Anschau, V., Campos, A. R., et al. (2024) · Molecular Cell · doi:10.1016/j.molcel.2024.08.006 · Cited by 27
Stem cell activity-coupled suppression of endogenous retrovirus governs adult tissue regeneration
Lyu, Y., Kim, S., Humphrey, E., Nayak, R., Guan, Y., Liang, Q., Kim, K. H., Tan, Y., Dou, J., Sun, H., et al. (2024) · Cell · doi:10.1016/j.cell.2024.10.007 · Cited by 31
Targeting immunosenescence for improved tumor immunotherapy
Liu, Z., Zuo, L., Zhou, Z., Liu, S., Ba, Y., Zuo, A., Ren, Y., Zhang, C., Chen, Y., Ma, H., et al. (2024) · MedComm · doi:10.1002/mco2.777 · Cited by 24
“193 Such drugs could even diminish IFN-I responses in SIRT6-deficient cells and notably enhance health and lifespan in SIRT6-knockout mice, which grossly exhibit abbreviated lifespans, growth delays, and high type 1 long interspersed nuclear element activities.”
BackgroundSepúlveda, H., Li, X., Arteaga-Vazquez, L. J., López-Moyado, I. F., Brunelli, M., Hernández-Espinosa, L., Yue, X., Angel, J. C., Brown, C., Dong, Z., et al. (2025) · Nature Structural & Molecular Biology · doi:10.1038/s41594-025-01505-9 · Cited by 28
“Cancer cells 77–79 , cells undergoing replicative senescence 80,81 and cells from aged individuals 82 display large partially methylated domains, in which DNA hypomethylation occurs across megabase-sized regions corresponding to heterochromatin.”
cGAS, an innate dsDNA sensor with multifaceted functions
Liu, Y., & Xu, P. (2025) · Cell Insight · doi:10.1016/j.cellin.2025.100249 · Cited by 26
Adney, E. M., Ochmann, M. T., Sil, S., Truong, D. M., Mita, P., Wang, X., Kahler, D. J., Fenyö, D., Holt, L. J., & Boeke, J. D. (2019) · Genetics · doi:10.1534/genetics.119.302601 · Cited by 27
Self-citationRetroelement-derived RNA and its role in the brain
Evans, T. A., & Erwin, J. A. (2020) · Seminars in Cell and Developmental Biology · doi:10.1016/j.semcdb.2020.11.001 · Cited by 25
Li, M., Zhao, J., Tang, Q., Zhang, Q., Wang, Y., Zhang, J., Hao, Y., Bai, X., & Lu, Z. (2021) · Journal of Cellular and Molecular Medicine · doi:10.1111/jcmm.16811 · Cited by 24
Cytoplasmic DNA in cancer cells: Several pathways that potentially limit DNase2 and TREX1 activities
Anindya, R. (2022) · Biochimica et Biophysica Acta (BBA) - Molecular Cell Research · doi:10.1016/j.bbamcr.2022.119278 · Cited by 24
Deciphering aging at three-dimensional genomic resolution
Liu, Z., Belmonte, J. C. I., Zhang, W., Qu, J. T., & Liu, G. (2022) · Cell Insight · doi:10.1016/j.cellin.2022.100034 · Cited by 24
Telomere Maintenance and the cGAS-STING Pathway in Cancer
Ebata, H., Loo, T. M., & Takahashi, A. (2022) · Cells · doi:10.3390/cells11121958 · Cited by 25
Senescence: An Identity Crisis Originating from Deep Within the Nucleus
Olan, I., & Narita, M. (2022) · Annual Review of Cell and Developmental Biology · doi:10.1146/annurev-cellbio-120420-013537 · Cited by 25
Senescent AECⅡ and the implication for idiopathic pulmonary fibrosis treatment
Zhang, T., Zhang, J., Lv, C., Li, H., & Song, X. (2022) · Frontiers in Pharmacology · doi:10.3389/fphar.2022.1059434 · Cited by 25
“SASP affects its surrounding non-senescent cells through autocrine and paracrine functions and mediate the exacerbation of cellular senescence (De Cecco et al., 2019).”
BackgroundRamini, D., Latini, S., Giuliani, A., Matacchione, G., Sabbatinelli, J., Mensa’, E., Bacalini, M. G., Garagnani, P., Rippo, M. R., Bronte, G., et al. (2022) · Cells · doi:10.3390/cells11233799 · Cited by 26
DNA Break-Induced Epigenetic Drift as a Cause of Mammalian AgingPreprint
Hayano, M., Yang, J.-H., Bonkowski, M. S., Amorim, J. A., Ross, J. M., Coppotelli, G., Griffin, P. T., Chew, Y. C., Guo, W., Yang, X., et al. (2019) · bioRxiv (Cold Spring Harbor Laboratory) · doi:10.1101/808659 · Cited by 24
“Loss of silencing at repetitive elements and retrotransposons is also a conserved feature of aging and a potential driver of inflammation (De Cecco et al., 2019; Oberdoerffer et al., 2008) and this was also seen in the skeletal muscle of ICE mice compared to Cre controls (Figure 5N, S5E and S5F).”
BackgroundResultSelf-citationSugawara, S., Okada, R., Loo, T. M., Tanaka, H., Miyata, K., Chiba, M., Kawasaki, H., Katoh, K., Kaji, S., Maezawa, Y., et al. (2022) · Communications Biology · doi:10.1038/s42003-022-04369-7 · Cited by 23
Ji, P., Wang, C., Liu, Y., Guo, X., Liang, Y., Wei, J., Liu, Z., Gong, L., Yang, G., & Ji, G. (2024) · Advanced Healthcare Materials · doi:10.1002/adhm.202400945 · Cited by 24
LINE-1 transposable element renaissance in aging and age-related diseases
Li, X., Yu, H., Li, D., & Liu, N. (2024) · Ageing Research Reviews · doi:10.1016/j.arr.2024.102440 · Cited by 23
Transposable element 5mC methylation state of blood cells predicts age and disease
Morandini, F., Lu, J. Y., Rechsteiner, C., Shadyab, A. H., Casanova, R., Snively, B. M., Seluanov, A., & Gorbunova, V. A. (2024) · Nature Aging · doi:10.1038/s43587-024-00757-2 · Cited by 28
“It has also been observed that inflammation in senescent cells is in part driven by L1 and ERV expression 18,60 .”
Self-citationSMARCA4 regulates the NK-mediated killing of senescent cells
Reen, V., D’Ambrosio, M., Søgaard, P. P., Tyson, K., Leeke, B. J., Clément, I., Dye, I. C., Pombo, J., Kuba, A., Lan, Y., et al. (2025) · Science Advances · doi:10.1126/sciadv.adn2811 · Cited by 26
STING in cancer immunoediting: Modeling tumor-immune dynamics throughout cancer development
Zhang, X., Chen, Y., Liu, X., Li, G., Zhang, S., Zhang, Q., Cui, Z., Qin, M., Simon, H., Terzić, J., et al. (2025) · Cancer Letters · doi:10.1016/j.canlet.2024.217410 · Cited by 28
Ribosomal DNA instability: An evolutionary conserved fuel for inflammaging
Storci, G., Bacalini, M. G., Bonifazi, F., Garagnani, P., Carolis, S. D., Salvioli, S., Olivieri, F., & Bonafè, M. (2020) · Ageing Research Reviews · doi:10.1016/j.arr.2020.101018 · Cited by 24
Non‐canonical ATM/MRN activities temporally define the senescence secretory program
Malaquin, N., Carrier-Leclerc, A., Martinez, A., Dessureault, M., Ghadaouia, S., Coppé, J., Nadeau, S., Cardin, G., Campisi, J., & Rodier, F. (2020) · EMBO Reports · doi:10.15252/embr.202050718 · Cited by 25
“…the link between DNA damage and senescence, TREX1-, PARP-, GATA4-, p38MAPK, or cGAS/STING-related damage responses have been linked to both SAPA and SASP (Freund et al , 2011; Ohanna et al , 2011; Kang et al , 2015; Dou et al , 2017; Ito et al , 2018; Takahashi et al , 2018; De Cecco et al , 2019).”
Rigal, J., Anduaga, A. M., Bitman, E., Rivellese, E., Kadener, S., & Marr, M. T. (2022) · eLife · doi:10.7554/elife.80169 · Cited by 21
Shan, B., Hou, H., Zhang, K., Li, R., Shen, C., Chen, Z., Xu, P., Cui, R., Su, Z., Zhang, C., et al. (2023) · Journal of Medicinal Chemistry · doi:10.1021/acs.jmedchem.2c01714 · Cited by 30
Transposable elements regulate thymus development and function
Larouche, J., Laumont, C. M., Trofimov, A., Vincent, K., Hesnard, L., Brochu, S., Côté, C., Humeau, J., Bonneil, É., Lanoix, J., et al. (2023) · eLife · doi:10.7554/elife.91037 · Cited by 26
Long interspersed nuclear elements safeguard neural progenitors from precocious differentiation
Toda, T., Bedrosian, T. A., Schafer, S. T., Cuoco, M. S., Linker, S. B., Ghassemzadeh, S., Mitchell, L. E., Whiteley, J. T., Novaresi, N., McDonald, A. H., et al. (2024) · Cell Reports · doi:10.1016/j.celrep.2024.113774 · Cited by 23
Senapati, P., Miyano, M., Sayaman, R. W., Basam, M., Leung, A., LaBarge, M. A., & Schones, D. E. (2023) · Genome Research · doi:10.1101/gr.277511.122 · Cited by 22
Research progress on interferon and cellular senescence
Wang, D., Chen, K., Wang, Z., Wu, H., & Li, Y. (2024) · The FASEB Journal · doi:10.1096/fj.202400808rr · Cited by 23
Vukić, D., Cherian, A., Keskitalo, S., Bong, Y. T., Marônek, M., Yadav, L., Keegan, L. P., Varjosalo, M. T., & O’Connell, M. A. (2024) · Nucleic Acids Research · doi:10.1093/nar/gkae1106 · Cited by 24
Transposable elements as instructors of the immune system
Schmidleithner, L., Stüve, P., & Feuerer, M. (2025) · Nature reviews. Immunology · doi:10.1038/s41577-025-01172-3 · Cited by 35
“…to increased type I interferon (IFN) activation via the cGAS–stimulator of interferon genes (STING) pathway, which can be alleviated by administration of a reverse transcriptase inhibitor, leading to speculation that LINE-1 expression may be involved in age-related sterile inflammation 45,53 .”
Ilik, İ., Xu, Y., Zhang, Z. Z., & Aktaş, T. (2025) · Nature Reviews Molecular Cell Biology · doi:10.1038/s41580-025-00867-8 · Cited by 30
Xin, Y., Yuan, Z., Wang, J., & Li, S. (2025) · The FASEB Journal · doi:10.1096/fj.202500244rrr · Cited by 28
Rostami, M. R., & Bradić, M. (2021) · Mobile DNA · doi:10.1186/s13100-021-00241-3 · Cited by 22
Modulation of Oxidative Stress-Induced Senescence during Non-Alcoholic Fatty Liver Disease
Pedroza-Díaz, J., Arroyave-Ospina, J. C., Salas, S. S., & Moshage, H. J. (2022) · Antioxidants · doi:10.3390/antiox11050975 · Cited by 27
Restructuring of Lamina-Associated Domains in Senescence and Cancer
Bellanger, A., Madsen‐Østerbye, J., Galigniana, N. M., & Collas, P. (2022) · Cells · doi:10.3390/cells11111846 · Cited by 23
Pabis, K., Barardo, D., Sirbu, O., Selvarajoo, K., Gruber, J., & Kennedy, B. K. (2023) · eLife · doi:10.7554/elife.87811 · Cited by 43
Bona, N., & Crossan, G. P. (2023) · Nature Structural & Molecular Biology · doi:10.1038/s41594-023-01067-8 · Cited by 23
“The activation of LINE-1 can induce cGAS-STING signaling 66 .”
BackgroundErwin, A. A., & Blumenstiel, J. P. (2019) · BMC Genomics · doi:10.1186/s12864-019-5668-3 · Cited by 22
Long INterspersed element‐1 mobility as a sensor of environmental stresses
Re, B. D., & Giorgi, G. (2020) · Environmental and Molecular Mutagenesis · doi:10.1002/em.22366 · Cited by 25
“…of L1 activity, both in various types of cancer cells (Iskow et al., 2010; Lee et al., 2012; Tubio et al., 2014) and in aging/senescent cells (De Cecco et al., 2013, 2013, 2019); (2) the finding that healthy somatic cells can become permissive to L1 activity during certain developmental…”
BackgroundLinker, S. B., Randolph‐Moore, L., Kottilil, K., Qiu, F., Jaeger, B. N., Barron, J. J., & Gage, F. H. (2020) · Genome Research · doi:10.1101/gr.262196.120 · Cited by 23
“This finding is intriguing in light of work linking L1 transcription and inflammation (Thomas et al. 2017; De Cecco et al. 2019).”
BackgroundThe context-dependent effect of cellular senescence: From embryogenesis and wound healing to aging
Lavarti, R., Alvarez-Diaz, T., Marti, K., Kar, P., & Raju, R. P. (2025) · Ageing Research Reviews · doi:10.1016/j.arr.2025.102760 · Cited by 21
Clinical response to azacitidine in MDS is associated with distinct DNA methylation changes in HSPCs
Thoms, J. A. I., Yan, F., Hampton, H. R., Davidson, S., Joshi, S. M., Saw, J., Sarowar, C. H., Lim, X. Y., Nunez, A. C., Kakadia, P. M., et al. (2025) · Nature Communications · doi:10.1038/s41467-025-59796-x · Cited by 25
Metabolic regulation of immunological aging
Kim, H., & Dixit, V. D. (2025) · Nature Aging · doi:10.1038/s43587-025-00921-2 · Cited by 30
Animal models of leukodystrophy: a new perspective for the development of therapies
Rutherford, H. A., & Hamilton, N. (2019) · FEBS Journal · doi:10.1111/febs.15060 · Cited by 22
Nassir, C. M. N. C. M., Damodaran, T. K., Yusof, S. R., Norazit, A., Chilla, G. S. V. N., Huen, I., Nagaraja, B. P. K., Ibrahim, N. M., & Mustapha, M. (2021) · Pharmaceutics · doi:10.3390/pharmaceutics13081207 · Cited by 22
Novototskaya-Vlasova, K. A., Neznanov, N., Molodtsov, I. A., Hall, B. M., Commane, M., Gleiberman, A. S., Murray, J. E., Haber, M., Norris, M. D., Leonova, K. I., et al. (2022) · Proceedings of the National Academy of Sciences · doi:10.1073/pnas.2213146119 · Cited by 22
McIntyre, R. L., Molenaars, M., Schomakers, B. V., Gao, A. W., Kamble, R., Jongejan, A., van Weeghel, M., Kuilenburg, A. B. P., Possemato, R., Houtkooper, R. H., et al. (2022) · Cell Reports · doi:10.1016/j.celrep.2022.111928 · Cited by 20
Yan, S., Si, Y., Zhou, W., Cheng, R., Wang, P., Wang, D., Ding, W., Shi, W., Jiang, Q., Yang, F., et al. (2023) · Computers in Biology and Medicine · doi:10.1016/j.compbiomed.2023.106801 · Cited by 24
Expression of retrotransposons contributes to aging in Drosophila
Schneider, B. K., Sun, S., Lee, M., Li, W., Skvir, N. J., Neretti, N., Vijg, J., & Secombe, J. (2023) · Genetics · doi:10.1093/genetics/iyad073 · Cited by 21
Self-citationThe transcription factor PAX5 activates human LINE1 retrotransposons to induce cellular senescence
Tang, H., Yang, J., Xu, J., Zhang, W., Geng, A., Jiang, Y., & Mao, Z. (2024) · EMBO Reports · doi:10.1038/s44319-024-00176-9 · Cited by 22
Pfaff, A. L., Lopez, A. I., Iacoangeli, A., Bubb, V. J., Smith, B. N., Troakes, C., Alahmady, N. F., Kõks, S., Schumann, G. G., Al‐Chalabi, A., et al. (2020) · Molecular Brain · doi:10.1186/s13041-020-00694-2 · Cited by 21
So, E. Y., Jeong, E.-M., Wu, K. Q., Dubielecka, P. M., Reginato, A. M., Quesenberry, P. J., & Liang, O. D. (2020) · Aging · doi:10.18632/aging.202167 · Cited by 21
Wang, X., Honda, Y., Zhao, J., Morikuni, H., Nishiura, A., Hashimoto, Y., & Matsumoto, N. (2021) · International Journal of Molecular Sciences · doi:10.3390/ijms222212415 · Cited by 22
Marchetti, B., Giachino, C., Tirolo, C., & Serapide, M. F. (2022) · Aging Cell · doi:10.1111/acel.13575 · Cited by 22
Metadata
- Authors
- De Cecco, M., Ito, T., Petrashen, A. P., Elias, A. E., Skvir, N. J., Criscione, S. W., Caligiana, A., Brocculi, G., Adney, E. M., Boeke, J. D., Le, O., Beauséjour, C., Ambati, J., Ambati, K., Simon, M., Seluanov, A., Gorbunova, V., Slagboom, P. E., Helfand, S. L., Neretti, N., & Sedivy, J. M.
- Affiliations
- Brown University (US)
- Johns Hopkins University (US)
- NYU Langone Health (US)
- University of Virginia (US)
- University of Rochester (US)
- Leiden University Medical Center (NL)
- Corresponding author
- Sedivy, John M.
- ORCID
- Venue
- Nature
- Published
- 2019-02-06
- Volume
- 566
- Issue
- 7742
- Pages
- 73-78
- ISSN
- 0028-0836 (ISSN-L)
- 1476-4687
- PMC
- PMC6519963
- OpenAlex
- W2911642321
- Cited by
- 1,255
- References
- 70
- Citations by year
- 2026: 162 · 2025: 228 · 2024: 203 · 2023: 179 · 2022: 145 · 2021: 141 · 2020: 129 · 2019: 67
- FWCI
- 82.35
- Type
- journal article
- Language
- en
- Update notices
- correction (2019-07-12)
- Open access
- green
- www.ncbi.nlm.nih.gov
- Licence
- Locations
- Nature (publishedVersion)
- PubMed (publishedVersion)
- Europe PMC (PubMed Central) (acceptedVersion)
- PubMed Central (acceptedVersion)
- Data Archiving and Networked Services (DANS) (submittedVersion)
- RePEc: Research Papers in Economics (submittedVersion)
- Leiden Repository (Leiden University) (submittedVersion)
- Archivio istituzionale della ricerca (Alma Mater Studiorum Università di Bologna) (submittedVersion)
- Funders
- National Institutes of Health (R01 AG047200)
- National Institute on Aging (F31AG050365, R01AG046320, R01AG024353, R01AG027237, R37AG016694, F31AG043189, R01AG016694, R01AG050582, R37AG016667, T32AG041688, P01AG047200, R37AG046320, P01AG051449)
- National Eye Institute (R01EY028027, R01EY029799, R01EY024068, R01EY022238)
- National Institute of General Medical Sciences (DP1GM114862, P20GM119943, P20GM109035)
- National Institute of Allergy and Infectious Diseases (P30AI050410)
- Topics
- Life Sciences › Biochemistry, Genetics and Molecular Biology › Cell Biology › Telomeres, Telomerase, and Senescence
- Life Sciences › Biochemistry, Genetics and Molecular Biology › Aging › Genetics, Aging, and Longevity in Model Organisms
- Life Sciences › Immunology and Microbiology › Immunology › interferon and immune responses
- Keywords
- LINE-1 retrotransposons, cellular senescence, type I interferon response, inflammaging, sterile inflammation, senescence-associated secretory phenotype, lamivudine, age-related diseases
- MeSH terms
- Aging, Animals, Female, Fibroblasts, Humans, Inflammation, Interferon Type I, Male, Phenotype, RNA-Directed DNA Polymerase, Down-Regulation, Cellular Senescence, Reverse Transcriptase Inhibitors, Lamivudine, Long Interspersed Nucleotide Elements, Mice
About these checks
Registry, retraction, Cites and statistics results are computed, not judged, with one exception: a printed reference that no index lists is read once by a model before it counts as a citation error. Claims are extracted by a model and kept only when their quote appears verbatim in the text; each cited source is then checked, with a model’s help, for whether it says what the claim relies on. Those verdicts can be wrong — read the claim’s quote and the cited source before relying on one.
A language model drew the claims from the paper on 2026-10-20, under version 3 of the claim definition (model deepseek-v4.1-flash, prompt extract-v3).
A second model labelled each claim on 2026-10-20 (model jev-1.13-20260917, definition revision gold-guideline-v0.2).
Cited sources are checked with a language model’s help (gpt-6-sol).
Statistics and arithmetic are recomputed, not judged.
Confidence bands are shown only for fields calibrated on our annotated test set. None is calibrated yet, so no band is shown.
What counts as a claim ›How we measure confidence ›How we check this ›
Are you an author, or do you see a problem with this page? Request a review
