L1 drives IFN in senescent cells and promotes age-associated inflammation

De Cecco, Marco; Ito, Takahiro; Petrashen, Anna P.; Elias, Amy E.; Skvir, Nicholas J.; Criscione, Steven W.; Caligiana, Alberto; Brocculi, Greta; Adney, Emily M.; Boeke, Jef D.; Le, Oanh; Beauséjour, Christian; Ambati, Jayakrishna; Ambati, Kameshwari; Simon, Matthew; Seluanov, Andrei; Gorbunova, Vera; Slagboom, P. Eline; Helfand, Stephen L.; Neretti, Nicola; Sedivy, John M.

doi:10.1038/s41586-018-0784-9

Cited by 1,258Telomeres, Telomerase, and SenescenceGenetics, Aging, and Longevity in Model Organismsinterferon and immune responses

L1 drives IFN in senescent cells and promotes age-associated inflammation

Open access

De Cecco, Marco, Ito, Takahiro, Petrashen, Anna P., Elias, Amy E., Skvir, Nicholas J., Criscione, Steven W., Caligiana, Alberto, Brocculi, Greta +13 more·2019·Nature

DOI 10.1038/s41586-018-0784-9PMC PMC6519963

Open this paper in CoChat — free account

Abstract

Retrotransposable elements are deleterious at many levels, and the failure of host surveillance systems for these elements can thus have negative consequences. However, the contribution of retrotransposon activity to ageing and age-associated diseases is not known. Here we show that during cellular senescence, L1 (also known as LINE-1) retrotransposable elements become transcriptionally derepressed and activate a type-I interferon (IFN-I) response. The IFN-I response is a phenotype of late senescence and contributes to the maintenance of the senescence-associated secretory phenotype. The IFN-I response is triggered by cytoplasmic L1 cDNA, and is antagonized by inhibitors of the L1 reverse transcriptase. Treatment of aged mice with the nucleoside reverse transcriptase inhibitor lamivudine downregulated IFN-I activation and age-associated inflammation (inflammaging) in several tissues. We propose that the activation of retrotransposons is an important component of sterile inflammation that is a hallmark of ageing, and that L1 reverse transcriptase is a relevant target for the treatment of age-associated disorders.

Integrity signals

Registry

Crossref · 10.1038/s41586-018-0784-9

Cites

68 of 68 references verified0 citation errors · 0 not checkable

Statistics

Nothing to recompute.

Claims the paper makes

14 of 16 cited sources checked · 12 supported · 0 flagged · accuracy not yet measured

Premisecitation
L1 elements can stimulate an IFN-I response.
“L1 elements can stimulate an IFN-I response9.”
Quote in the paperSubstantial claim1 of 1 sources checked
- cites [9] Volkman, H. E. & Stetson, D. B. The enemy within: endogenous retroelements and autoimmune disease. Nat. Immunol. 15, 415–422 (2014). source
Premisecitation
pWA355 contains a functional, active L1RP element.
“pWA355 contains a functional, active L1RP element, whereas pWA366 contains L1RP(JM111), a mutated element carrying two missense mutations in ORF1 that is unable to retrotranspose.”
Quote in the paperSubstantial claim1 of 1 sources checked
- cites Xie et al. (2011)52 source
Findingown data
The IFN-I response is antagonized by NRTIs that inhibit L1 reverse transcriptase.
“The IFN-I response is triggered by cytoplasmic L1 cDNA, and is antagonized by nucleoside reverse transcriptase inhibitors (NRTIs) that inhibit the L1 reverse transcriptase (RT).”
- Also stated in: § Consequences of L1 activation · plain
  “L1 knockdown with shRNA or treatment of cells with 3TC significantly reduced interferon levels, as well as reducing the IFN-I response more broadly in both late senescent and 3X cells (Fig. 3b, Extended Data Fig. 7a).”
Quote in the paperSubstantial claim
Findingown data
A triple intervention of RB1 and TREX1 knockdowns combined with FOXA1 overexpression (3X) resulted in a massive induction of L1 and IFN-I expression.
“While some of these effects were statistically significant, they were dwarfed by a triple intervention of RB1 and TREX1 104knockdowns combined with FOXA1 overexpression (3X), which resulted in a massive induction of L1 and IFN-I expression (Fig. 2f, Extended Data Fig. 4g-i and 5c).”
Quote in the paperSubstantial claim
Findingown data
Treatment of aged mice with lamivudine downregulated IFN-I activation and age-associated inflammation in several tissues.
“Treatment of aged mice with the NRTI lamivudine downregulated IFN-I activation and age-associated inflammation in several tissues.”
- Also stated in: § Activation of L1 in human and mouse tissues · plain
  “We treated old animals (26 months) for two-weeks with 3TC (administered in water at human therapeutic doses) and found a broad and significant downregulation the IFN-I response and alleviation of the SASP pro-inflammatory state (Fig. 4c, for the full dataset see Extended Data Fig. 9 and Supplementary Table 7).”
Quote in the paperSubstantial claim

Findingown data
A large component of IFN-I changes is specific for late senescence.
“Note that the majority of changes in SASP genes occur early, whereas a large component of IFN-I changes is specific for late senescence.”
Quote in the paperNot a substantial claim
Findingown data
The transcriptome evolves considerably in late senescence, exemplified by large changes (especially upregulated) in differentially expressed genes as well as pathways.
“Note the considerable evolution the transcriptome in late senescence, exemplified by large changes (especially upregulated) in differentially expressed genes as well as pathways.”
Quote in the paperNot a substantial claim
Findingown data
Of 96 total clones examined, 37 mapped to L1.
“Of the 96 total clones examined 37 mapped to L1.”
Quote in the paperSubstantial claim
Findingown data
Loss of Lamin B1 colocalized with IL-6 in white adipose of 5- and 26-month-old male mice.
“In (a) loss of Lamin B1 (senescence marker) was colocalized with IL-6 (SASP marker).”
Quote in the paperSubstantial claim
Findingown data
Full length L1 mRNA is expressed in all forms of senescence.
“Confirmation of full length L1 mRNA expression in all forms of senescence using RT-qPCR with primers for amplicons A and F on poly(A)-purified RNA.”
Quote in the paperSubstantial claim
Findingown data
The majority of changes in SASP genes occur early.
“Note that the majority of changes in SASP genes occur early, whereas a large component of IFN-I changes is specific for late senescence.”
Quote in the paperNot a substantial claim
Findingown data
L1 mRNA was progressively upregulated with age in several tissues of mice.
“We next examined mice and found that L1 mRNA was progressively upregulated with age in several tissues (Extended Data Fig. 10g).”
Quote in the paperSubstantial claim
Findingown data
IFN-I is significantly upregulated between early and late senescence.
“Note the significant upregulation of IFN-I between early and late senescence.”
Quote in the paperSubstantial claim
Findingown data
pStat1 colocalized with Orf1 in white adipose of 5- and 26-month-old male mice.
“In (b) pStat1 (IFN-I marker) was colocalized with Orf1 (L1 marker).”
Quote in the paperSubstantial claim
Findingown data
L1 activation is late onset in OIS and SIPS.
“Late onset activation is shown by comparing days 9 and 20 for OIS and days 12 and 30 for SIPS.”
Quote in the paperNot a substantial claim
Findingown data
67 genes significantly changed expression in SEN and/or 3X cells.
“Heat map representation showing all biological replicates for the 67 genes significantly changing expression in SEN and/or 3X cells (Fig. 2h, Supplementary Table 6).”
Quote in the paperSubstantial claim
Interpretationown data
In normal healthy cells all three effectors (RB1, FOXA1, TREX1) have to be compromised to effectively unleash L1.
“Hence, in normal healthy cells all three effectors have to be compromised to effectively unleash L1.”
Quote in the paperSubstantial claim
Interpretationown data
The IFN-I response contributes to the maintenance of the senescence-associated secretory phenotype (SASP).
“The IFN-I response is a novel phenotype of late senescence and contributes to the maintenance of the senescence associated secretory phenotype (SASP).”
- Also stated in: § Consequences of L1 activation · plain
  “Hence, while L1 activation and the ensuing IFN-I response are relatively late in onset, they contribute importantly to the mature SASP and proinflammatory phenotype of senescent cells.”
Quote in the paperSubstantial claim
Interpretationown data
The IFN-I response is triggered by cytoplasmic L1 cDNA.
“The IFN-I response is triggered by cytoplasmic L1 cDNA, and is antagonized by nucleoside reverse transcriptase inhibitors (NRTIs) that inhibit the L1 reverse transcriptase (RT).”
- Also stated in: § Consequences of L1 activation · hedged
  “3TC did not affect L1 transcript levels (Extended Data Fig. 5i), suggesting that the INF-I response is triggered by L1 cDNA.”
Quote in the paperSubstantial claim
Interpretationreasoning
L1 RT is a relevant target for the treatment of age-associated disorders.
“We propose that RTE activation is an important component of sterile inflammation that is a hallmark of aging, and that L1 RT is a relevant target for the treatment of age-associated disorders.”
- Also stated in: § Activation of L1 in human and mouse tissues · plain
  “We propose that activation of L1 elements (and possibly other RTEs in the mouse) promotes inflammaging, and that the L1 RT is a relevant target for the development of drugs to treat age-associated disorders.”
Quote in the paperNot a substantial claim
Interpretationown data
RTE activation is an important component of sterile inflammation that is a hallmark of aging.
“We propose that RTE activation is an important component of sterile inflammation that is a hallmark of aging, and that L1 RT is a relevant target for the treatment of age-associated disorders.”
- Also stated in: § Activation of L1 in human and mouse tissues · hedged
  “We propose that activation of L1 elements (and possibly other RTEs in the mouse) promotes inflammaging, and that the L1 RT is a relevant target for the development of drugs to treat age-associated disorders.”
Quote in the paperSubstantial claim
Interpretationown data
The IFN-I response is a novel phenotype of late senescence.
“The IFN-I response is a novel phenotype of late senescence and contributes to the maintenance of the senescence associated secretory phenotype (SASP).”
- Also stated in: § Activation of L1 in human and mouse tissues · plain
  “The activation of endogenous L1 elements and the ensuing robust activation of an IFN-I response is a novel phenotype of senescent cells, including naturally occurring senescent cells in tissues.”
Quote in the paperSubstantial claim
Interpretationown data
The effect of 3TC on the IFN-I pathway requires RT inhibition.
“Hence, the effect of 3TC on the IFN-I pathway requires RT inhibition.”
Quote in the paperSubstantial claim
Study design and conductown data
CRISPR-mediated inactivation of IFNAR1 and IFNAR2 downregulated interferon signaling, verified by absence of IRF9 nuclear translocation and STAT2 phosphorylation in response to interferon stimulation.
“Downregulation of interferon signaling after CRISPR-mediated inactivation of IFNAR1 and IFNAR2 genes was verified by the absence of IRF9 nuclear translocation and STAT2 phosphorylation in response to interferon stimulation.”
Quote in the paperSubstantial claim

Classified as probably not a substantial claim. 36
May combine two claims. 19

Probably not a substantial claim: may not pass S3 (load-bearing).
Premisecitation
NRTIs developed against HIV inhibit L1 RT activity.
“Some NRTIs developed against HIV have been found to also inhibit L1 RT activity15.”
Quote in the paperNot a substantial claim1 of 1 sources checked
- cites [15] Dai, L., Huang, Q. & Boeke, J. D. Effect of reverse transcriptase inhibitors on LINE-1 and Ty1 reverse transcriptase activities and on LINE-1 retrotransposition. BMC Biochem. 12, 18 (2011). source
May combine two claims.
Findingown data
Knockdown of the cytosolic DNA sensing pathway components cGAS or STING inhibited the IFN-I response in both late senescent and 3X cells, and also downregulated the SASP response in late senescent cells.
“As this model would predict, knockdown of the cytosolic DNA sensing pathway components cGAS or STING17 inhibited the IFN-I response in both late senescent and 3X cells (Extended Data Fig. 5l and Fig. 7c, d), and also downregulated the SASP response in late senescent cells (Extended Data Fig. 7e).”
Quote in the paperSubstantial claim1 of 1 sources checked
- cites [17] Dhanwani, R., Takahashi, M. & Sharma, S. Cytosolic sensing of immuno-stimulatory DNA, the enemy within. Curr. Opin. Immunol. 50, 82–87 (2018). source
Probably not a substantial claim: may not pass S3 (load-bearing). May combine two claims.
Premisecitation
The initiation of L1 transcription is imprecise, with the majority of start sites occurring +/−50 bp of the consensus start site, and a subset as far down as +180 bp.
“The initiation of L1 transcription is known to be imprecise, with the majority of start sites occurring +/−50 bp of the consensus start site, and a subset as far down as +180 bp68.”
Quote in the paperNot a substantial claim1 of 1 sources checked
- cites [68] Rangwala, S. H., Zhang, L. & Kazazian, H. H., Jr. Many LINE1 elements contribute to the transcriptome of human somatic cells. Genome Biol. 10, R100 (2009). source
  The Results section on L1 expression tags reports variable 5′ start sites, with 50% (170) within ±50 nucleotides of the consensus start—not a majority. The Results and Discussion describe other starts more than 100 nucleotides upstream, but do not establish a subset starting at +180 bp. The paper’s 182-nucleotide figure concerns transcript termination beyond the 3′ end, not initiation. (LLM, conf=0.88)
  Experimental — accuracy not yet measured
Probably not a substantial claim: may not pass S3 (load-bearing).
Premisecitation
The binding of YY1 to the L1 promoter has been documented.
“The binding of YY1 to the L1 promoter has been documented69 and was used as a positive control.”
Quote in the paperNot a substantial claim1 of 1 sources checked
- cites [69] Athanikar, J. N., Badge, R. M. & Moran, J. V. A. A YY1-binding site is required for accurate human LINE-1 transcription initiation. Nucleic Acids Res. 32, 3846–3855 (2004). source
Classified as probably not a substantial claim.
Interpretationown data
NRTIs can be categorized as "senostatic" agents, to contrast them from "senolytic" treatments that remove senescent cells from tissues.
“Hence, NRTIs can be categorized as “senostatic” agents, to contrast them from “senolytic” treatments that remove senescent cells from tissues21,22.”
Quote in the paperSubstantial claim2 of 2 sources checked
- cites [21] Chang, J. et al. Clearance of senescent cells by ABT263 rejuvenates aged hematopoietic stem cells in mice. Nat. Med. 22, 78–83 (2016). source
- cites [22] Zhu, Y. et al. The Achilles’ heel of senescent cells: from transcriptome to senolytic drugs. Aging Cell 14, 644–658 (2015). source
Classified as probably not a substantial claim. May combine two claims.
Premisecitation
pWA366 contains L1RP(JM111), a mutated element carrying two missense mutations in ORF1 that is unable to retrotranspose.
“pWA355 contains a functional, active L1RP element, whereas pWA366 contains L1RP(JM111), a mutated element carrying two missense mutations in ORF1 that is unable to retrotranspose.”
Quote in the paperSubstantial claim1 of 1 sources checked
- cites Xie et al. (2011)52 source
May combine two claims.
Findingown data
Longer term treatments (from 20 to 26 months of age) with 3TC were effective at opposing several known phenotypes of aging: macrophage infiltration of tissues, glomerulosclerosis of the kidney and skeletal muscle atrophy.
“Longer term treatments (from 20 to 26 months of age) were effective at opposing several known phenotypes of aging: macrophage infiltration of tissues, a hallmark of chronic inflammation23,25, glomerulosclerosis of the kidney26 and skeletal muscle atrophy27 (Fig. 4e).”
Quote in the paperSubstantial claim4 of 4 sources checked
- cites [23] Tchkonia, T. et al. Fat tissue, aging, and cellular senescence. Aging Cell 9, 667–684 (2010). source
- cites [25] Frasca, D. & Blomberg, B. B. Inflammaging decreases adaptive and innate immune responses in mice and humans. Biogerontology 17, 7–19 (2016). source
- cites [26] Baker, D. J. et al. Naturally occurring p16Ink4a-positive cells shorten healthy lifespan. Nature 530, 184–189 (2016). source
- cites [27] Baker, D. J. et al. Clearance of p16Ink4a-positive senescent cells delays ageing-associated disorders. Nature 479, 232–236 (2011). source
  Citation 26 is attached to glomerulosclerosis of the kidney. Our copy’s account of late-life treatment reports effects in skeletal muscle and fat, but does not address glomerulosclerosis (main text, Fig. 4 discussion; page unavailable). Searches for glomerulosclerosis, kidney, 3TC, and treatment at 20–26 months found no supporting passage. (LLM, conf=0.75)
  Experimental — accuracy not yet measured
Probably not a substantial claim: may not pass S3 (load-bearing). May combine two claims.
Study design and conductcitation
The absolute average retrotransposition frequency for pLD143 was 4.1%, matching published values.
“The absolute average retrotransposition frequency (percentage of GFP-positive cells) was 4.1, which matches the published values for the reporter used (pLD143)53.”
Quote in the paperNot a substantial claim1 of 1 sources checked
- cites [53] An, W. et al. Characterization of a synthetic human LINE-1 retrotransposon ORFeus-Hs. Mob. DNA 2, 2 (2011). source
May combine two claims.
Findingown data
The expression of RB1, FOXA1 and TREX1 changes during senescence, and these changes are both sufficient and necessary to allow the transcriptional activation of L1s.
“We show that the expression of three regulators, RB1, FOXA1 and TREX1 changes during senescence, and that these changes are both sufficient and necessary to allow the transcriptional activation of L1s (Fig. 4g).”
Quote in the paperSubstantial claim
May combine two claims.
Findingown data
During cellular senescence, LINE-1 elements become transcriptionally derepressed and activate a type-I interferon response.
“Here we show that during cellular senescence LINE-1 elements (L1s) become transcriptionally derepressed and activate a type-I interferon (IFN-I) response.”
- Also stated in: § Activation of L1 and interferon in cellular senescence · plain
  “We show here that L1 transcription is activated exponentially during replicative senescence (RS) of human fibroblasts, increasing 4–5-fold by 16 weeks after cessation of proliferation, which we refer to as late senescence (Fig. 1a, Extended Data Fig. 1a-e).”
Quote in the paperSubstantial claim
May combine two claims.
Findingown data
A fraction of senescent cells in normal human individuals display activation of L1, consistent with these events accumulating during the progression of senescence.
“Hence, a fraction of senescent cells in normal human individuals display activation of L1, consistent with these events accumulating during the progression of senescence.”
Quote in the paperSubstantial claim
May combine two claims.
Findingown data
SASP upregulation is significant for EP_SEN-E and EP_SEN-L but not SEN-E_SEN-L.
“Note that the upregulation of IFN-I is significant for EP_SEN-L and SEN-E_SEN-L but not for EP_SEN-E, and that the upregulation of SASP is significant for EP_SEN-E and EP_SEN-L but not SEN-E_SEN-L.”
Quote in the paperNot a substantial claim
Probably not a substantial claim: may not pass S3 (load-bearing).
Findingown data
Among the 658 mappable clones 224 unique elements were represented.
“Among the 658 mappable clones 224 unique elements were represented (Supplementary Table 3).”
Quote in the paperNot a substantial claim
May combine two claims.
Findingown data
In mice at 5 months, 3TC treatment did not significantly change expression of L1 mRNA, p16, IFN-I response genes, or SASP genes compared to no drug control.
“In no instance was expression at 5 months + 3TC significantly different from the no drug control, therefore these data are not shown in the figure”
Quote in the paperNot a substantial claim
Probably not a substantial claim: may not pass S3 (load-bearing).
Findingown data
The remaining 50 mappable clones contained L1 sequences.
“The remaining 50 mappable clones contained L1 sequences and were aligned to the L1HS consensus using a setting of >95% identity at positions 1–450”
Quote in the paperNot a substantial claim
May combine two claims.
Findingown data
Several IFN-I response genes (Ifn-α, Irf7, Oas1) as well as pro-inflammatory and SASP markers (Il-6, Mmp3, Pai1) were upregulated in tissues of old mice.
“Notably, we found that several IFN-I response genes (Ifn-α, Irf7, Oas1) as well as pro-inflammatory and SASP markers (Il-6, Mmp3, Pai1) were upregulated in tissues of old mice (Fig. 4c, Extended Data Fig. 9).”
Quote in the paperSubstantial claim
Probably not a substantial claim: may not pass S3 (load-bearing).
Findingown data
658 clones could be mapped to the unmasked reference genome demanding 100% identity.
“658 clones could be thus mapped, 51 additional clones contained at least 1 mismatch and thus likely represent elements that are polymorphic in the cell line, and 58 were cloning artifacts.”
Quote in the paperNot a substantial claim
May combine two claims.
Findingown data
The SASP gene set is upregulated early whereas the IFN-I gene set is upregulated late.
“Note that the SASP gene set is upregulated early whereas the IFN-I gene set is upregulated late.”
Quote in the paperSubstantial claim
May combine two claims.
Findingown data
The RNA-DNA signal in senescent cells largely colocalized with the ORF1 signal and was lost after RNase A treatment.
“The RNA-DNA signal in senescent cells largely colocalized with the ORF1 signal and was lost after RNase A treatment.”
Quote in the paperSubstantial claim
Probably not a substantial claim: may not pass S3 (load-bearing).
Findingnone given
Several attempts using the same protocol on early passage proliferating cells did not yield any L1 clones.
“Several attempts using the same protocol on early passage proliferating cells did not yield any L1 clones.”
Quote in the paperNot a substantial claim
May combine two claims.
Findingown data
IFN-I upregulation is significant for EP_SEN-L and SEN-E_SEN-L but not for EP_SEN-E.
“Note that the upregulation of IFN-I is significant for EP_SEN-L and SEN-E_SEN-L but not for EP_SEN-E, and that the upregulation of SASP is significant for EP_SEN-E and EP_SEN-L but not SEN-E_SEN-L.”
Quote in the paperSubstantial claim
May combine two claims.
Findingown data
The ssDNA signal also colocalized with the ORF1 signal and was exposed by RNase treatment.
“The ssDNA signal also colocalized with the ORF1 signal and was exposed by RNase treatment.”
Quote in the paperSubstantial claim
Probably not a substantial claim: may not pass S3 (load-bearing).
Study design and conductnone given
Sample sizes were based on previously published experiments and previous experience in which differences were observed.
“Sample sizes were based on previously published experiments and previous experience in which differences were observed.”
Quote in the paperNot a substantial claim
Probably not a substantial claim: may not pass S3 (load-bearing). May combine two claims.
Study design and conductnone given
In each individual experiment all samples were processed in parallel and no blinding was introduced.
“In each individual experiment all samples were processed in parallel and no blinding was introduced.”
Quote in the paperNot a substantial claim
Probably not a substantial claim: may not pass S3 (load-bearing).
Study design and conductnone given
The RNA-seq experiment was performed in three biological replicates.
“The RNA-seq experiment was performed in three biological replicates.”
Quote in the paperNot a substantial claim
Probably not a substantial claim: may not pass S3 (load-bearing).
Study design and conductnone given
Fields or sections of tissues for quantification were randomly selected.
“Fields or sections of tissues for quantification were randomly selected and the scored, using methods as indicated for individual experiments.”
Quote in the paperNot a substantial claim
Probably not a substantial claim: may not pass S3 (load-bearing).
Study design and conductnone given
All attempts at replication were successful.
“All attempts at replication were successful.”
Quote in the paperNot a substantial claim
Probably not a substantial claim: may not pass S3 (load-bearing).
Study design and conductnone given
The Brown investigators were blinded to everything except the age and sex of the subjects.
“The Brown investigators were blinded to everything except the age and sex of the subjects.”
Quote in the paperNot a substantial claim
Probably not a substantial claim: may not pass S3 (load-bearing).
Study design and conductown data
The successful knock out of IFNAR1 and IFNAR2 was verified in 4 out of the 24 expanded clonal cell lines.
“The successful knock out of IFNAR1 and IFNAR2 was verified in 4 out of the 24 expanded clonal cell lines.”
Quote in the paperNot a substantial claim
- Rests on an assumption: Absence of nuclear translocation of phospho-STAT2 and IRF9 after interferon treatment signifies lack of IFN-I responsiveness and loss of IFNAR function.
Probably not a substantial claim: may not pass S3 (load-bearing).
Study design and conductnone given
No statistical test was used to pre-determine sample size.
“No statistical test was used to pre-determine sample size.”
Quote in the paperNot a substantial claim
Probably not a substantial claim: may not pass S3 (load-bearing).
Study design and conductnone given
Three independent experiments were performed for each construct.
“Three independent experiments were performed for each construct.”
Quote in the paperNot a substantial claim
Probably not a substantial claim: may not pass S3 (load-bearing).
Study design and conductnone given
There were no findings that were not replicated or could not be reproduced.
“There were no findings that were not replicated or could not be reproduced.”
Quote in the paperNot a substantial claim
Probably not a substantial claim: may not pass S3 (load-bearing).
Study design and conductnone given
The investigators were also blinded when scoring glomerulosclerosis and muscle fiber diameter.
“The investigators were also blinded when scoring glomerulosclerosis and muscle fiber diameter.”
Quote in the paperNot a substantial claim
Probably not a substantial claim: may not pass S3 (load-bearing).
Study design and conductnone given
The investigators were blinded when quantifying immunofluorescence results.
“The investigators were blinded when quantifying immunofluorescence results.”
Quote in the paperNot a substantial claim
Probably not a substantial claim: may not pass S3 (load-bearing). May combine two claims.
Interpretationown data
51 additional clones contained at least 1 mismatch and thus likely represent elements that are polymorphic in the cell line.
“658 clones could be thus mapped, 51 additional clones contained at least 1 mismatch and thus likely represent elements that are polymorphic in the cell line, and 58 were cloning artifacts.”
Quote in the paperNot a substantial claim
Probably not a substantial claim: may not pass S3 (load-bearing).
Study design and conductnone given
All conditions were run in triplicate.
“All conditions were run in triplicate.”
Quote in the paperNot a substantial claim
Probably not a substantial claim: may not pass S3 (load-bearing). May combine two claims.
Study design and conductnone given
40 glomeruli per animal were assessed in a blinded fashion and assigned scores of 1-4.
“Briefly, 40 glomeruli per animal were assessed in a blinded fashion and assigned scores of 1–4: score of 1, <25% sclerosis; 2, 25–50% sclerosis; 3, 50–75% sclerosis; 4, >75% sclerosis.”
Quote in the paperNot a substantial claim
Probably not a substantial claim: may not pass S3 (load-bearing).
Study design and conductcitation
Differential expression outputs were corrected for multiple comparisons by adjusting the nominal p value using the Benjamini-Hochberg method.
“The outputs were then corrected for multiple comparisons by adjusting the nominal p value using Benjamini-Hochberg method47.”
Quote in the paperNot a substantial claim0 of 1 sources checked
- cites [47] Benjamini, Y. & Hochberg, Y. Controlling the false discovery rate: a practical and powerful approach to multiple testing. J. R. Stat. Soc. B 57, 289–300 (1995). source
Probably not a substantial claim: may not pass S3 (load-bearing).
Study design and conductnone given
No samples were excluded.
“No samples were excluded.”
Quote in the paperNot a substantial claim
Probably not a substantial claim: may not pass S3 (load-bearing). May combine two claims.
Study design and conductnone given
All microscope settings and exposure times were set to collect images below saturation and were kept constant for all images taken in one experiment.
“All microscope settings and exposure times were set to collect images below saturation and were kept constant for all images taken in one experiment.”
Quote in the paperNot a substantial claim
Probably not a substantial claim: may not pass S3 (load-bearing).
Study design and conductown data
The remaining 7 shRNAs produced no or minimal knockdown.
“The remaining 7 shRNAs produced no or minimal knockdown.”
Quote in the paperNot a substantial claim
Probably not a substantial claim: may not pass S3 (load-bearing).
Interpretationown data
58 clones were cloning artifacts.
“658 clones could be thus mapped, 51 additional clones contained at least 1 mismatch and thus likely represent elements that are polymorphic in the cell line, and 58 were cloning artifacts.”
Quote in the paperNot a substantial claim
Classified as probably not a substantial claim.
Study design and conductown data
For knockdown of L1, shL1_11 and shL1_44 showed significant knockdown.
“For knockdown of L1 we designed and tested 9 shRNAs, of which two (shL1_11 to ORF1, AAGACACATGCACACGTATGT, and shL1_44 to ORF2 AAGACACATGCACACGTATGT) showed significant knockdown (Extended Data Fig. 5g) and were chosen for further work.”
Quote in the paperSubstantial claim
Probably not a substantial claim: may not pass S3 (load-bearing).
Study design and conductreasoning
Because of limiting material it was not possible to combine detection of p16 with TIFs in a 3 color experiment.
“Because of limiting material it was not possible to combine detection of p16 with TIFs in a 3 color experiment.”
Quote in the paperNot a substantial claim
Probably not a substantial claim: may not pass S3 (load-bearing).
Study design and conductown data
The experiments were repeated 3 times with similar results.
“The experiment was repeated 3 times with similar results.”
- Also stated in: § Extended Data · plain
  “The experiment was repeated 3 times with similar results.”
- Also stated in: § Extended Data · plain
  “The experiments shown in panels (a, b) was repeated 3 times independently with similar results.”
Quote in the paperNot a substantial claim
Probably not a substantial claim: may not pass S3 (load-bearing).
Study design and conductnone given
The specimens used here were chosen randomly from left over material.
“The specimens used here were chosen randomly from left over material.”
Quote in the paperNot a substantial claim
Probably not a substantial claim: may not pass S3 (load-bearing).
Study design and conductnone given
Primer pairs for all genes were verified to be of equivalent efficiency.
“Primer pairs for all genes were verified to be of equivalent efficiency.”
Quote in the paperNot a substantial claim
Probably not a substantial claim: may not pass S3 (load-bearing).
Premisecitation
The TIF assay relies on a two-parameter visualization of telomeres and immunofluorescent detection of DNA damage foci.
“The TIF assay34 relies on a two-parameter (color) visualization of telomeres (using a FISH probe) and immunofluorescent detection of DNA damage foci (using antibody to 53BP1).”
Quote in the paperNot a substantial claim0 of 1 sources checked
- cites [34] Herbig, U., Jobling, W. A., Chen, B. P., Chen, D. J. & Sedivy, J. M. Telomere shortening triggers senescence of human cells through a pathway involving ATM, p53, and p21CIP1, but not p16INK4a. Mol. Cell 14, 501–513 (2004). source

48 of 48

The authors state this as an assumption.
The contribution of RTE activity to aging and age-associated diseases is not known.
“However, the contribution of RTE activity to aging and age-associated diseases is not known.”
The paper relies on this without support.
Cellular senescence in cultured human fibroblasts is representative of senescence in vivo and of aging.
“The activation of endogenous L1 elements and the ensuing robust activation of an IFN-I response is a novel phenotype of senescent cells, including naturally occurring senescent cells in tissues.”
The paper relies on this without support.
Absence of nuclear translocation of phospho-STAT2 and IRF9 after interferon treatment signifies lack of IFN-I responsiveness and loss of IFNAR function.
“The absence of translocation signifies lack of IFN-I responsiveness and hence loss of IFNAR function.”

3 of 3

Claims other papers make about this one

Each is checked against this paper’s own text: does it say what the citing paper says it does?

Repeated triggering of the RCM response disrupts youthful gene expression and releases retrotransposons, including those normally silenced by SIRT1 and SIRT6.
“Studies of these proteins indicate that repeated triggering of the RCM response disrupts youthful gene expression patterns and liberates retrotransposons, such as those silenced by SIRT1/SIRT6 (De Cecco et al., 2019; Oberdoerffer et al., 2008; Simon et al., 2019).”
From Loss of epigenetic information as a cause of mammalian aging (2023) · cites this paper as De Cecco et al., 2019
The Abstract (page unavailable) reports that LINE-1 retrotransposons become derepressed during cellular senescence, supporting the retrotransposon portion of the claim. The paper does not establish that repeated triggering of an RCM response causes this or disrupts youthful gene-expression patterns. Its References list names a study of SIRT6-mediated LINE-1 repression, but this paper does not show that SIRT1 or SIRT6 silences the elements it examined. (LLM, conf=0.87)
Experimental — accuracy not yet measured
Intracellular cues such as retrotransposable elements (e.g., LINE-1), cytosolic mitochondrial DNA, and circular DNA can activate cGAS-STING and trigger pro-inflammatory genes weeks or months after senescence induction.
“These include retrotransposable elements (for example, LINE-1), cytosolic mitochondrial DNA, or circular DNA—all of which can activate the cytosolic DNA-sensing (cGAS)-STING pathway, triggering the expression of pro-inflammatory genes79–81.”
From Cellular senescence and senolytics: the path to the clinic (2022) · cites this paper as [79]
The Consequences of L1 activation section reports that suppressing cGAS or STING inhibited the interferon response and reduced pro-inflammatory SASP gene expression in late-senescent cells. The paper also mentions mitochondrial DNA as a possible source of cytoplasmic DNA, but does not establish the claimed pathway for mitochondrial DNA or address circular DNA. Its Extended Data examine cells at 12–16 weeks of senescence. (LLM, conf=0.87)
Experimental — accuracy not yet measured
Numerous other senescence markers, such as p21, p16, SASP factors, and DNA damage, are found across populations of adipose tissue cells.
“numerous other senescence markers, such as p21, p16, SASP factors, and DNA damage, are found across populations of adipose tissue cells7,31,84–87 (Fig. 2 F).”
From Guidelines for minimal information on cellular senescence experimentation in vivo (2024) · cites this paper as [87]
Extended Data Figure 10 reports a senescence marker (loss of Lamin B1) alongside the SASP factor IL-6 in mouse white adipose tissue. Extended Data Figure 1 assesses p21, p16, SASP genes, and DNA-damage foci in senescent cell cultures, not across adipose-tissue cell populations. The paper therefore supports the adipose-tissue SASP example, but not the full list or its distribution across adipose cell populations. (LLM, conf=0.87)
Experimental — accuracy not yet measured
Treatment with NRTIs that inhibit L1 reverse transcriptase, or knockdown of L1 expression with shRNAs against active L1 families, decreased cytoplasmic L1 DNAs and ameliorated cGAS and IFN-I activation.
“Importantly, treatment with nucleoside reverse transcriptase inhibitor (NRTI) drugs that inhibit L1 reverse transcriptase, or a knockdown of L1 expression with shRNAs against active L1 families, decreased cytoplasmic L1 DNAs and ameliorated cGAS and IFN-I activation33, 34, 92.”
From The role of retrotransposable elements in ageing and age-associated diseases (2021) · cites this paper as [33]
In ‘Consequences of L1 activation’ (page unavailable), the paper reports that 3TC or L1 shRNA nearly blocked cytoplasmic L1 DNA synthesis and reduced the IFN-I response. It also shows that cGAS or STING knockdown inhibited that response, but does not report a direct measurement showing that 3TC or L1 shRNA reduced cGAS activation. The Methods describe shRNAs targeting L1 ORF1 and ORF2, rather than identifying them as targeting specific active L1 families. (LLM, conf=0.83)
Experimental — accuracy not yet measured
Cytoplasmic L1 DNA was found in normal cells in association with cellular senescence and aging.
“Recently, cytoplasmic L1 DNA was found in normal cells in association with cellular senescence and aging33, 34.”
From The role of retrotransposable elements in ageing and age-associated diseases (2021) · cites this paper as [33]
In “Consequences of L1 activation,” the paper reports cytoplasmic DNA enriched for L1 sequences in senescent cells. In “Activation of L1 in human and mouse tissues,” it links L1 expression to aging in normal tissues, but the reported tissue measurements are of L1 RNA or ORF1 protein, not cytoplasmic L1 DNA. (LLM, conf=0.84)
Experimental — accuracy not yet measured

Retrotransposition is greatly diminished in non-dividing cells, although low levels could be detected in senescent cells or neurons.
“Retrotransposition is greatly diminished in non-dividing cells94, although low levels could be detected in senescent cells33 or neurons92, and it is possible that abortive products of these processes could accumulate.”
From The role of retrotransposable elements in ageing and age-associated diseases (2021) · cites this paper as [33]
In “Consequences of L1 activation” (page unavailable), the paper reports L1-enriched cytoplasmic DNA and an increase in L1HS sequences in senescent cells, supporting detectable L1 activity. It does not establish a low rate of completed retrotransposition in those cells; the retrotransposition reporter described in the Extended Data was tested in early-passage cells. Citation 33 is attached to the senescent-cell clause, not the claims about non-dividing cells generally or neurons. (LLM, conf=0.82)
Experimental — accuracy not yet measured
In very late replicative, stress, and OIS cells, the SASP becomes characterized by the expression of type-I interferons.
“Moreover, in very late replicative, stress, and OIS cells, the SASP becomes characterized by the expression of type-I interferons (IFN-I) (De Cecco et al. 2019).”
From Senescence and the SASP: many therapeutic avenues (2020) · cites this paper as De Cecco et al. 2019
In “Activation of L1 and interferon in cellular senescence,” the paper reports late IFN-I induction in replicative, stress-induced, and oncogene-induced senescence. It also says the SASP and IFN-I responses are temporally distinct, although “Consequences of L1 activation” finds that IFN-I signaling contributes to a mature SASP. Thus, the late IFN-I expression is supported, but describing it as what characterizes the SASP blurs a distinction the paper makes. (LLM, conf=0.84)
Experimental — accuracy not yet measured
At 10 months post-treatment, ICE mice had 6-fold fewer COX-positive myofibers, about half the capillary-to-fiber ratio, and loss of silencing at repetitive elements and transcription of retrotransposons, paralleling normal aging.
“At 10-months post-treatment, the ICE mice had 6-fold fewer COX-positive myofibers (Figure S5G and S5H), about half the capillary to fiber ratio (Figure 4G and 4H), a loss of silencing at repetitive elements and the transcription of retrotransposons, paralleling normal aging (Das et al., 2019; De Cecco et al., 2019; Oberdoerffer et al., 2008; Wenz et al., 2009) (Figure S5I).”
From Loss of epigenetic information as a cause of mammalian aging (2023) · cites this paper as De Cecco et al., 2019
The SASP is dynamic, changes over time, and varies with the type of senescent cell and how senescence was induced.
“The SASP of senescent cells is not static; it can change over time78–80 and varies depending on the type of cells that became senescent and how senescence was induced16,44,59,60,81.”
From Cellular senescence and senolytics: the path to the clinic (2022) · cites this paper as [79]
Experimental — accuracy not yet measured
Reactivation of transposable elements contributes to the non-cell-autonomous functions of senescent cells.
“the reactivation of transposable elements also contributes to mediate the non-cell-autonomous functions of senescent cells as detailed later62”
From Cellular senescence in ageing: from mechanisms to therapeutic opportunities (2021) · cites this paper as [62]
Senescent cells that persist for long periods in culture or in vivo show strong activation of the type I interferon response and its downstream targets.
“Senescent cells, especially when persisting for extended periods in culture or in vivo, display a profound activation of type I interferon response and downstream targets.”
From Cellular senescence in ageing: from mechanisms to therapeutic opportunities (2021) · cites this paper as [62]
Nucleoside reverse-transcriptase inhibitors, which block retrotransposition of transposable elements, reduce the detrimental SASP effects of senescence and improve chronic inflammation in aged animals.
“Treatment with nucleoside reverse-transcriptase inhibitors, which inhibit retrotransposition of transposable elements, limits the senescence-associated detrimental effects of SASP and ameliorates chronic inflammation in aged animals62,119.”
From Cellular senescence in ageing: from mechanisms to therapeutic opportunities (2021) · cites this paper as [62]
The strong type I interferon induction is partly caused by transposable element reactivation and follows cGAS-STING activation.
“This distinctively strong induction of type I interferon was found to be partly caused by reactivation of transposable elements and consequent to cGAS–STING activation62.”
From Cellular senescence in ageing: from mechanisms to therapeutic opportunities (2021) · cites this paper as [62]
Additional features of the senescent cell-cycle arrest include ribosome biogenesis defects and derepression of retrotransposons.
“Additional features of the senescent cell-cycle arrest include ribosome biogenesis defects and derepression of retrotransposons (De Cecco et al., 2019; Lessard et al., 2018).”
From Cellular Senescence: Defining a Path Forward (2019) · cites this paper as De Cecco et al., 2019
An interferon type 1 response occurs as a later event and is driven in part by derepression of LINE-1 retrotransposable elements.
“Moreover, an interferon type 1 response occurs as a later event and is driven in part by derepression of LINE-1 retrotransposable elements (De Cecco et al., 2019).”
From Cellular Senescence: Defining a Path Forward (2019) · cites this paper as De Cecco et al., 2019
Loss of heterochromatin factors reduces heterochromatin at retrotransposons and allows their transcriptional derepression.
“Loss of these factors reduces heterochromatin at retrotransposons and allows their transcriptional derepression26, 29, 31, 33–35.”
From The role of retrotransposable elements in ageing and age-associated diseases (2021) · cites this paper as [33]
DNA methylation changes are early events in senescence, whereas retrotransposon activation occurs only much later.
“However, DNA methylation changes are early events in senescence73, whereas retrotransposon activation occurs only much later33.”
From The role of retrotransposable elements in ageing and age-associated diseases (2021) · cites this paper as [33]
Knockdown of RB1 and TREX1 combined with FOXA1 overexpression led to L1 derepression in human fibroblasts.
“Knockdown of RB1 and TREX1 combined with FOXA1 overexpression led to L1 derepression in human fibroblasts33.”
From The role of retrotransposable elements in ageing and age-associated diseases (2021) · cites this paper as [33]
Senescent cells have high transcription levels of LINE-1.
“De Cecco et al74 reported high transcription levels of the long‐interspersed element‐1 (LINE‐1, also known as L1), a retrotransposable element, in senescent cells.”
From Cellular senescence and senescence-associated secretory phenotype via the cGAS-STING signaling pathway in cancer (2020) · cites this paper as [74]
Lamivudine reduces the late SASP response and ameliorates several phenotypes of aging in old mice, including kidney glomerulosclerosis, skeletal muscle atrophy, and tissue immune infiltrations.
“lamivudine reduces the late SASP response and ameliorates several phenotypes of aging in old mice, including kidney glomerulosclerosis, skeletal muscle atrophy, and tissue immune infiltrations (De Cecco et al. 2019).”
From Senescence and the SASP: many therapeutic avenues (2020) · cites this paper as De Cecco et al. 2019
Treatment of LOAD neurons with 3TC from PID16 to PID28 reduced the presence of single-stranded DNA (ssDNA) by ~50% at PID28.
“LOAD neurons were treated with 3TC from PID16 to PID28, and the presence of single-stranded DNA (ssDNA), an intermediate product of retrotransposition and its amount has been served as an indicator for RTE synthesis (86), were reduced by ~50% at PID28 (Fig. 7A).”
From Modeling late-onset Alzheimer’s disease neuropathology via direct neuronal reprogramming (2024) · cites this paper as [86]
Dysregulation of retrotransposon elements (RTEs) in aging may trigger inflammatory responses.
“It was previously shown that dysregulation of retrotransposon elements (RTEs) in aging may trigger inflammatory responses (86–88)”
From Modeling late-onset Alzheimer’s disease neuropathology via direct neuronal reprogramming (2024) · cites this paper as [86]
DNA damage products and retroelement amplification are upstream triggers of cGAS in senescence.
“Previous research has revealed DNA damage products5–7 and retroelement amplification52 as upstream triggers of cGAS in senescence.”
From cGAS–STING drives ageing-related inflammation and neurodegeneration (2023) · cites this paper as [52]
Elimination of p16+ cells in adipose tissue of transgenic mice reduces overall tissue senescence.
“Elimination of p16+ cells in the adipose tissue of transgenic mice reduces overall tissue senescence86,87”
From Guidelines for minimal information on cellular senescence experimentation in vivo (2024) · cites this paper as [87]
The section on L1 activation in human and mouse tissues reports that 3TC reduced inflammatory markers in aged mice but did not remove senescent cells. Extended Data Figure 10 examines adipose tissue after 3TC treatment. Neither passage addresses elimination of p16-positive adipose cells in transgenic mice or its effect on overall tissue senescence; searches for transgenic elimination and genetic ablation found no such result in our copy. (LLM, conf=0.75)
Experimental — accuracy not yet measured
Activation of L1 mediated by TREX1, RB1 and FOXA1 leads to accumulation of cDNA in cytoplasm as L1 possesses high reverse transcriptase activity.
“This activation of L1 which is mediated by TREX1, RB1 and FOXA1 leads to accumulation of cDNA in the cytoplasm as L1 possesses high reverse transcriptase activity.”
From Mechanisms of Cellular Senescence: Cell Cycle Arrest and Senescence Associated Secretory Phenotype (2021) · cites this paper as De Cecco et al., 2019
Accumulated cDNA triggers cGAS/STING signaling pathway, leading to production of SASP factors.
“The accumulated cDNA has been demonstrated to trigger cGAS/STING signaling pathway, leading to production of SASP factors (De Cecco et al., 2019).”
From Mechanisms of Cellular Senescence: Cell Cycle Arrest and Senescence Associated Secretory Phenotype (2021) · cites this paper as De Cecco et al., 2019
De Cecco et al. (2019) reported derepression of LINE-1 in senescent cells.
“De Cecco et al. (2019) reported derepression of long-interspersed element-1 (L1 or LINE-1), the only human retrotransposable element capable of autonomous retrotransposition, in senescent cells.”
From Mechanisms of Cellular Senescence: Cell Cycle Arrest and Senescence Associated Secretory Phenotype (2021) · cites this paper as De Cecco et al., 2019
Senomorphic treatment may require continuous administration and could disrupt tissue homeostasis due to SASP blockade.
“However, senomorphic treatment may require continuous administration and could potentially disrupt tissue homeostasis due to SASP blockade.”
From Senescence, brain inflammation, and oligomeric tau drive cognitive decline in Alzheimer's disease: Evidence from clinical and preclinical studies (2024) · cites this paper as [191]
In the reversal group, exercise training reduced p16Ink4a mRNA levels by 73%.
“but decreased p16Ink4a mRNA levels, a marker of late senescence, by 73% (Fig. 2i)”
From Exercise activates AMPK in mouse and human pancreatic islets to decrease senescence (2024) · cites this paper as [23]
Previous data suggest that p16Ink4a maintains senescence while p21Cip1 establishes senescence.
“Previous data have suggested that p16Ink4a is involved in maintaining senescence, whereas p21Cip1 is involved in establishing senescence23,39.”
From Exercise activates AMPK in mouse and human pancreatic islets to decrease senescence (2024) · cites this paper as [23]
Senescent cells accumulate in a range of tissues with age, secreting numerous pro-inflammatory cytokines, chemokines, growth factors, and extracellular matrix (ECM) degrading proteins.
“Senescent cells accumulate in a range of tissues with age, secreting numerous pro‐inflammatory cytokines, chemokines, growth factors, and extracellular matrix (ECM) degrading proteins.[ 58 ]”
From Pathogenesis of sarcopenia and the relationship with fat mass: descriptive review (2022) · cites this paper as [58]
Transposons can be produced in senescent cells, re-insert into their DNA, contribute to the senescent phenotype, and exacerbate the SASP.
“Transposons (“jumping genes”) can be produced within senescent cells that re-insert into senescent cell DNA, contributing to the senescent cell phenotype and exacerbating their SASP [24, 25].”
From Reducing Senescent Cell Burden in Aging and Disease (2020) · cites this paper as [25]
Senescence and the SASP are dynamic phenotypes that change over time.
“Senescence and the SASP are dynamic phenotypes that change over time (De Cecco et al., 2019; Hernandez-Segura et al., 2017).”
From Oxylipin biosynthesis reinforces cellular senescence and allows detection of senolysis (2021) · cites this paper as De Cecco et al., 2019
The increase in L1 transcription observed during cellular senescence is mediated by decreased expression of RB1 and increased expression of FOXA1.
“Indeed, a study demonstrated that the increase in L1 transcription observed during cellular senescence was mediated by decreased expression of RB1, a transcriptional repressor that promotes heterochromatinization of L1 elements, as well as increased expression of the transcriptional activator, FOXA1 (De Cecco et al., 2019).”
From Cytoplasmic DNA: sources, sensing, and role in aging and disease (2021) · cites this paper as De Cecco et al., 2019
Activation of retrotransposon contributes to age-associated chronic inflammation.
“Activation of retrotransposon has also been shown to contribute to age-associated chronic inflammation (De Cecco et al., 2019; Simon et al., 2019).”
From Cytoplasmic DNA: sources, sensing, and role in aging and disease (2021) · cites this paper as De Cecco et al., 2019
Reactivation of LINE-1 elements during late senescence is accompanied by accumulation of L1 cytoplasmic cDNA, due in part to a decrease in the levels of the exonuclease TREX1, and activation of a cGAS-STING-dependent IFN-I response and pro-inflammatory phenotype.
“Reactivation of LINE-1 elements during late senescence is accompanied by accumulation of L1 cytoplasmic cDNA, due in part to a decrease in the levels of the exonuclease TREX1 (De Cecco et al., 2019), and activation of a cGAS-STING-dependent IFN-I response and pro-inflammatory phenotype (De Cecco et al., 2019).”
From Cytoplasmic DNA: sources, sensing, and role in aging and disease (2021) · cites this paper as De Cecco et al., 2019
NRTIs abrogate the accumulation of cytoplasmic L1 DNA in senescent cells.
“In addition, NRTIs have been shown to abrogate the accumulation of cytoplasmic L1 DNA in senescent cells (De Cecco et al., 2019; Simon et al., 2019).”
From Cytoplasmic DNA: sources, sensing, and role in aging and disease (2021) · cites this paper as De Cecco et al., 2019
Inhibiting the synthesis of cytoplasmic L1 DNA, either by using NRTIs or by shRNA knockdown of L1, reduces activation of IFN genes and the magnitude of the SASP, demonstrating that accumulation of L1 cDNA in the cytoplasm of senescent cells is an important contributor to the maintenance of the pro-inflammatory phenotype.
“Inhibiting the synthesis of cytoplasmic L1 DNA, either by using nucleoside reverse transcriptase inhibitors (NRTIs) or by shRNA knockdown of L1, was sufficient to reduce the activation of IFN genes and the magnitude of the SASP, demonstrating that accumulation of L1 cDNA in the cytoplasm of senescent cells is an important contributor to the maintenance of the pro-inflammatory phenotype (De Cecco”
From Cytoplasmic DNA: sources, sensing, and role in aging and disease (2021) · cites this paper as De Cecco et al., 2019
Retrotransposons are known to be activated in senescent cells.
“Retrotransposons are known to be activated in senescent cells (De Cecco et al., 2019; Gorbunova et al., 2021).”
From Cytoplasmic DNA: sources, sensing, and role in aging and disease (2021) · cites this paper as De Cecco et al., 2019
Treating aged mice with NRTIs effectively reduces L1 cytoplasmic DNA and the ensuing inflammation in a variety of tissues, and improves age-related phenotypes such as tissue macrophage infiltration, glomerulosclerosis of the kidney, and skeletal muscle atrophy.
“Indeed, treating aged mice with NRTIs effectively reduced L1 cytoplasmic DNA and the ensuing inflammation in a variety of tissues (De Cecco et al., 2019; Simon et al., 2019), and improved a number of age-related phenotypes, such as tissue macrophage infiltration, glomerulosclerosis of the kidney, and skeletal muscle atrophy (De Cecco et al., 2019).”
From Cytoplasmic DNA: sources, sensing, and role in aging and disease (2021) · cites this paper as De Cecco et al., 2019
Increased cytosolic L1 DNA and expression of IFN genes have been observed in a number of tissues of aged mice.
“Interestingly, increased cytosolic L1 DNA and expression of IFN genes has been observed in a number of tissues of aged mice (De Cecco et al., 2019; Simon et al., 2019).”
From Cytoplasmic DNA: sources, sensing, and role in aging and disease (2021) · cites this paper as De Cecco et al., 2019
In senescence, RT activation appears months later, whereas CCF formation appears within days.
“this activation only occurs late in senescence (a few months), versus CCF formation (a few days)”
From Cytoplasmic DNA: sources, sensing, and role in aging and disease (2021) · cites this paper as De Cecco et al., 2019
Senescent cells show activation of retrotransposons (RT).
“Senescent cells also display RT activation (De Cecco et al., 2019)”
From Cytoplasmic DNA: sources, sensing, and role in aging and disease (2021) · cites this paper as De Cecco et al., 2019
An increase in transcription of LINE-1 during senescence could partly contribute to accumulation of DNA fragments in the cytoplasm.
“Alternatively, an increase in the transcription of long-interspersed element-1 (LINE-1 or L1), the only human retro-transposable element, during senescence could partly contribute to the accumulation of DNA fragments in the cytoplasm [177].”
From Mechanisms and Regulation of Cellular Senescence (2021) · cites this paper as [177]
L1 activation results in cDNA accumulation in the cytoplasm that reinforces cGAS signaling activation to produce the SASP response in senescent cells and chronic inflammation in aged mice.
“As L1 displays high reverse transcriptase activity, its activation results in cDNA accumulation in the cytoplasm that reinforces cGAS signaling activation to produce the SASP response in senescent cells and chronic inflammation in aged mice [177,178].”
From Mechanisms and Regulation of Cellular Senescence (2021) · cites this paper as [177]
Genomic mosaicism by retrotransposition of LINE-1 elements has been associated with the neuronal genome and the derepression of LINE-1 elements has been associated with senescence.
“Indeed, genomic mosaicism by retro transposition of LINE-1 elements has been associated with the neuronal genome and the derepression of LINE-1 elements has been associated with senescence129–131.”
From Neuronal DNA double-strand breaks lead to genome structural variations and 3D genome disruption in neurodegeneration (2023) · cites this paper as [130]
p21 levels may decrease in 'late' senescence or when senescence has been achieved, whereas high levels of p16 are thought to be maintained throughout senescence.
“p21 levels may also decrease in ‘late’ senescence or when senescence has been achieved [115,158], whereas high levels of p16 are thought to be maintained throughout senescence [158,159].”
From Untangling senescent and damage‐associated microglia in the aging and diseased brain (2023) · cites this paper as [158]

Self-check

Percentages, sums and reported differences re-computed from the paper’s own numbers.

Each contradiction between two passages listed here was confirmed by an independent check.

Point D is assigned both 12 and 16 weeks
Minor
The methods assign point D to 12 weeks and point E to 16 weeks, but the 5′RACE caption identifies 16 weeks as point D.
PCR-array significance criterion reverses the stated P-value threshold
Minor
The PCR-array methods say a gene must have P > 0.05 to be considered significant, whereas the paper states that significance in its figures uses P < 0.05. This leaves the reported counts of significantly changed PCR-array genes dependent on contradictory criteria.
Two described L1 shRNAs have the same listed sequence
Minor
The methods give shL1_11 and shL1_44 identical nucleotide sequences, while the figure legend calls them two distinct shRNAs.

3 of 3

Controlling the False Discovery Rate: A Practical and Powerful Approach to Multiple Testing
Benjamini, Y., & Hochberg, Y. (1995) · Journal of the Royal Statistical Society Series B: Statistical Methodology · doi:10.1111/j.2517-6161.1995.tb02031.x · Cited by 109,482 · cited 1× · see citing works
“The outputs were then corrected for multiple comparisons by adjusting the nominal p value using Benjamini-Hochberg method 47 .”
Gene set enrichment analysis: A knowledge-based approach for interpreting genome-wide expression profiles
Subramanian, A., Tamayo, P., Mootha, V. K., Mukherjee, S., Ebert, B. L., Gillette, M. A., Paulovich, A., Pomeroy, S. L., Golub, T. R., Lander, E. S., et al. (2005) · Proceedings of the National Academy of Sciences · doi:10.1073/pnas.0506580102 · Cited by 53,625 · see citing works
MAFFT Multiple Sequence Alignment Software Version 7: Improvements in Performance and Usability
Katoh, K., & Standley, D. M. (2013) · Molecular Biology and Evolution · doi:10.1093/molbev/mst010 · Cited by 46,209 · cited 1× · see citing works
“Multiple sequence alignments were calculated using MAFFT (Multiple Alignment using Fast Fourier Transform) with the L-INS-i algorithm (accurate for alignments of 200 sequences) 57 .”
<tt>edgeR</tt> : a Bioconductor package for differential expression analysis of digital gene expression data
Robinson, M. D., McCarthy, D. J., & Smyth, G. K. (2010) · Bioinformatics · doi:10.1093/bioinformatics/btp616 · Cited by 41,364 · see citing works
featureCounts: an efficient general purpose program for assigning sequence reads to genomic features
Liao, Y., Smyth, G. K., & Shi, W. (2014) · Bioinformatics · doi:10.1093/bioinformatics/btt656 · Cited by 27,219 · cited 1× · see citing works
“Counts mapping to the genome were determined using featureCounts 43 .”
HISAT: a fast spliced aligner with low memory requirements
Kim, D., Langmead, B., & Salzberg, S. L. (2015) · Nature Methods · doi:10.1038/nmeth.3317 · Cited by 24,112 · see citing works
The Hallmarks of Aging
López-Otín, C., Blasco, M. A., Partridge, L., Serrano, M., & Kroemer, G. (2013) · Cell · doi:10.1016/j.cell.2013.05.039 · Cited by 14,982 · cited 1× · see citing works
“Given Sterile inflammation, also known as inflammaging, is a hallmark of aging and a contributing factor to many age-related diseases 31,32 .”
Jalview Version 2—a multiple sequence alignment editor and analysis workbench
Waterhouse, A. M., Procter, J. B., Martin, D. M. A., Clamp, M. E., & Barton, G. J. (2009) · Bioinformatics · doi:10.1093/bioinformatics/btp033 · Cited by 10,011 · see citing works
Primer-BLAST: A tool to design target-specific primers for polymerase chain reaction
Ye, J., Coulouris, G., Zaretskaya, I., Cutcutache, I., Rozen, S., & Madden, T. (2012) · BMC Bioinformatics · doi:10.1186/1471-2105-13-134 · Cited by 6,138 · see citing works
Improved vectors and genome-wide libraries for CRISPR screening
Sanjana, N. E., Shalem, O., & Zhang, F. (2014) · Nature Methods · doi:10.1038/nmeth.3047 · Cited by 5,239 · cited 1× · see citing works
“0 resource (Feng Zhang Lab, MIT, http://genome-engineering.org/gecko/?page_id=15) 59 , were tested and the following ones were chosen: IFNAR1 (HGLibA_29983) AACAGGAGCGATGAGTCTGTA; IFNAR2 (HGLibA_29985) GTGTATATCAGCCTCGTGTT.”
Genome-scale CRISPR-Cas9 knockout screening in human cells
Shalem, O., Sanjana, N. E., Hartenian, E., Shi, X., Scott, D. A., Mikkelsen, T. S., Heckl, D., Ebert, B. L., Root, D. E., Doench, J. G., et al. (2014) · Science · doi:10.1126/science.1247005 · Cited by 5,234 · see citing works
The senescence-associated secretory phenotype: the dark side of tumor suppression
Coppé, J.-P., Desprez, P.-Y., Krtolica, A., & Campisi, J. (2010) · Annual Review of Pathology: Mechanisms of Disease · doi:10.1146/annurev-pathol-121808-102144 · Cited by 5,206 · cited 7× · see citing works
“Observed: qPCR was performed on 1 ng of genomic DNA and normalized to a known single copy locus. i , Activation of IFN-α and IFN-β 1 genes during senescence of WI-38 and IMR-90 cells was determined by RT-qPCR. j, Confirmation of the senescent status of cells in OIS (20 days, Fig.”
Influential
Chronic Inflammation (Inflammaging) and Its Potential Contribution to Age-Associated Diseases
Franceschi, C., & Campisi, J. (2014) · The Journals of Gerontology Series A: Biological Sciences and Medical Sciences · doi:10.1093/gerona/glu057 · Cited by 3,891 · cited 1× · see citing works
“Given Sterile inflammation, also known as inflammaging, is a hallmark of aging and a contributing factor to many age-related diseases 31,32 .”
Clearance of p16Ink4a-positive senescent cells delays ageing-associated disorders
Baker, D. J., Wijshake, T., Tchkonia, T., LeBrasseur, N. K., Childs, B. G., van de Sluis, B., Kirkland, J. L., & van Deursen, J. M. (2011) · Nature · doi:10.1038/nature10600 · Cited by 3,670 · see citing works
Naturally occurring p16Ink4a-positive cells shorten healthy lifespan
Baker, D. J., Childs, B. G., Durik, M., Wijers, M. E., Sieben, C. J., Zhong, J., A. Saltness, R., Jeganathan, K. B., Verzosa, G. C., Pezeshki, A., et al. (2016) · Nature · doi:10.1038/nature16932 · Cited by 2,891 · cited 1× · see citing works
“Longer term treatments (from 20 to 26 months of age) were effective at opposing several known phenotypes of aging: macrophage infiltration of tissues, a hallmark of chronic inflammation 23,25 , glomerulosclerosis of the kidney 26 and skeletal muscle atrophy 27 (Fig.”
The Achilles' heel of senescent cells: from transcriptome to senolytic drugs
Zhu, Y., Tchkonia, T., Pirtskhalava, T., Gower, A. C., Ding, H., Giorgadze, N., Palmer, A. K., Ikeno, Y., Hubbard, G. B., Lenburg, M., et al. (2015) · Aging Cell · doi:10.1111/acel.12344 · Cited by 2,562 · cited 1× · see citing works
“Hence, NRTIs can be categorized as “senostatic” agents, to contrast them from “senolytic” treatments that remove senescent cells from tissues 21,22 .”
Cellular senescence in aging and age-related disease: from mechanisms to therapy
Childs, B. G., Durik, M., Baker, D. J., & van Deursen, J. M. (2015) · Nature Medicine · doi:10.1038/nm.4000 · Cited by 2,363 · cited 1× · see citing works
“Pairwise alignments to the consensus were performed with LALIGN 56 .”
GenePattern 2.0
Reich, M. M., Liefeld, T., Gould, J., Lerner, J., Tamayo, P., & Mesirov, J. P. (2006) · Nature Genetics · doi:10.1038/ng0506-500 · Cited by 2,035 · cited 1× · see citing works
“Differential expression data were then ranked by log 2 fold change and input into the GenePattern interface for GSEA Preranked, using 1000 permutations, to determine enrichment for KEGG pathways, SASP, and the interferon response 45,46 .”
Clearance of senescent cells by ABT263 rejuvenates aged hematopoietic stem cells in mice
Chang, J., Wang, Y., Shao, L., Laberge, R.-M., Demaria, M., Campisi, J., Janakiraman, K., Sharpless, N. E., Ding, S., Feng, W., et al. (2016) · Nature Medicine · doi:10.1038/nm.4010 · Cited by 1,819 · cited 1× · see citing works
“Hence, NRTIs can be categorized as “senostatic” agents, to contrast them from “senolytic” treatments that remove senescent cells from tissues 21,22 .”
Telomere Shortening Triggers Senescence of Human Cells through a Pathway Involving ATM, p53, and p21CIP1, but Not p16INK4a
Herbig, U., Jobling, W. A., Chen, B. P. C., Chen, D. J., & Sedivy, J. M. (2004) · Molecular Cell · doi:10.1016/s1097-2765(04)00256-4 · Cited by 1,344 · see citing works
Self-citation
Cytoplasmic chromatin triggers inflammation in senescence and cancer
Dou, Z., Ghosh, K., Vizioli, M. G., Zhu, J., Sen, P., Wangensteen, K. J., Simithy, J., Lan, Y., Lin, Y., Zhou, Z., et al. (2017) · Nature · doi:10.1038/nature24050 · Cited by 1,335 · cited 1× · see citing works
“Cytoplasmic DNA can originate from several sources, such as mtDNA released from stressed mitochondria 28 or cytoplasmic chromatin fragments (CCF) released from damaged nuclei 29,30 .”
Aligning Short Sequencing Reads with Bowtie
Langmead, B. (2010) · Current Protocols in Bioinformatics · doi:10.1002/0471250953.bi1107s32 · Cited by 1,270 · cited 2× · see citing works
“Transcription factor ChIP-seq and input control reads were aligned to the consensus sequence of L1HS using bowtie1 48 .”
Mitochondrial DNA in innate immune responses and inflammatory pathology
West, A. P., & Shadel, G. S. (2017) · Nature Reviews Immunology · doi:10.1038/nri.2017.21 · Cited by 1,115 · cited 1× · see citing works
“Cytoplasmic DNA can originate from several sources, such as mtDNA released from stressed mitochondria 28 or cytoplasmic chromatin fragments (CCF) released from damaged nuclei 29,30 .”
Cellular Senescence in Aging Primates
Herbig, U., Ferreira, M., Condel, L., Carey, D., & Sedivy, J. M. (2006) · Science · doi:10.1126/science.1122446 · Cited by 1,101 · cited 1× · see citing works
“In skin biopsies of normal aged human individuals, we found that 10.7% of dermal fibroblasts were positive for the senescence marker p16, which is in the range documented in aging primates 19 (Extended Data Fig.”
InfluentialSelf-citation
Repetitive Elements May Comprise Over Two-Thirds of the Human Genome
de Koning, A. P. J., Gu, W., Castoe, T. A., Batzer, M. A., & Pollock, D. D. (2011) · PLoS Genetics · doi:10.1371/journal.pgen.1002384 · Cited by 1,099 · see citing works
Fat tissue, aging, and cellular senescence
Tchkonia, T., Morbeck, D. E., Von Zglinicki, T., Van Deursen, J., Lustgarten, J., Scrable, H., Khosla, S., Jensen, M. D., & Kirkland, J. L. (2010) · Aging Cell · doi:10.1111/j.1474-9726.2010.00608.x · Cited by 1,094 · cited 2× · see citing works
“Longer term treatments (from 20 to 26 months of age) were effective at opposing several known phenotypes of aging: macrophage infiltration of tissues, a hallmark of chronic inflammation 23,25 , glomerulosclerosis of the kidney 26 and skeletal muscle atrophy 27 (Fig.”
The EMBL-EBI bioinformatics web and programmatic tools framework
Li, W., Cowley, A., Uludağ, M., Gür, T., McWilliam, H., Squizzato, S., Park, Y. M., Buso, N., & López, R. (2015) · Nucleic Acids Research · doi:10.1093/nar/gkv279 · Cited by 1,028 · cited 1× · see citing works
“Second, a consensus sequence of these 6 sequences was generated with the Clustal Omega multiple sequence alignment tool (http://www.ebi.ac.uk/Tools/msa/clustalo/) 39 .”
Improved structure, function and compatibility for CellProfiler: modular high-throughput image analysis software
Kamentsky, L. D., Jones, T. R., Fraser, A. N., Bray, M., Logan, D. J., Madden, K. L., Ljosa, V., Rueden, C., Eliceiri, K. W., & Carpenter, A. E. (2011) · Bioinformatics · doi:10.1093/bioinformatics/btr095 · Cited by 1,002 · see citing works
Cellular senescence and its effector programs
Salama, R., Sadaie, M., Hoare, M., & Narita, M. (2014) · Genes & Development · doi:10.1101/gad.235184.113 · Cited by 855 · cited 1× · see citing works
“Cellular senescence proceeds through an early DNA damage response phase followed by the SASP response 10 .”
L1 retrotransposition in human neural progenitor cells
Coufal, N. G., Garcia-Perez, J. L., Peng, G. E., Yeo, G. W., Mu, Y., Lovci, M. T., Morell, M., O’Shea, K. S., Moran, J. V., & Gage, F. H. (2009) · Nature · doi:10.1038/nature08248 · Cited by 814 · cited 4× · see citing works
“1b) were developed by Coufal et al. (2009) 16 to preferentially target L1HS.”
Influential
Bypass of Senescence After Disruption of p21 CIP1/WAF1 Gene in Normal Diploid Human Fibroblasts
Brown, J. P., Wei, W., & Sedivy, J. M. (1997) · Science · doi:10.1126/science.277.5327.831 · Cited by 804 · cited 1× · see citing works
“LF1 cells were derived from embryonic lung tissue as described 33 .”
Self-citation
Active human retrotransposons: variation and disease
Hancks, D. C., & Kazazian, H. H. (2012) · Current Opinion in Genetics & Development · doi:10.1016/j.gde.2012.02.006 · Cited by 592 · cited 1× · see citing works
“However, germline activity of L1 is a major source of human structural polymorphisms 3 .”
A type I interferon autocrine–paracrine loop is involved in Toll-like receptor-induced interleukin-12p70 secretion by dendritic cells
Gautier, G., Humbert, M., Deauvieau, F., Scuiller, M., Hiscott, J. B., Bates, E. E. M., Trinchieri, G., Caux, C., & Garrone, P. (2005) · The Journal of Experimental Medicine · doi:10.1084/jem.20041964 · Cited by 537 · cited 1× · see citing works
“Sequences of primers corresponding to a consensus of all the murine IFN alpha genes, as well as to the IFNB1 gene, were obtained from the publication by Gautier et al. 41 .”
Methods to Detect Biomarkers of Cellular Senescence
Itahana, K., Campisi, J., & Dimri, G. P. (2007) · Methods in molecular biology · doi:10.1007/978-1-59745-361-5_3 · Cited by 516 · cited 1× · see citing works
“Co-staining of SA-β -Gal activity and ORF1 protein in liver sections was performed by staining for SA-β -Gal first as described 66 .”
Genomes of replicatively senescent cells undergo global epigenetic changes leading to gene silencing and activation of transposable elements
De Cecco, M., Criscione, S. W., Peckham, E. J., Hillenmeyer, S., Hamm, E. A., Manivannan, J., Peterson, A. L., Kreiling, J. A., Neretti, N., & Sedivy, J. M. (2013) · Aging Cell · doi:10.1111/acel.12047 · Cited by 459 · see citing works
Self-citation
SIRT6 represses LINE1 retrotransposons by ribosylating KAP1 but this repression fails with stress and age
Van Meter, M., Kashyap, M., Rezazadeh, S., Geneva, A. J., Morello, T. D., Seluanov, A., & Gorbunova, V. (2014) · Nature Communications · doi:10.1038/ncomms6011 · Cited by 455 · see citing works
Self-citation
Active Transposition in Genomes
Huang, C. R. L., Burns, K. H., & Boeke, J. D. (2012) · Annual Review of Genetics · doi:10.1146/annurev-genet-110711-155616 · Cited by 412 · cited 1× · see citing works
“RTE activity can promote aberrant transcription, alternative splicing, insertional mutagenesis, DNA damage and genome instability 1 .”
Self-citation
Evidence of genetic enrichment for exceptional survival using a family approach: the Leiden Longevity Study
Schoenmaker, M., de Craen, A. J. M., de Meijer, P. H. E. M., Beekman, M., Blauw, G. J., Slagboom, P. E., & Westendorp, R. G. J. (2005) · European Journal of Human Genetics · doi:10.1038/sj.ejhg.5201508 · Cited by 363 · cited 2× · see citing works
“These specimens were collected as part of the ongoing Leiden Longevity Study 62 .”
Self-citation
Inflammaging decreases adaptive and innate immune responses in mice and humans
Frasca, D., & Blomberg, B. B. (2016) · Biogerontology · doi:10.1007/s10522-015-9578-8 · Cited by 357 · cited 1× · see citing works
“Longer term treatments (from 20 to 26 months of age) were effective at opposing several known phenotypes of aging: macrophage infiltration of tissues, a hallmark of chronic inflammation 23,25 , glomerulosclerosis of the kidney 26 and skeletal muscle atrophy 27 (Fig.”
Downregulation of cytoplasmic DNases is implicated in cytoplasmic DNA accumulation and SASP in senescent cells
Takahashi, A., Loo, T. M., Okada, R., Kamachi, F., Watanabe, Y., Wakita, M., Watanabe, S., Kawamoto, S., Miyata, K., Barber, G. N., et al. (2018) · Nature Communications · doi:10.1038/s41467-018-03555-8 · Cited by 350 · cited 1× · see citing works
“Cytoplasmic DNA can originate from several sources, such as mtDNA released from stressed mitochondria 28 or cytoplasmic chromatin fragments (CCF) released from damaged nuclei 29,30 .”
Long Interspersed Element-1 Protein Expression Is a Hallmark of Many Human Cancers
Rodić, N., Sharma, R., Sharma, R. B., Zampella, J. G., Dai, L., Taylor, M. S., Hruban, R. H., Iacobuzio–Donahue, C. A., Maitra, A., Torbenson, M. S., et al. (2014) · American Journal Of Pathology · doi:10.1016/j.ajpath.2014.01.007 · Cited by 349 · cited 2× · see citing works
“Increasing evidence points to RTE activation in some cancers, in the adult brain, and during aging 4–7 .”
Self-citation
The enemy within: endogenous retroelements and autoimmune disease
Volkman, H. E., & Stetson, D. B. (2014) · Nature Immunology · doi:10.1038/ni.2872 · Cited by 333 · cited 1× · see citing works
“L1 elements can stimulate an IFN-I response 9 .”
Modeling of TREX1-dependent autoimmune disease using human stem cells highlights L1 accumulation as a source of neuroinflammation
Thomas, C. A., Tejwani, L., Trujillo, C. A., Negraes, P. D., Herai, R. H., Mesci, P., Macia, A., Crow, Y. J., & Muotri, A. R. (2017) · Cell Stem Cell · doi:10.1016/j.stem.2017.07.009 · Cited by 330 · cited 11× · see citing works
“>200 cells were examined for each condition (a.f.u., arbitrary fluorescence units). i, The L1 shRNA treatment in the experiment in (g) was substituted with 3TC treatment (10 μM) for the same period of time. j, Five different NRTIs (or combinations) were tested for effects on the IFN-I response.”
Influential
Pharmacologic Inhibition of Cyclin-Dependent Kinases 4 and 6 Arrests the Growth of Glioblastoma Multiforme Intracranial Xenografts
Michaud, K., Solomon, D. A., Oermann, E. K., Kim, J.-S., Zhong, W.-Z., Prados, M. D., Ozawa, T., James, C. D., & Waldman, T. A. (2010) · Cancer Research · doi:10.1158/0008-5472.can-09-4559 · Cited by 321 · cited 1× · see citing works
“Primers were designed to distinguishing 5’UTR polymorphisms of the MdA, MdN and Tf families (Methods, Supplementary Table 1 primer sets 51–53).”
Transcriptional landscape of repetitive elements in normal and cancer human cells
Criscione, S. W., Zhang, Y., Thompson, W., Sedivy, J., & Neretti, N. (2014) · BMC Genomics · doi:10.1186/1471-2164-15-583 · Cited by 293 · cited 1× · see citing works
“The mappable clones were also assigned to individual L1 families using RepEnrich software 55 .”
Self-citation
The number of p16INK4a positive cells in human skin reflects biological age
Waaijer, M. E. C., Parish, W. E., Strongitharm, B. H., van Heemst, D., Slagboom, P. E., de Craen, A. J. M., Sedivy, J. M., Westendorp, R. G. J., Gunn, D. A., & Maier, A. B. (2012) · Aging Cell · doi:10.1111/j.1474-9726.2012.00837.x · Cited by 264 · cited 1× · see citing works
“Human skin specimens were collected as part of the Leiden Longevity Study 62,63 and were provided by P. Eline Slagboom, Leiden University Medical Centre, Netherlands.”
Self-citation
Mobile DNA elements in the generation of diversity and complexity in the brain
Erwin, J. A., Marchetto, M. C., & Gage, F. H. (2014) · Nature reviews. Neuroscience · doi:10.1038/nrn3730 · Cited by 264 · see citing works
Nucleoside reverse transcriptase inhibitors possess intrinsic anti-inflammatory activity
Fowler, B. J., Gelfand, B. D., Kim, Y., Kerur, N., Tarallo, V., Hirano, Y., Amarnath, S., Fowler, D. H., Radwan, M., Young, M. T., et al. (2014) · Science · doi:10.1126/science.1261754 · Cited by 225 · cited 3× · see citing works
“At high concentrations (100 μM) K-9 had some inhibitory activity on markers of inflammation, as reported 18 (Extended Data Fig.”
Self-citation
Primate-Specific ORF0 Contributes to Retrotransposon-Mediated Diversity
Denli, A. M., Narvaiza, I., Kerman, B. E., Pena, M., Benner, C. W., Marchetto, M. C., Diedrich, J. K., Aslanian, A., Ma, J., Moresco, J. J., et al. (2015) · Cell · doi:10.1016/j.cell.2015.09.025 · Cited by 223 · cited 18× · see citing works
“Conversely, knockdown of FOXA1 reduced its binding to the L1 5’UTR (Extended Data Fig.”
Influential
A YY1-binding site is required for accurate human LINE-1 transcription initiation
Athanikar, J. N. (2004) · Nucleic Acids Research · doi:10.1093/nar/gkh698 · Cited by 200 · see citing works
Stable Cellular Senescence Is Associated with Persistent DDR Activation
Fumagalli, M., Rossiello, F., Mondello, C., & d’Adda di Fagagna, F. (2014) · PLoS ONE · doi:10.1371/journal.pone.0110969 · Cited by 183 · cited 1× · see citing works
“At point B (4 weeks) the cultures were trypsinized and replated as described 35 to eliminate a small fraction of persisting contact-inhibited cells.”
Ionizing radiation-induced long-term expression of senescence markers in mice is independent of p53 and immune status
Le, O. N. L., Rodier, F., Fontaine, F., Coppe, J., Campisi, J., DeGregori, J., Laverdière, C., Kokta, V., Haddad, E., & Beauséjour, C. M. (2010) · Aging Cell · doi:10.1111/j.1474-9726.2010.00567.x · Cited by 168 · cited 1× · see citing works
“Non-lethal total body irradiation (6 Gy) was performed by the group of Christian Beauséjour as described 38 and tissue specimens were shipped to Brown University on dry ice.”
An RB-EZH2 Complex Mediates Silencing of Repetitive DNA Sequences
Ishak, C. A., Marshall, A. E., Passos, D. T., White, C. R., Kim, S. J., Cecchini, M. J., Ferwati, S., MacDonald, W. A., Howlett, C. J., Welch, I. D., et al. (2016) · Molecular Cell · doi:10.1016/j.molcel.2016.10.021 · Cited by 167 · cited 1× · see citing works
“RB1 has been shown to bind to repetitive elements, including L1s, and promote their heterochromatinization 12 .”
Age‐associated increase in heterochromatic marks in murine and primate tissues
Kreiling, J. A., Tamamori‐Adachi, M., Sexton, A. N., Jeyapalan, J. C., Munoz‐Najar, U., Peterson, A. L., Manivannan, J., Rogers, E. S., Pchelintsev, N. A., Adams, P. D., et al. (2011) · Aging Cell · doi:10.1111/j.1474-9726.2010.00666.x · Cited by 152 · cited 2× · see citing works
“All microscope settings were set to collect images below saturation and were kept constant for all images taken in one experiment, as previously described 61 .”
Self-citation
Effect of reverse transcriptase inhibitors on LINE-1 and Ty1 reverse transcriptase activities and on LINE-1 retrotransposition
Dai, L., Huang, Q., & Boeke, J. D. (2011) · BMC Biochemistry · doi:10.1186/1471-2091-12-18 · Cited by 131 · cited 1× · see citing works
“Some NRTIs developed against HIV have been found to also inhibit L1 RT activity 15 .”
Self-citation
Cytosolic sensing of immuno-stimulatory DNA, the enemy within
Dhanwani, R., Takahashi, M., & Sharma, S. (2018) · Current Opinion in Immunology · doi:10.1016/j.coi.2017.11.004 · Cited by 123 · cited 6× · see citing works
“The absolute average retrotransposition frequency (percentage of GFP-positive cells) was 4.1, which matches the published values for the reporter used (pLD143) 53 . l, Knockdowns of cGAS and STING were performed in senescent or 3X cells as with the other shRNAs (Fig.”
Influential
Perspective: Does brown fat protect against diseases of aging?
Mattson, M. P. (2009) · Ageing Research Reviews · doi:10.1016/j.arr.2009.11.004 · Cited by 112 · cited 1× · see citing works
“Decreased adipogenesis 23 and thermogenesis 24 are features of natural aging and both were increased in old animals by 2 weeks of 3TC treatment (Extended Data Fig.”
L1Base: from functional annotation to prediction of active LINE-1 elements
Penzkofer, T. (2004) · Nucleic Acids Research · doi:10.1093/nar/gki044 · Cited by 108 · see citing works
Analysis of cell cycle phases and progression in cultured mammalian cells
Schorl, C., & Sedivy, J. M. (2006) · Methods · doi:10.1016/j.ymeth.2006.07.022 · Cited by 104 · see citing works
Self-citation
Many LINE1 elements contribute to the transcriptome of human somatic cells
Rangwala, S. H., Zhang, L., & Kazazian, H. H. (2009) · Genome Biology · doi:10.1186/gb-2009-10-9-r100 · Cited by 102 · see citing works
Characterization of L1 retrotransposition with high-throughput dual-luciferase assays
Xie, Y., Rosser, J. M., Thompson, T. L., Boeke, J. D., & An, W. (2011) · Nucleic Acids Research · doi:10.1093/nar/gkq1076 · Cited by 98 · cited 2× · see citing works
“3TC was administered continuously from SEN entry until harvest 16 weeks later. e, The dual luciferase L1 reporter system 52 was used to determine the effect of 3TC dosing on retrotransposition.”
Self-citation
Characterization of a synthetic human LINE-1 retrotransposon ORFeus-Hs
An, W., Dai, L., Niewiadomska, A. M., Yetil, A., O'Donnell, K. A., Han, J. S., & Boeke, J. D. (2011) · Mobile DNA · doi:10.1186/1759-8753-2-2 · Cited by 67 · cited 1× · see citing works
“Primers were designed to distinguishing 5’UTR polymorphisms of the MdA, MdN and Tf families (Methods, Supplementary Table 1 primer sets 51–53).”
Self-citation
Imaging White Adipose Tissue with Confocal Microscopy
Martinez-Santibañez, G., Cho, K. W., & Lumeng, C. N. (2014) · Methods in Enzymology · doi:10.1016/b978-0-12-411619-1.00002-1 · Cited by 64 · cited 1× · see citing works
“Imaging of whole-mount white adipose tissue followed the method described by Martinez-Santibañez et al. (2014) 65 .”
FOXA1 mediates p16INK4a activation during cellular senescence
Li, Q., Zhang, Y., Fu, J., Han, L., Xue, L., Lv, C., Wang, P., Li, G., & Tong, T. (2013) · The EMBO Journal · doi:10.1038/emboj.2013.35 · Cited by 49 · see citing works
Pharmacokinetics of Lamivudine and Lamivudine-Triphosphate after Administration of 300 Milligrams and 150 Milligrams Once Daily to Healthy Volunteers: Results of the ENCORE 2 Study
Else, L., Jackson, A., Puls, R. L., et al. (2011) · Antimicrobial Agents and Chemotherapy · doi:10.1128/aac.05599-11 · Cited by 37 · cited 2× · see citing works
“This dose of drug was chosen for further experiments to mimic the human HIV therapeutic dose (300 mg per day, 5–8 μM in plasma) 37 .”
Sense transcripts originated from an internal part of the human retrotransposon LINE-1 5′ UTR
Alexandrova, E., Olovnikov, I. A., Malakhova, G., Zabolotneva, A. A., Suntsova, M., Dmitriev, S. E., & Buzdin, A. A. (2012) · Gene · doi:10.1016/j.gene.2012.09.026 · Cited by 25 · cited 2× · see citing works
“Luciferase and β -galactosidase assays were performed as described 49 .”
[A key role of the internal region of the 5'-untranslated region in the human L1 retrotransposon transcription activity].
Olovnikov, I. A., Adyanova, Z. V., Galimov, E. R., et al. (2007) · PubMed · Cited by 8 · see citing works
Key role of the internal 5′-UTR segment in the transcription activity of the human L1 retrotransposon
Olovnikov, I. A., Adyanova, Z. V., Galimov, E. R., Andreev, D. E., Terenin, I. M., Ivanov, D. S., Prassolov, V., & Dmitriev, S. E. (2007) · Molecular Biology · doi:10.1134/s0026893307030119 · Cited by 7 · see citing works

Flagged first, then by citations

2 of the 70 references couldn’t be matched to a known paper.

Research works printed but not linked: 1

Kreiling, J. A. et al. in Human Retrotransposons in Health and Disease (ed. Cristofari, G.) 297–321 (Springer International, New York, 2017).

Sorted by citations

Hallmarks of aging: An expanding universe
López-Otín, C., Blasco, M. A., Partridge, L., Serrano, M., & Kroemer, G. (2023) · Cell · doi:10.1016/j.cell.2022.11.001 · Cited by 6,549 · see citing works
Cellular Senescence: Defining a Path Forward
Gorgoulis, V., Adams, P. D., Alimonti, A., Bennett, D. C., Bischof, O., Bishop, C., Campisi, J., Collado, M., Evangelou, K., Ferbeyre, G., et al. (2019) · Cell · doi:10.1016/j.cell.2019.10.005 · Cited by 3,225 · see citing works
Self-citation
The cGAS–STING pathway as a therapeutic target in inflammatory diseases
Decout, A., Katz, J. D., Venkatraman, S., & Ablasser, A. (2021) · Nature Reviews Immunology · doi:10.1038/s41577-021-00524-z · Cited by 2,309 · see citing works
Cellular senescence in ageing: from mechanisms to therapeutic opportunities
Di Micco, R., Krizhanovsky, V., Baker, D., & d’Adda di Fagagna, F. (2021) · Nature Reviews Molecular Cell Biology · doi:10.1038/s41580-020-00314-w · Cited by 2,277 · see citing works
Mechanisms of Cellular Senescence: Cell Cycle Arrest and Senescence Associated Secretory Phenotype
Kumari, R., & Jat, P. (2021) · Frontiers in Cell and Developmental Biology · doi:10.3389/fcell.2021.645593 · Cited by 1,622 · see citing works
Senolytic drugs: from discovery to translation
Kirkland, J. L., & Tchkonia, T. (2020) · Journal of Internal Medicine · doi:10.1111/joim.13141 · Cited by 1,227 · see citing works
Senescence and the SASP: many therapeutic avenues
Birch, J., & Gil, J. (2020) · Genes & Development · doi:10.1101/gad.343129.120 · Cited by 1,177 · see citing works
“Moreover, in very late replicative, stress, and OIS cells, the SASP becomes characterized by the expression of type-I interferons (IFN-I) (De Cecco et al. 2019).”
BackgroundInfluential
Cellular senescence and senolytics: the path to the clinic
Chaib, S., Tchkonia, T., & Kirkland, J. L. (2022) · Nature Medicine · doi:10.1038/s41591-022-01923-y · Cited by 1,105 · see citing works
cGAS–STING drives ageing-related inflammation and neurodegeneration
Gulen, M. F., Samson, N., Keller, A., Schwabenland, M., Liu, C., Glück, S., Thacker, V. V., Favre, L., Mangeat, B., Kroese, L. J., et al. (2023) · Nature · doi:10.1038/s41586-023-06373-1 · Cited by 1,074 · see citing works
Unmasking senescence: context-dependent effects of SASP in cancer
Faget, D. V., Ren, Q., & Stewart, S. A. (2019) · Nature Reviews Cancer · doi:10.1038/s41568-019-0156-2 · Cited by 863 · see citing works
How the ageing microenvironment influences tumour progression
Fane, M., & Weeraratna, A. T. (2020) · Nature Reviews Cancer · doi:10.1038/s41568-019-0222-9 · Cited by 849 · see citing works
The senescence-associated secretory phenotype and its physiological and pathological implications
Wang, B., Han, J., Elisseeff, J. H., & Demaria, M. (2024) · Nature Reviews Molecular Cell Biology · doi:10.1038/s41580-024-00727-x · Cited by 948 · see citing works
The metabolic roots of senescence: mechanisms and opportunities for intervention
Wiley, C. D., & Campisi, J. (2021) · Nature Metabolism · doi:10.1038/s42255-021-00483-8 · Cited by 691 · see citing works
Apoptotic stress causes mtDNA release during senescence and drives the SASP
Victorelli, S. G., Salmonowicz, H., Chapman, J., Martini, H., Vizioli, M. G., Riley, J. S., Cloix, C., Hall-Younger, E., Espíndola‐Netto, J. M., Jurk, D., et al. (2023) · Nature · doi:10.1038/s41586-023-06621-4 · Cited by 696 · see citing works
“Several reports indicate that nucleus-derived CCFs and activation of retrotransposons have a role in senescence and the SASP by activating the DNA-sensing cGAS–STING pathway 13,14,40 .”
The cGAS–STING pathway and cancer
Samson, N., & Ablasser, A. (2022) · Nature Cancer · doi:10.1038/s43018-022-00468-w · Cited by 705 · see citing works
Loss of epigenetic information as a cause of mammalian aging
Yang, J.-H., Hayano, M., Griffin, P. T., Amorim, J. A., Bonkowski, M. S., Apostolides, J. K., Salfati, E. L., Blanchette, M., Munding, E. M., Bhakta, M., et al. (2023) · Cell · doi:10.1016/j.cell.2022.12.027 · Cited by 643 · see citing works
Self-citation
Pathogenesis of sarcopenia and the relationship with fat mass: descriptive review
Li, C., Yu, K., Shyh‐Chang, N., Jiang, Z., Liu, T., Ma, S., Luo, L., Guang, L., Liang, K., Ma, W., et al. (2022) · Journal of Cachexia, Sarcopenia and Muscle · doi:10.1002/jcsm.12901 · Cited by 626 · see citing works
“growth factors, and extracellular matrix (ECM) degrading proteins.([58]) SASP is thought to have evolved as an adaptive”
Background
Cellular senescence: a key therapeutic target in aging and diseases
Zhang, L., Pitcher, L. E., Yousefzadeh, M. J., Niedernhofer, L. J., Robbins, P. D., & Zhu, Y. (2022) · Journal of Clinical Investigation · doi:10.1172/jci158450 · Cited by 631 · see citing works
“Epigenetic changes in SnCs create an environment that is permissive to the deregulation of transposable elements like LINE-1, whose increased expression is observed in late senescence (24, 25).”
Background
Sexual-dimorphism in human immune system aging
Márquez, E. J., Chung, C.-H., Marches, R., Rossi, R. J., Nehar-Belaid, D., Eroglu, A., Mellert, D. J., Kuchel, G. A., Banchereau, J., & Ucar, D. (2020) · Nature Communications · doi:10.1038/s41467-020-14396-9 · Cited by 584 · see citing works
Antitumor activity of a systemic STING-activating non-nucleotide cGAMP mimetic
Chin, E. N., Yu, C., Vartabedian, V. F., Jia, Y., Kumar, M. N. S., Gamo, A. M., Vernier, W. F., Ali, S. H., Kissai, M., Lazar, D. C., et al. (2020) · Science · doi:10.1126/science.abb4255 · Cited by 560 · see citing works
The role of cellular senescence in ageing and endocrine disease
Khosla, S., Farr, J. N., Tchkonia, T., & Kirkland, J. L. (2020) · Nature Reviews Endocrinology · doi:10.1038/s41574-020-0335-y · Cited by 523 · see citing works
Single-cell analysis reveals T cell infiltration in old neurogenic niches
Dulken, B. W., Buckley, M. T., Navarro Negredo, P., Saligrama, N., Cayrol, R., Leeman, D. S., George, B. M., Boutet, S. C., Hebestreit, K., Pluvinage, J. V., et al. (2019) · Nature · doi:10.1038/s41586-019-1362-5 · Cited by 521 · see citing works
Strategies for targeting senescent cells in human disease
Gasek, N. S., Kuchel, G. A., Kirkland, J. L., & Xu, M. (2021) · Nature Aging · doi:10.1038/s43587-021-00121-8 · Cited by 501 · see citing works
Mechanisms and consequences of endothelial cell senescence
Bloom, S. I., Islam, M. T., Lesniewski, L. A., & Donato, A. J. (2022) · Nature Reviews Cardiology · doi:10.1038/s41569-022-00739-0 · Cited by 512 · see citing works
The quest to slow ageing through drug discovery
Partridge, L., Fuentealba, M., & Kennedy, B. K. (2020) · Nature Reviews Drug Discovery · doi:10.1038/s41573-020-0067-7 · Cited by 468 · see citing works
The ageing epigenome and its rejuvenation
Zhang, W., Qu, J. T., Liu, G., & Belmonte, J. C. I. (2020) · Nature Reviews Molecular Cell Biology · doi:10.1038/s41580-019-0204-5 · Cited by 472 · see citing works
Acceleration of β Cell Aging Determines Diabetes and Senolysis Improves Disease Outcomes
Aguayo-Mazzucato, C., Andle, J., Lee, T. B., Midha, A., Talemal, L., Chipashvili, V., Hollister-Lock, J., van Deursen, J., Weir, G., & Bonner-Weir, S. (2019) · Cell Metabolism · doi:10.1016/j.cmet.2019.05.006 · Cited by 469 · see citing works
The role of retrotransposable elements in ageing and age-associated diseases
Gorbunova, V., Seluanov, A., Mita, P., McKerrow, W., Fenyö, D., Boeke, J. D., Linker, S. B., Gage, F. H., Kreiling, J. A., Petrashen, A. P., et al. (2021) · Nature · doi:10.1038/s41586-021-03542-y · Cited by 457 · see citing works
Self-citation
Chronic inflammation and the hallmarks of aging
Baechle, J. J., Chen, N., Makhijani, P., Winer, S., Furman, D., & Winer, D. A. (2023) · Molecular Metabolism · doi:10.1016/j.molmet.2023.101755 · Cited by 471 · see citing works
“[53] De Cecco M, Ito T, Petrashen AP, Elias AE, Skvir NJ, Criscione SW, et al.”
Background
Senolysis by glutaminolysis inhibition ameliorates various age-associated disorders
Johmura, Y., Yamanaka, T., Omori, S., Wang, T.-W., Sugiura, Y., Matsumoto, M., Suzuki, N., Kumamoto, S., Yamaguchi, K., Hatakeyama, S., et al. (2021) · Science · doi:10.1126/science.abb5916 · Cited by 440 · see citing works
Senescence atlas reveals an aged-like inflamed niche that blunts muscle regeneration
Moiseeva, V., Cisneros, A., Sica, V., Deryagin, O., Lai, Y., Jung, S., Andrés, E., An, J., Segalés, J., Ortet, L., et al. (2023) · Nature · doi:10.1038/s41586-022-05535-x · Cited by 423 · see citing works
Whole‐body senescent cell clearance alleviates age‐related brain inflammation and cognitive impairment in mice
Ogrodnik, M., Evans, S. A., Fielder, E., Victorelli, S., Kruger, P., Salmonowicz, H., Weigand, B. M., Patel, A. D., Pirtskhalava, T., Inman, C. L., et al. (2021) · Aging Cell · doi:10.1111/acel.13296 · Cited by 405 · see citing works
“SASP lists were obtained from De Cecco et al. (2019).”
Self-citation
The landscape of aging
Cai, Y., Song, W., Li, J., Jing, Y., Liang, C., Zhang, L., Zhang, X., Zhang, W., Liu, B., An, Y., et al. (2022) · Science China Life Sciences · doi:10.1007/s11427-022-2161-3 · Cited by 436 · see citing works
Mechanisms and Regulation of Cellular Senescence
Roger, L., Tomas, F., & Gire, V. (2021) · International Journal of Molecular Sciences · doi:10.3390/ijms222313173 · Cited by 395 · see citing works
“Alternatively, an increase in the transcription of long-interspersed element-1 (LINE-1 or L1), the only human retro-transposable element, during senescence could partly contribute to the accumulation of DNA fragments in the cytoplasm [177].”
BackgroundInfluential
SenNet recommendations for detecting senescent cells in different tissues
Suryadevara, V., Hudgins, A. D., Rajesh, A., Pappalardo, A., Karpova, A., Dey, A. K., Hertzel, A., Agudelo, A., Rocha, A., Soygur, B., et al. (2024) · Nature Reviews Molecular Cell Biology · doi:10.1038/s41580-024-00738-8 · Cited by 408 · see citing works
“Studies on aged mouse hepatocytes have shown the presence of senescence-associated markers such as SA-β-gal activity 157 , TAF 54,158 , karyomegaly and SADS 159 , LINE-1 expression 23 and expression of SASP factors 141 .”
Self-citation
Inflammation, epigenetics, and metabolism converge to cell senescence and ageing: the regulation and intervention
Zhu, X., Chen, Z., Shen, W., Huang, G., Sedivy, J. M., Wang, H., & Ju, Z. (2021) · Signal Transduction and Targeted Therapy · doi:10.1038/s41392-021-00646-9 · Cited by 410 · see citing works
Self-citation
From geroscience to precision geromedicine: Understanding and managing aging
Kroemer, G., Maier, A. B., Cuervo, A. M., Gladyshev, V. N., Ferrucci, L., Gorbunova, V., Kennedy, B. K., Rando, T. A., Seluanov, A., Sierra, F., et al. (2025) · Cell · doi:10.1016/j.cell.2025.03.011 · Cited by 395 · see citing works
Self-citation
Resurrection of endogenous retroviruses during aging reinforces senescence
Liu, X., Liu, Z., Wu, Z., Ren, J., Fan, Y., Sun, L., Cao, G., Niu, Y., Zhang, B., Ji, Q., et al. (2023) · Cell · doi:10.1016/j.cell.2022.12.017 · Cited by 390 · see citing works
Measuring and interpreting transposable element expression
Lanciano, S., & Cristofari, G. (2020) · Nature Reviews Genetics · doi:10.1038/s41576-020-0251-y · Cited by 390 · see citing works
Transcriptionally active HERV-H retrotransposons demarcate topologically associating domains in human pluripotent stem cells
Zhang, Y., Li, T., Preißl, S., Amaral, M. L., Grinstein, J. D., Farah, E. N., Destici, E., Qiu, Y., Hu, R., Lee, A. Y., et al. (2019) · Nature Genetics · doi:10.1038/s41588-019-0479-7 · Cited by 367 · see citing works
DNA damage and repair in age-related inflammation
Zhao, Y., Simon, M. A., Seluanov, A., & Gorbunova, V. A. (2022) · Nature reviews. Immunology · doi:10.1038/s41577-022-00751-y · Cited by 393 · see citing works
Self-citation
Biomarkers of aging
Bao, H., Cao, J., Chen, M., Min, C., Chen, W., Chen, X., Chen, Y., Chen, Y., Chen, Y., Chen, Z., et al. (2023) · Science China Life Sciences · doi:10.1007/s11427-023-2305-0 · Cited by 389 · see citing works
Guidelines for minimal information on cellular senescence experimentation in vivo
Ogrodnik, M., Carlos Acosta, J., Adams, P. D., d’Adda di Fagagna, F., Baker, D. J., Bishop, C. L., Chandra, T., Collado, M., Gil, J., Gorgoulis, V., et al. (2024) · Cell · doi:10.1016/j.cell.2024.05.059 · Cited by 376 · see citing works
Self-citation
Transposable elements in human genetic disease
Payer, L. M., & Burns, K. H. (2019) · Nature Reviews Genetics · doi:10.1038/s41576-019-0165-8 · Cited by 344 · see citing works
Cellular aging beyond cellular senescence: Markers of senescence prior to cell cycle arrest in vitro and in vivo
Ogrodnik, M. (2021) · Aging Cell · doi:10.1111/acel.13338 · Cited by 349 · see citing works
New frontiers in the cGAS-STING intracellular DNA-sensing pathway
Dvorkin, S., Cambier, S., Volkman, H. E., & Stetson, D. B. (2024) · Immunity · doi:10.1016/j.immuni.2024.02.019 · Cited by 377 · see citing works
CD38 ecto-enzyme in immune cells is induced during aging and regulates NAD+ and NMN levels
Chini, C. C. S., Peclat, T. R., Warner, G. M., Kashyap, S., Espindola-Netto, J. M., de Oliveira, G. C., Gomez, L. S., Hogan, K. A., Tarragó, M. G., Puranik, A. S., et al. (2020) · Nature Metabolism · doi:10.1038/s42255-020-00298-z · Cited by 349 · see citing works
Self-citation
Cytoplasmic DNA: sources, sensing, and role in aging and disease
Miller, K. N., Victorelli, S. G., Salmonowicz, H., Dasgupta, N., Liu, T., Passos, J. F., & Adams, P. D. (2021) · Cell · doi:10.1016/j.cell.2021.09.034 · Cited by 288 · see citing works
The roles and mechanisms of senescence-associated secretory phenotype (SASP): can it be controlled by senolysis?
Ohtani, N. (2022) · Inflammation and Regeneration · doi:10.1186/s41232-022-00197-8 · Cited by 306 · see citing works
“Moreover, the accumulated cytoplasmic cDNAs produced from LINE-1 retrotransposons have also been linked to aging-associated chronic inflammation [34].”
BackgroundInfluential
Host–transposon interactions: conflict, cooperation, and cooptionPreprint
Cosby, R. L., Chang, N., & Feschotte, C. (2019) · Genes & Development · doi:10.1101/gad.327312.119 · Cited by 286 · see citing works
“…are associatedwith and increasingly recognized as directly contributing to various disease states, including cancer, senescence, and chronic inflammation (Lee et al. 2012a; Tubio et al. 2014; Burns 2017; Tang et al. 2017; Bourque et al. 2018; Dubnau 2018; Schauer et al. 2018; De Cecco et al. 2019).”
Background
Regulation of cGAS–STING signalling and its diversity of cellular outcomes
Zhang, Z., & Zhang, C. (2025) · Nature Reviews Immunology · doi:10.1038/s41577-024-01112-7 · Cited by 287 · see citing works
The Genetics of Aging: A Vertebrate Perspective
Singh, P. P., Demmitt, B. A., Nath, R. D., & Brunet, A. (2019) · Cell · doi:10.1016/j.cell.2019.02.038 · Cited by 259 · see citing works
Reverse-transcribed SARS-CoV-2 RNA can integrate into the genome of cultured human cells and can be expressed in patient-derived tissues
Zhang, L., Richards, A. L., Barrasa, M. I., Hughes, S. H., Young, R. A., & Jaenisch, R. (2021) · Proceedings of the National Academy of Sciences · doi:10.1073/pnas.2105968118 · Cited by 279 · see citing works
“Endogenous LINE1 elements have been shown to be expressed in aged human tissues (35) and LINE1-mediated somatic retro-transposition is common in cancer patients (36, 37).”
Senolytics and senomorphics: Natural and synthetic therapeutics in the treatment of aging and chronic diseases
Lagoumtzi, S. M., & Chondrogianni, N. (2021) · Free Radical Biology and Medicine · doi:10.1016/j.freeradbiomed.2021.05.003 · Cited by 279 · see citing works
Inflammation: the incubator of the tumor microenvironment
Denk, D., & Greten, F. R. (2022) · Trends in cancer · doi:10.1016/j.trecan.2022.07.002 · Cited by 279 · see citing works
Cellular senescence and SASP in tumor progression and therapeutic opportunities
Dong, Z., Luo, Y., Yuan, Z., Tian, Y., Jin, T., & Feng, X. (2024) · Molecular Cancer · doi:10.1186/s12943-024-02096-7 · Cited by 292 · see citing works
Emerging role of STING signalling in CNS injury: inflammation, autophagy, necroptosis, ferroptosis and pyroptosis
Hu, X., Zhang, H., Zhang, Q., Yao, X. X., Ni, W., & Zhou, K. (2022) · Journal of Neuroinflammation · doi:10.1186/s12974-022-02602-y · Cited by 256 · see citing works
Roles of JAK2 in Aging, Inflammation, Hematopoiesis and Malignant Transformation
Perner, F., Perner, C., Ernst, T., & Heidel, F. H. (2019) · Cells · doi:10.3390/cells8080854 · Cited by 247 · see citing works
Cellular senescence at the crossroads of inflammation and Alzheimer's disease
Guerrero, A., De Strooper, B., & Arancibia-Cárcamo, I. L. (2021) · Trends in Neurosciences · doi:10.1016/j.tins.2021.06.007 · Cited by 236 · see citing works
Cellular senescence and senescence-associated secretory phenotype via the cGAS-STING signaling pathway in cancer
Loo, T. M., Miyata, K., Tanaka, Y., & Takahashi, A. (2020) · Cancer Science · doi:10.1111/cas.14266 · Cited by 232 · see citing works
Loss of Nuclear TDP-43 Is Associated with Decondensation of LINE Retrotransposons
Liu, E. Y., Russ, J., Cali, C. P., Phan, J. M., Amlie-Wolf, A., & Lee, E. B. (2019) · Cell Reports · doi:10.1016/j.celrep.2019.04.003 · Cited by 231 · see citing works
Classical and Nonclassical Intercellular Communication in Senescence and Ageing
Fafián‐Labora, J., & O’Loghlen, A. (2020) · Trends in Cell Biology · doi:10.1016/j.tcb.2020.05.003 · Cited by 230 · see citing works
Targeting immune dysfunction in aging
Borgoni, S., Kudryashova, K. S., Burka, K., & de Magalhães, J. P. (2021) · Ageing Research Reviews · doi:10.1016/j.arr.2021.101410 · Cited by 227 · see citing works
Senescence‐associated β‐galactosidase reveals the abundance of senescent CD8+ T cells in aging humans
Martínez‐Zamudio, R. I., Dewald, H. K., Vasilopoulos, T., Gittens‐Williams, L., Fitzgerald‐Bocarsly, P., & Herbig, U. (2021) · Aging Cell · doi:10.1111/acel.13344 · Cited by 213 · see citing works
“…processes consistent with a senescence response in the yellow module, including “p53 pathway,” “inflammatory response,” and “TGFβ signaling,” many of which overlapped with pathways also activated in senescent human fibroblasts (De Cecco et al., 2019; Martínez- Zamudio et al., 2020) (Figure S4e,f).”
BackgroundMethodInfluential
Inflammation and DNA damage: cause, effect or both
Pezone, A., Olivieri, F., Napoli, M. V., Procopio, A., Avvedimento, E. V., & Gabrielli, A. (2023) · Nature Reviews Rheumatology · doi:10.1038/s41584-022-00905-1 · Cited by 212 · see citing works
The commensal skin microbiota triggers type I IFN–dependent innate repair responses in injured skin
Domizio, J. D., Belkhodja, C., Chenuet, P., Fries, A., Murray, T. J., Mondéjar, P. M., Demaria, O., Conrad, C., Homey, B., Werner, S., et al. (2020) · Nature Immunology · doi:10.1038/s41590-020-0721-6 · Cited by 201 · see citing works
ER-directed TREX1 limits cGAS activation at micronuclei
Mohr, L., Toufektchan, E., von Morgen, P., Chu, K., Kapoor, A. R., & Maciejowski, J. (2021) · Molecular Cell · doi:10.1016/j.molcel.2020.12.037 · Cited by 207 · see citing works
Identifying transposable element expression dynamics and heterogeneity during development at the single-cell level with a processing pipeline scTE
He, J., Babarinde, I. A., Sun, L., Xu, S., Chen, R., Shi, J., Wei, Y., Li, Y., Ma, G., Zhuang, Q., et al. (2021) · Nature Communications · doi:10.1038/s41467-021-21808-x · Cited by 197 · see citing works
Bone Aging, Cellular Senescence, and Osteoporosis
Pignolo, R. J., Law, S. F., & Chandra, A. (2021) · JBMR Plus · doi:10.1002/jbm4.10488 · Cited by 206 · see citing works
A single-cell transcriptomic landscape of the lungs of patients with COVID-19
Wang, S., Yao, X., Ma, S., Ping, Y., Fan, Y., Sun, S., He, Z., Shi, Y., Sun, L., Xiao, S., et al. (2021) · Nature Cell Biology · doi:10.1038/s41556-021-00796-6 · Cited by 191 · see citing works
Generation of a p16 Reporter Mouse and Its Use to Characterize and Target p16high Cells In Vivo
Omori, S., Wang, T.-W., Johmura, Y., Kanai, T., Nakano, Y., Kido, T., Susaki, E. A., Nakajima, T., Shichino, S., Ueha, S., et al. (2020) · Cell Metabolism · doi:10.1016/j.cmet.2020.09.006 · Cited by 194 · see citing works
Senescent Cells: Emerging Targets for Human Aging and Age-Related Diseases
Song, S., Lam, E. W.-F., Tchkonia, T., Kirkland, J. L., & Sun, Y. (2020) · Trends in Biochemical Sciences · doi:10.1016/j.tibs.2020.03.008 · Cited by 195 · see citing works
Opposing Roles of Type I Interferons in Cancer Immunity
Boukhaled, G. M., Harding, S. M., & Brooks, D. G. (2020) · Annual Review of Pathology Mechanisms of Disease · doi:10.1146/annurev-pathol-031920-093932 · Cited by 195 · see citing works
Nanopore Sequencing Enables Comprehensive Transposable Element Epigenomic Profiling
Ewing, A. D., Smits, N., Sanchez-Luque, F. J., Faivre, J., Brennan, P. M., Richardson, S. R., Cheetham, S. W., & Faulkner, G. J. (2020) · Molecular Cell · doi:10.1016/j.molcel.2020.10.024 · Cited by 194 · see citing works
Reducing Senescent Cell Burden in Aging and Disease
Pignolo, R. J., Passos, J. F., Khosla, S., Tchkonia, T., & Kirkland, J. L. (2020) · Trends in Molecular Medicine · doi:10.1016/j.molmed.2020.03.005 · Cited by 177 · see citing works
“Transposons (“jumping genes”) can be produced within senescent cells that re-insert into senescent cell DNA, contributing to the senescent cell phenotype and exacerbating their SASP [24, 25].”
Background
Senescent immune cells release grancalcin to promote skeletal aging
Li, C.-J., Xiao, Y., Sun, Y.-C., He, W.-Z., Liu, L., Huang, M., He, C., Huang, M., Chen, K.-X., Hou, J., et al. (2021) · Cell Metabolism · doi:10.1016/j.cmet.2021.08.009 · Cited by 190 · see citing works
Hallmarks of aging and immunosenescence: Connecting the dots
Rodrigues, L. P., Teixeira, V. R., Alencar‐Silva, T., Simonassi-Paiva, B., Pereira, R. W., Pogue, R. E., & Carvalho, J. L. (2021) · Cytokine & Growth Factor Reviews · doi:10.1016/j.cytogfr.2021.01.006 · Cited by 187 · see citing works
m6A-independent genome-wide METTL3 and METTL14 redistribution drives the senescence-associated secretory phenotype
Liu, P., Li, F., Lin, J., Fukumoto, T., Nacarelli, T., Hao, X., Kossenkov, A. V., Simon, M. C., & Zhang, R. (2021) · Nature Cell Biology · doi:10.1038/s41556-021-00656-3 · Cited by 180 · see citing works
Self-citation
Metabolic landscape in cardiac aging: insights into molecular biology and therapeutic implications
Xie, S., Xu, S., Deng, W., & Tang, Q. (2023) · Signal Transduction and Targeted Therapy · doi:10.1038/s41392-023-01378-8 · Cited by 185 · see citing works
“However, Sirt 6-deficient mice showed premature aging and presented a proinflammatory phenotype.(237,238) Both Sirt 1 and Sirt 6 have been found to prevent cardiac aging.”
Background
Cross-talk of inflammation and cellular senescence: a new insight into the occurrence and progression of osteoarthritis
Han, Z., Wang, K., Ding, S., & Zhang, M. (2024) · Bone Research · doi:10.1038/s41413-024-00375-z · Cited by 190 · see citing works
Cellular senescence and the tumour microenvironment
Takasugi, M., Yoshida, Y., & Ohtani, N. (2022) · Molecular Oncology · doi:10.1002/1878-0261.13268 · Cited by 178 · see citing works
Mitochondrial DNA released by senescent tumor cells enhances PMN-MDSC-driven immunosuppression through the cGAS-STING pathway
Lai, P., Liu, L., Bancaro, N., Troiani, M., Calì, B., Li, Y., Chen, J., Singh, P. K., Arzola, R. A., Attanasio, G., et al. (2025) · Immunity · doi:10.1016/j.immuni.2025.03.005 · Cited by 174 · see citing works
The World Goes Bats: Living Longer and Tolerating Viruses
Gorbunova, V., Seluanov, A., & Kennedy, B. K. (2020) · Cell Metabolism · doi:10.1016/j.cmet.2020.06.013 · Cited by 162 · see citing works
Self-citation
Oxylipin biosynthesis reinforces cellular senescence and allows detection of senolysis
Wiley, C. D., Sharma, R., Davis, S. S., Lopez-Dominguez, J. A., Mitchell, K. P., Wiley, S., Alimirah, F., Kim, D. E., Payne, T., Rosko, A., et al. (2021) · Cell Metabolism · doi:10.1016/j.cmet.2021.03.008 · Cited by 173 · see citing works
Age-Related Gene Expression Signature in Rats Demonstrate Early, Late, and Linear Transcriptional Changes from Multiple Tissues
Shavlakadze, T., Morris, M., Fang, J., Wang, S. X., Zhu, J., Zhou, W., Tse, H. W., Mondragon-Gonzalez, R., Roma, G., & Glass, D. J. (2019) · Cell Reports · doi:10.1016/j.celrep.2019.08.043 · Cited by 170 · see citing works
SIRT3 consolidates heterochromatin and counteracts senescence
Diao, Z., Ji, Q., Wu, Z., Zhang, W., Cai, Y., Wang, Z., Hu, J., Liu, Z., Wang, Q., Bi, S., et al. (2021) · Nucleic Acids Research · doi:10.1093/nar/gkab161 · Cited by 171 · see citing works
Nuclear Membrane Rupture and Its Consequences
Maciejowski, J., & Hatch, E. M. (2020) · Annual Review of Cell and Developmental Biology · doi:10.1146/annurev-cellbio-020520-120627 · Cited by 165 · see citing works
“For example, the cytoplasmic nucleases TREX1 and DNase II exhibit marked reductions during senescence (De Cecco et al. 2019, Takahashi et al. 2018).”
Background
Comprehensive human proteome profiles across a 50-year lifespan reveal aging trajectories and signatures
Ding, Y., Zuo, Y., Zhang, B., Fan, Y., Xu, G., Cheng, Z., Ma, S., Fang, S., Tian, A., Gao, D., et al. (2025) · Cell · doi:10.1016/j.cell.2025.06.047 · Cited by 182 · see citing works
Mechanism and therapeutic potential of targeting cGAS-STING signaling in neurological disorders
Huang, Y., Liu, B., Sinha, S. C., Amin, S., & Gan, L. (2023) · Molecular Neurodegeneration · doi:10.1186/s13024-023-00672-x · Cited by 164 · see citing works
Targeting aging mechanisms: pharmacological perspectives
Moskalev, A., Guvatova, Z., Lopes, I. D. A., Beckett, C. W., Kennedy, B. K., De Magalhaes, J. P., & Makarov, A. A. (2022) · Trends in Endocrinology & Metabolism · doi:10.1016/j.tem.2022.01.007 · Cited by 164 · see citing works
The HUSH complex is a gatekeeper of type I interferon through epigenetic regulation of LINE-1s
Tunbak, H., Enriquez-Gasca, R., Tie, C. H. C., Gould, P. A., Mlcochova, P., Gupta, R. K., Fernandes, L., Holt, J., van der Veen, A. G., Giampazolias, E., et al. (2020) · Nature Communications · doi:10.1038/s41467-020-19170-5 · Cited by 162 · see citing works
Time to test antibacterial therapy in Alzheimer’s disease
Panza, F., Lozupone, M., Solfrizzi, V., Watling, M., & Imbimbo, B. P. (2019) · Brain · doi:10.1093/brain/awz244 · Cited by 161 · see citing works
SIRT7 antagonizes human stem cell aging as a heterochromatin stabilizer
Bi, S., Liu, Z., Wu, Z., Wang, Z., Liu, X., Wang, S., Ren, J., Yao, Y., Zhang, W., Song, M., et al. (2020) · Protein & Cell · doi:10.1007/s13238-020-00728-4 · Cited by 160 · see citing works
SIRT6 in Aging, Metabolism, Inflammation and Cardiovascular Diseases
Guo, Z., Li, P., Ge, J., & Li, H. (2022) · Aging and Disease · doi:10.14336/ad.2022.0413 · Cited by 160 · see citing works
Kinetics and mechanisms of mitotic inheritance of DNA methylation and their roles in aging-associated methylome deterioration
Ming, X., Zhang, Z., Zou, Z., Lv, C., Dong, Q., He, Q., Yi, Y., Li, Y., Wang, H., & Zhu, B. (2020) · Cell Research · doi:10.1038/s41422-020-0359-9 · Cited by 157 · see citing works
Epigenetics, DNA damage, and aging
Soto-Palma, C., Niedernhofer, L. J., Faulk, C. D., & Dong, X. (2022) · Journal of Clinical Investigation · doi:10.1172/jci158446 · Cited by 153 · see citing works
Spatial transcriptomic landscape unveils immunoglobin-associated senescence as a hallmark of aging
Ma, S., Ji, Z., Zhang, B., Geng, L., Cai, Y., Nie, C., Li, J., Zuo, Y., Sun, Y., Xu, G., et al. (2024) · Cell · doi:10.1016/j.cell.2024.10.019 · Cited by 162 · see citing works
COVID-19 and cellular senescence
Schmitt, C. A., Tchkonia, T., Niedernhofer, L. J., Robbins, P. D., Kirkland, J. L., & Lee, S. (2023) · Nature Reviews Immunology · doi:10.1038/s41577-022-00785-2 · Cited by 153 · see citing works
Single-cell transcriptomic atlas of primate cardiopulmonary aging
Ma, S., Sun, S., Li, J., Fan, Y., Qu, J. T., Sun, L., Wang, S., Zhang, Y., Yang, S., Liu, Z., et al. (2020) · Cell Research · doi:10.1038/s41422-020-00412-6 · Cited by 149 · see citing works
The role of cellular senescence and SASP in tumour microenvironment
Takasugi, M., Yoshida, Y., Hara, E., & Ohtani, N. (2023) · The FEBS Journal · doi:10.1111/febs.16381 · Cited by 144 · see citing works

LINE-1 retrotransposon activation drives age-associated inflammation via cytoplasmic cDNA-STING/type I interferon signalling: therapeutic potential of reverse transcriptase inhibition
Mehmood, A., Xue, Y., Yassin, H. M., Zubair, M. A., Rahmat, S. A., & Ahmad, A. (2025) · Współczesna Onkologia · doi:10.5114/wo.2025.152369 · Cited by 5 · see citing works
LINE1 Derepression in aged wild-type and SIRT6-deficient mice drives inflammation
Simon, M., Van Meter, M., Ablaeva, J., Ke, Z., Gonzalez, R. S., Taguchi, T., De Cecco, M., Leonova, K. I., Kogan, V., Helfand, S. L., et al. (2019) · Cell Metabolism · doi:10.1016/j.cmet.2019.02.014 · Cited by 498 · see citing works
Self-citation
Inhibition of ‘jumping genes’ promotes healthy ageing
Childs, B. G., & van Deursen, J. (2019) · Nature · doi:10.1038/d41586-018-07553-0 · Cited by 11 · see citing works
Antagonistic regulation of LINE-1/Alu elements and their repressor APOBEC3B in cellular senescence
Munot, D., Lu, Y., Haußmann, I., Najjar, G., Baur, C., Singh, M. K., Güneş, Ç., Sauter, D., & Arora, A. V. (2025) · Mobile DNA · doi:10.1186/s13100-025-00378-5 · Cited by 1 · see citing works
Reactivation of senescence-associated endogenous retroviruses by ATF3 drives interferon signaling in aging
Mao, J., Zhang, Q., Zhuang, Y., Zhang, Y., Li, L., Pan, J., Xu, L., Ding, Y., Wang, M., & Cong, Y. (2024) · Nature Aging · doi:10.1038/s43587-024-00745-6 · Cited by 38 · see citing works

Authors: De Cecco, M., Ito, T., Petrashen, A. P., Elias, A. E., Skvir, N. J., Criscione, S. W., Caligiana, A., Brocculi, G., Adney, E. M., Boeke, J. D., Le, O., Beauséjour, C., Ambati, J., Ambati, K., Simon, M., Seluanov, A., Gorbunova, V., Slagboom, P. E., Helfand, S. L., Neretti, N., & Sedivy, J. M.
Affiliations: Brown University (US)
Johns Hopkins University (US)
NYU Langone Health (US)
University of Virginia (US)
University of Rochester (US)
Leiden University Medical Center (NL)
Corresponding author: Sedivy, John M.
ORCID: Ito, Takahiro
Petrashen, Anna P.
Elias, Amy E.
Skvir, Nicholas J.
Criscione, Steven W.
Caligiana, Alberto
Adney, Emily M.
Boeke, Jef D.
Ambati, Jayakrishna
Simon, Matthew
Seluanov, Andrei
Gorbunova, Vera
Slagboom, P. Eline
Neretti, Nicola
Sedivy, John M.
Venue: Nature
Publisher: Springer Science and Business Media LLC
Published: 2019-02-06
Volume: 566
Issue: 7742
Pages: 73-78
ISSN: 0028-0836 (ISSN-L)
1476-4687
DOI: 10.1038/s41586-018-0784-9
PMC: PMC6519963
OpenAlex: W2911642321
Cited by: 1,255
References: 70
Citations by year: 2026: 162 · 2025: 228 · 2024: 203 · 2023: 179 · 2022: 145 · 2021: 141 · 2020: 129 · 2019: 67 · 2015: 1
FWCI: 82.35
Type: journal article
Language: en
Update notices: correction (2019-07-12)
Open access: green
www.ncbi.nlm.nih.gov
Licence: www.springernature.com/gp/researchers/text-and-data-mining (tdm)
www.springernature.com/gp/researchers/text-and-data-mining (vor)
Locations: Nature (publishedVersion)
PubMed (publishedVersion)
Europe PMC (PubMed Central) (acceptedVersion)
PubMed Central (acceptedVersion)
Data Archiving and Networked Services (DANS) (submittedVersion)
RePEc: Research Papers in Economics (submittedVersion)
Leiden Repository (Leiden University) (submittedVersion)
Archivio istituzionale della ricerca (Alma Mater Studiorum Università di Bologna) (submittedVersion)
Funders: National Institutes of Health (R01 AG047200)
National Institute on Aging (F31AG050365, R01AG046320, R01AG024353, R01AG027237, R37AG016694, F31AG043189, R01AG016694, R01AG050582, R37AG016667, T32AG041688, P01AG047200, R37AG046320, P01AG051449)
National Eye Institute (R01EY028027, R01EY029799, R01EY024068, R01EY022238)
National Institute of General Medical Sciences (DP1GM114862, P20GM119943, P20GM109035)
National Institute of Allergy and Infectious Diseases (P30AI050410)
Topics: Health Sciences › Medicine › Physiology › Telomeres, Telomerase, and Senescence
Life Sciences › Biochemistry, Genetics and Molecular Biology › Aging › Genetics, Aging, and Longevity in Model Organisms
Life Sciences › Immunology and Microbiology › Immunology › interferon and immune responses
Keywords: LINE-1 retrotransposons, cellular senescence, type I interferon response, inflammaging, sterile inflammation, senescence-associated secretory phenotype, lamivudine, age-related diseases
MeSH terms: Aging, Animals, Female, Fibroblasts, Humans, Inflammation, Interferon Type I, Male, Phenotype, RNA-Directed DNA Polymerase, Down-Regulation, Cellular Senescence, Reverse Transcriptase Inhibitors, Lamivudine, Long Interspersed Nucleotide Elements, Mice

About these checks

Registry, retraction, Cites and statistics results are computed, not judged, with one exception: a printed reference that no index lists is read once by a model before it counts as a citation error. Claims are extracted by a model and kept only when their quote appears verbatim in the text; each cited source is then checked, with a model’s help, for whether it says what the claim relies on. Those verdicts can be wrong — read the claim’s quote and the cited source before relying on one.

Claims read by deepseek-v4.1-flash under definition version 3 (extract-v3) on 2026-10-20.

Classified by jev-1.13-20260917 (gold-guideline-v0.2) on 2026-10-20.

Cited sources are checked by gpt-6-sol.

Statistics and arithmetic are recomputed, not judged.

Confidence bands are shown only for fields calibrated on our annotated test set. None is calibrated yet, so no band is shown.

What counts as a claim ›How we measure confidence ›How we check this ›

Are you an author, or do you see a problem with this page? Request a review

L1 drives IFN in senescent cells and promotes age-associated inflammation

Abstract

Integrity signals

Claims the paper makes

Claims other papers make about this one

Self-check

Cites

Cited by

Related

Record

About these checks