Cited by 6,661SARS-CoV-2 and COVID-19 ResearchCOVID-19 Clinical Research StudiesSARS-CoV-2 detection and testing

The DOI matches its Crossref record; 34 of the 37 references it cites were found in a registry or an index.

Virological assessment of hospitalized patients with COVID-2019

Open access

Wölfel, Roman, Corman, Victor M., Guggemos, Wolfgang, Seilmaier, Michael, Zange, Sabine, Müller, Marcel A., Niemeyer, Daniela, Jones, Terry C., Vollmar, Patrick, Rothe, Camilla, Hoelscher, Michael, Bleicker, Tobias, Brünink, Sebastian, Schneider, Julia, Ehmann, Rosina, Zwirglmaier, Katrin, Drosten, Christian, Wendtner, Clemens·2020·Nature

DOI 10.1038/s41586-020-2196-x

Published version of a preprint

Open this paper in CoChat — free account Open PDF

Abstract

Coronavirus disease 2019 (COVID-19) is an acute infection of the respiratory tract that emerged in late 2019 1,2. Initial outbreaks in China involved 13.8% of cases with severe courses, and 6.1% of cases with critical courses 3. This severe presentation may result from the virus using a virus receptor that is expressed predominantly in the lung 2,4; the same receptor tropism is thought to have determined the pathogenicity-but also aided in the control-of severe acute respiratory syndrome (SARS) in 2003 5. However, there are reports of cases of COVID-19 in which the patient shows mild upper respiratory tract symptoms, which suggests the potential for pre- or oligosymptomatic transmission 6-8. There is an urgent need for information on virus replication, immunity and infectivity in specific sites of the body. Here we report a detailed virological analysis of nine cases of COVID-19 that provides proof of active virus replication in tissues of the upper respiratory tract. Pharyngeal virus shedding was very high during the first week of symptoms, with a peak at 7.11 × 10 8 RNA copies per throat swab on day 4. Infectious virus was readily isolated from samples derived from the throat or lung, but not from stool samples-in spite of high concentrations of virus RNA. Blood and urine samples never yielded virus. Active replication in the throat was confirmed by the presence of viral replicative RNA intermediates in the throat samples. We consistently detected sequence-distinct virus populations in throat and lung samples from one patient, proving independent replication. The shedding of viral RNA from sputum outlasted the end of symptoms. Seroconversion occurred after 7 days in 50% of patients (and by day 14 in all patients), but was not followed by a rapid decline in viral load. COVID-19 can present as a mild illness of the upper respiratory tract. The confirmation of active virus replication in the upper respiratory tract has implications for the containment of COVID-19.

The claims and statistics of this paper haven’t been checked yet.

Run the check — free, no account needed. It reads the open-access text and checks the sources it cites.

Integrity signals

Registry

Crossref · 10.1038/s41586-020-2196-x

Cites

34 of 34 references verified0 citation errors · 0 not checkable

Statistics

Claims the paper makes

The claims and statistics of this paper haven’t been checked yet.

Run the check — free, no account needed. It reads the open-access text and checks the sources it cites.

Claims other papers make about this one

Each is checked against this paper’s own text: does it say what the citing paper says it does?

Self-check

Percentages, sums and reported differences re-computed from the paper’s own numbers.

The self-check needs the paper’s full text.

A novel coronavirus from patients with pneumonia in China, 2019
Zhu, N., Zhang, D., Wang, W., Li, X., Yang, B., Song, J., Zhao, X., Huang, B., Shi, W., Lu, R., et al. (2020) · New England Journal of Medicine · doi:10.1056/nejmoa2001017 · Cited by 28,244
Epidemiological and clinical characteristics of 99 cases of 2019 novel Coronavirus pneumonia in Wuhan, China: a descriptive study.
Chen, N., Zhou, M., Dong, X., Qu, J., Gong, F., Han, Y., Qiu, Y., Wang, J., Liu, Y., Wei, Y., et al. (2020) · The Lancet · doi:10.1016/s0140-6736(20)30211-7 · Cited by 21,415
SARS-CoV-2 Cell Entry Depends on ACE2 and TMPRSS2 and Is Blocked by a Clinically Proven Protease Inhibitor
Hoffmann, M., Kleine-Weber, H., Schroeder, S., Krüger, N., Herrler, T., Erichsen, S., Schiergens, T. S., Herrler, G., Wu, N.-H., Nitsche, A., et al. (2020) · Cell · doi:10.1016/j.cell.2020.02.052 · Cited by 20,286
Self-citation
The species Severe acute respiratory syndrome-related coronavirus: classifying 2019-nCoV and naming it SARS-CoV-2
Gorbalenya, A. E., Baker, S. C., Baric, R. S., de Groot, R. J., Drosten, C., Gulyaeva, A. A., Haagmans, B. L., Lauber, C., Leontovich, A. M., Neuman, B. W., et al. (2020) · Nature Microbiology · doi:10.1038/s41564-020-0695-z · Cited by 8,745
Self-citation
Detection of 2019 novel coronavirus (2019-nCoV) by real-time RT-PCR
Corman, V. M., Landt, O., Kaiser, M., Molenkamp, R., Meijer, A., Chu, D. K. W., Bleicker, T., Brünink, S., Schneider, J. A., Schmidt, M. L., et al. (2020) · Eurosurveillance · doi:10.2807/1560-7917.es.2020.25.3.2000045 · Cited by 7,266
Self-citation
First case of 2019 novel coronavirus in the United States
Holshue, M. L., DeBolt, C., Lindquist, S., Lofy, K. H., Wiesman, J., Bruce, H., Spitters, C., Ericson, K., Wilkerson, S., Tural, A., et al. (2020) · New England Journal of Medicine · doi:10.1056/nejmoa2001191 · Cited by 6,030
SARS-CoV-2 Viral Load in Upper Respiratory Specimens of Infected Patients
Zou, L., Ruan, F., Huang, M.-X., Liang, L.-J., Huang, H., Hong, Z.-S., Yu, J.-X., Kang, M., Song, Y.-C., Xia, J., et al. (2020) · New England Journal of Medicine · doi:10.1056/nejmc2001737 · Cited by 4,590
Identification of a novel coronavirus in patients with severe acute respiratory syndrome
Drosten, C., Günther, S., Preiser, W., van der Werf, S., Brodt, H.-R., Becker, S., Rabenau, H., Panning, M., Kolesnikova, L., Fouchier, R. A. M., et al. (2003) · New England Journal of Medicine · doi:10.1056/nejmoa030747 · Cited by 4,574
Self-citation
A Novel Coronavirus Associated with Severe Acute Respiratory Syndrome
Tg, K., Erdman, D. D., Cs, G., Zaki, Peret, T. C. T., Emery, S. L., Tong, S., Urbani, C., Comer, J. A., Lim, W., et al. (2003) · New England Journal of Medicine · doi:10.1056/nejmoa030781 · Cited by 4,353
Transmission of 2019-nCoV Infection from an Asymptomatic Contact in Germany
Rothe, C., Schunk, M., Sothmann, P., Bretzel, G., Froeschl, G., Wallrauch, C., Zimmer, T., Thiel, V., Jänke, C., Guggemos, W., et al. (2020) · New England Journal of Medicine · doi:10.1056/nejmc2001468 · Cited by 4,211
Self-citation

Show all 37 references

Sorted by citations

Items 201–300 of 1,012

Frontline Science: COVID-19 infection induces readily detectable morphologic and inflammation-related phenotypic changes in peripheral blood monocytes
Zhang, D., Guo, R., Lei, L., Liu, H., Wang, Y., Wang, Y., Qian, H., Dai, T., Zhang, T., Lai, Y., et al. (2020) · Journal of Leukocyte Biology · doi:10.1002/jlb.4hi0720-470r · Cited by 395
COVID-19 vaccines: The status and perspectives in delivery points of view
Chung, J. Y., Thone, M. N., & Kwon, Y. J. (2021) · Advanced Drug Delivery Reviews · doi:10.1016/j.addr.2020.12.011 · Cited by 375
“In the following 3-7 days, SARS-CoV-2 remains restricted to the upper respiratory airway in themajority of patientswithmild symptoms that can bemonitored and managed from home [94].”
Background
To Interpret the SARS-CoV-2 Test, Consider the Cycle Threshold Value
Tom, M. R., & Mina, M. J. (2020) · Clinical Infectious Diseases · doi:10.1093/cid/ciaa619 · Cited by 373
Infectious viral load in unvaccinated and vaccinated individuals infected with ancestral, Delta or Omicron SARS-CoV-2
Puhach, O., Adea, K., Hulo, N., Sattonnet‐Roche, P., Genecand, C., Iten, A., Jacquérioz, F., Kaiser, L., Vetter, P., Eckerle, I., et al. (2022) · Nature Medicine · doi:10.1038/s41591-022-01816-0 · Cited by 369
Evaluation of a novel antigen-based rapid detection test for the diagnosis of SARS-CoV-2 in respiratory samples
Lorena Porte, T., Legarraga, P., Vollrath, V., Aguilera, X., Munita, J. M., Rafael Araos, B., Pizarro, G., Vial, P., Iruretagoyena, M., Dittrich, S., et al. (2020) · International Journal of Infectious Diseases · doi:10.1016/j.ijid.2020.05.098 · Cited by 371
Visualizing in deceased COVID-19 patients how SARS-CoV-2 attacks the respiratory and olfactory mucosae but spares the olfactory bulb
Khan, M., Yoo, S., Clijsters, M., Backaert, W., Vanstapel, A., Speleman, K., Lietaer, C., Choi, S., HETHER, T. D., Marcelis, L., et al. (2021) · Cell · doi:10.1016/j.cell.2021.10.027 · Cited by 393
“5938 Cell 184, 5932–5949, November 24, 2021 and replication (Wölfel et al., 2020; Zou et al., 2020).”
SARS-CoV-2 from faeces to wastewater treatment: What do we know? A review
Foladori, P., Cutrupi, F., Segata, N., Manara, S., Pinto, F., Malpei, F., Bruni, L., & Rosa, G. L. (2020) · The Science of The Total Environment · doi:10.1016/j.scitotenv.2020.140444 · Cited by 369
Virus-induced senescence is a driver and therapeutic target in COVID-19
Lee, S., Yu, Y., Trimpert, J., Benthani, F., Mairhofer, M., Richter-Pechanska, P., Wyler, E., Belenki, D., Kaltenbrunner, S., Pammer, M., et al. (2021) · Nature · doi:10.1038/s41586-021-03995-1 · Cited by 350
Self-citation
Pre-activated antiviral innate immunity in the upper airways controls early SARS-CoV-2 infection in children
Loske, J., Roehmel, J. F., Lukassen, S., Stricker, S., Magalhães, V. G., Liebig, J., Chua, R. L., Thürmann, L., Messingschlager, M., Seegebarth, A., et al. (2021) · Nature Biotechnology · doi:10.1038/s41587-021-01037-9 · Cited by 365
Self-citation
SARS-CoV-2 RNA in Wastewater Settled Solids Is Associated with COVID-19 Cases in a Large Urban Sewershed
Graham, K. E., Loeb, S. K., Wolfe, M. K., Catoe, D., Sinnott-Armstrong, N., Kim, S., Yamahara, K. M., Sassoubre, L. M., Grijalva, L. M. M., Roldan-Hernandez, L., et al. (2020) · Environmental Science & Technology · doi:10.1021/acs.est.0c06191 · Cited by 365
Molecular diagnostic technologies for COVID-19: Limitations and challenges
Afzal, A. (2020) · Journal of Advanced Research · doi:10.1016/j.jare.2020.08.002 · Cited by 378
Routine childhood immunisation during the COVID-19 pandemic in Africa: a benefit–risk analysis of health benefits versus excess risk of SARS-CoV-2 infection
Abbas, K., Procter, S. R., van Zandvoort, K., Clark, A. D., Funk, S., Mengistu, T., Hogan, D. R., Dansereau, E. A., Jit, M., Flasche, S., et al. (2020) · The Lancet Global Health · doi:10.1016/s2214-109x(20)30308-9 · Cited by 362
Genome Sequencing of Sewage Detects Regionally Prevalent SARS-CoV-2 Variants
Crits‐Christoph, A., Kantor, R. S., Olm, M. R., Whitney, O. N., Al-Shayeb, B., Lou, Y. C., Flamholz, A. I., Kennedy, L. C., Greenwald, H., Hinkle, A., et al. (2021) · mBio · doi:10.1128/mbio.02703-20 · Cited by 362
Serology testing in the COVID-19 pandemic response
Peeling, R. W. W., Wedderburn, C. J., Garcia, P. J., Boeras, D. I., Fongwen, N. T., Nkengasong, J. N., Sall, A. A., Tanuri, A., & Heymann, D. L. (2020) · The Lancet Infectious Diseases · doi:10.1016/s1473-3099(20)30517-x · Cited by 376
Morphogenesis and cytopathic effect of SARS-CoV-2 infection in human airway epithelial cells
Zhu, N., Wang, W., Liu, Z., Liang, C., Wang, W., Ye, F., Huang, B., Zhao, L., Wang, H., Zhou, W., et al. (2020) · Nature Communications · doi:10.1038/s41467-020-17796-z · Cited by 368
Alterations in Fecal Fungal Microbiome of Patients With COVID-19 During Time of Hospitalization until Discharge
Zuo, T., Zhan, H., Zhang, F., Liu, Q., Tso, E. Y. K., Lui, G. C.-Y., Chen, N., Li, A., Lu, W., Chan, F. K. L., et al. (2020) · Gastroenterology · doi:10.1053/j.gastro.2020.06.048 · Cited by 353
Comparison of deep learning approaches to predict COVID-19 infection
Alakuş, T. B., & Türkoğlu, İ. (2020) · Chaos Solitons & Fractals · doi:10.1016/j.chaos.2020.110120 · Cited by 357
Effects of common mutations in the SARS-CoV-2 Spike RBD and its ligand, the human ACE2 receptor on binding affinity and kinetics
Barton, M. I., MacGowan, S. A., Kutuzov, M. A., Dushek, O., Barton, G. J., & van der Merwe, P. A. (2021) · eLife · doi:10.7554/elife.70658 · Cited by 346
Interleukin-6 Is a Biomarker for the Development of Fatal Severe Acute Respiratory Syndrome Coronavirus 2 Pneumonia
Cruz, A. S., Mendes‐Frias, A., Oliveira, A. I., Dias, L., Matos, A. R., Carvalho, A., Capela, C., Pedrosa, J., Castro, A. G., & Silvestre, R. (2021) · Frontiers in Immunology · doi:10.3389/fimmu.2021.613422 · Cited by 364
“Hydroxychloroquine + azithromycin 19 (41)”
Background
Decay of SARS-CoV-2 and surrogate murine hepatitis virus RNA in untreated wastewater to inform application in wastewater-based epidemiology
Ahmed, W., Bertsch, P. M., Bibby, K. J., Haramoto, E., Hewitt, J., Huygens, F., Gyawali, P., Korajkic, A., Riddell, S., Sherchan, S. P., et al. (2020) · Environmental Research · doi:10.1016/j.envres.2020.110092 · Cited by 357
SARS-CoV-2 RNA concentrations in wastewater foreshadow dynamics and clinical presentation of new COVID-19 cases
Wu, F., Xiao, A., Zhang, J., Moniz, K., Endo, N., Armas, F., Bonneau, R., Brown, M. A., Bushman, M., Chai, P. R., et al. (2021) · The Science of The Total Environment · doi:10.1016/j.scitotenv.2021.150121 · Cited by 351
“In several clinical studies, the earliest stool samples collected have been positive for viral RNA (day 3 post symptom onset (Wölfel et al., 2020); and day 0 of hospital admission (Chen et al.”
Influential
The dynamics of humoral immune responses following SARS-CoV-2 infection and the potential for reinfection
Kellam, P., & Barclay, W. (2020) · Journal of General Virology · doi:10.1099/jgv.0.001439 · Cited by 353
A Therapeutic Non-self-reactive SARS-CoV-2 Antibody Protects from Lung Pathology in a COVID-19 Hamster Model
Kreye, J., Reincke, S. M., Kornau, H.-C., Sánchez-Sendin, E., Corman, V. M., Liu, H., Yuan, M., Wu, N. C., Zhu, X., Lee, C.-C. D., et al. (2020) · Cell · doi:10.1016/j.cell.2020.09.049 · Cited by 347
Self-citation
Effects of potent neutralizing antibodies from convalescent plasma in patients hospitalized for severe SARS-CoV-2 infection
Gharbharan, A., Jordans, C. C. E., GeurtsvanKessel, C. H., den Hollander, J. G., Karim, F., Mollema, F. P. N., Stalenhoef, J. E., Dofferhoff, A. S. M., Ludwig, I., Koster, A., et al. (2021) · Nature Communications · doi:10.1038/s41467-021-23469-2 · Cited by 351
“Although a systematic collection of cultures before inclusion was not required per protocol and current knowledge indicates that viral cultures tend to become negative around 8 days of symptoms, (34, 35) none of the 6 patients from the SoC arm and 1 patient on ConvP had cytopathic effects in culture after 7 days of in…”
Background
Transmission of COVID-19 in 282 clusters in Catalonia, Spain: a cohort study
Marks, M., Millat-Martínez, P., Ouchi, D., Roberts, C. H., Alemany, A., Corbacho‐Monné, M., Ubals, M., Tobı́as, A., Tebé, C., Ballana, E., et al. (2021) · The Lancet Infectious Diseases · doi:10.1016/s1473-3099(20)30985-3 · Cited by 351
Lessons learned 1 year after SARS-CoV-2 emergence leading to COVID-19 pandemic
To, K. K., Sridhar, S., Chiu, K. H., Hung, D. L. L., Li, X., Hung, I. F., Tam, A. R., Chung, T. W., Chan, J. F., Zhang, J., et al. (2021) · Emerging Microbes & Infections · doi:10.1080/22221751.2021.1898291 · Cited by 359
“shown as well, though intensity is not as great as that with SARS-CoV [52, 281, 282].”
Correlation of SARS-CoV-2 RNA in wastewater with COVID-19 disease burden in sewersheds
Weidhaas, J., Aanderud, Z. T., Roper, D. K., VanDerslice, J. A., Gaddis, E. J. B., Ostermiller, J., Hoffman, K., Jamal, R., Heck, P. E., Zhang, Y., et al. (2020) · The Science of The Total Environment · doi:10.1016/j.scitotenv.2021.145790 · Cited by 345
COVID-19: towards understanding of pathogenesis
Cao, W., & Li, T. (2020) · Cell Research · doi:10.1038/s41422-020-0327-4 · Cited by 344
Comparison of seven commercial SARS-CoV-2 rapid point-of-care antigen tests: a single-centre laboratory evaluation study
Corman, V. M., Haage, V. C., Bleicker, T., Schmidt, M. L., Mühlemann, B., Żuchowski, M., Jo, W. K., Tscheak, P., Möncke‐Buchner, E., Müller, M. A., et al. (2021) · The Lancet Microbe · doi:10.1016/s2666-5247(21)00056-2 · Cited by 325
“Due to the rapid change of viral load in the acute phase of COVID-19, 12,25 AgPOCTs have a narrow timeframe for their useful application that predominantly comprises the first week of symptoms.”
Self-citation
Molecular mechanism of interaction between SARS-CoV-2 and host cells and interventional therapy
Zhang, Q., Xiang, R., Huo, S., Zhou, Y., Jiang, S., Wang, Q., & Yu, F. (2021) · Signal Transduction and Targeted Therapy · doi:10.1038/s41392-021-00653-w · Cited by 364
Pathophysiology of COVID-19: Why Children Fare Better than Adults?
Dhochak, N., Singhal, T., Kabra, S. K., & Lodha, R. (2020) · The Indian Journal of Pediatrics · doi:10.1007/s12098-020-03322-y · Cited by 358
Face masks effectively limit the probability of SARS-CoV-2 transmission
Cheng, Y., Ma, N., Witt, C. C., Rapp, S., Wild, P. S., Andreae, M. O., Pöschl, U., & Su, H. (2021) · Science · doi:10.1126/science.abg6296 · Cited by 339
Lung transplantation for patients with severe COVID-19
Bharat, A., Querrey, M., Markov, N. S., Kim, S., Kurihara, C., Garza-Castillon, R., Manerikar, A., Shilatifard, A., Tomic, R., Politanska, Y., et al. (2020) · Science Translational Medicine · doi:10.1126/scitranslmed.abe4282 · Cited by 336
Breakthrough infections with SARS-CoV-2 omicron despite mRNA vaccine booster dose
Kuhlmann, C., Mayer, C. K., Claassen, M., Maponga, T. G., Burgers, W. A., Keeton, R., Riou, C., Sutherland, A. D., Suliman, T., Shaw, M. L., et al. (2022) · The Lancet · doi:10.1016/s0140-6736(22)00090-3 · Cited by 327
Critical Role of Type III Interferon in Controlling SARS-CoV-2 Infection in Human Intestinal Epithelial Cells
Stanifer, M. L., Kee, C., Cortese, M., Metz‐Zumaran, C., Triana, S., Mukenhirn, M., Kraeusslich, H.-G., Alexandrov, T., Bartenschlager, R. F. W., & Boulant, S. (2020) · Cell Reports · doi:10.1016/j.celrep.2020.107863 · Cited by 337
Serial interval of SARS-CoV-2 was shortened over time by nonpharmaceutical interventions
Ali, S. T., Wang, L., Lau, E. H. Y., Xu, X.-K., Du, Z., Wu, Y., Leung, G. M., & Cowling, B. J. (2020) · Science · doi:10.1126/science.abc9004 · Cited by 324
Emerging treatment strategies for COVID-19 infection
Gavriatopoulou, M., Ntanasis‐Stathopoulos, I., Korompoki, E., Fotiou, D., Migkou, M., Tzanninis, I., Ψαλτοπούλου, Θ., Kastritis, E., Terpos, E., & Dimopoulos, M. A. (2020) · Clinical and Experimental Medicine · doi:10.1007/s10238-020-00671-y · Cited by 335
Adjuvanting a subunit COVID-19 vaccine to induce protective immunity
Arunachalam, P. S., Walls, A. C., Golden, N., Atyeo, C. G., Fischinger, S., Li, C., Aye, P. P., Navarro, M. J., Lai, L., Edara, V. V., et al. (2021) · Nature · doi:10.1038/s41586-021-03530-2 · Cited by 317
How Efficacious Must a COVID-19 Coronavirus Vaccine be to Prevent or Stop an Epidemic by Itself
Bartsch, S. M., O’Shea, K. J., Ferguson, M. C., Bottazzi, M. E., Wedlock, P. T., Strych, U., McKinnell, J. A., Siegmund, S. S., Cox, S. N., Hotez, P. J., et al. (2020) · American Journal of Preventive Medicine · doi:10.1016/j.amepre.2020.06.011 · Cited by 328
Scaling up COVID-19 rapid antigen tests: promises and challenges
Peeling, R. W. W., Olliaro, P., Boeras, D. I., & Fongwen, N. T. (2021) · The Lancet Infectious Diseases · doi:10.1016/s1473-3099(21)00048-7 · Cited by 324
Myocarditis is rare in COVID-19 autopsies: cardiovascular findings across 277 postmortem examinations
Halushka, M. K., & Vander Heide, R. S. (2021) · Cardiovascular Pathology · doi:10.1016/j.carpath.2020.107300 · Cited by 307
Epidemiology of COVID-19
Bulut, C., & Kato, Y. (2020) · TURKISH JOURNAL OF MEDICAL SCIENCES · doi:10.3906/sag-2004-172 · Cited by 325
UV-C irradiation is highly effective in inactivating SARS-CoV-2 replication
Biasin, M., Bianco, A. G., Pareschi, G., Cavalleri, A., Cavatorta, C., Fenizia, C., Gallì, P., Lessio, L., Lualdi, M., Tombetti, E., et al. (2021) · Scientific Reports · doi:10.1038/s41598-021-85425-w · Cited by 359
A high-throughput neutralizing antibody assay for COVID-19 diagnosis and vaccine evaluation
Muruato, A. E., Fontes-Garfias, C. R., Ren, P., Garcia-Blanco, M. A., Menachery, V. D., Xie, X., & Shi, P.-Y. (2020) · Nature Communications · doi:10.1038/s41467-020-17892-0 · Cited by 319
Monitoring approaches for health-care workers during the COVID-19 pandemic
Bielicki, J. A., Duval, X., Gobat, N., Goossens, H., Koopmans, M., Tacconelli, E., & van der Werf, S. (2020) · The Lancet Infectious Diseases · doi:10.1016/s1473-3099(20)30458-8 · Cited by 314
Simultaneous Dual‐Gene Diagnosis of SARS‐CoV‐2 Based on CRISPR/Cas9‐Mediated Lateral Flow Assay
Xiong, E., Jiang, L., Tian, T., Hu, M., Yue, H., Huang, M., Lin, W. H., Jiang, Y., Zhu, D., & Zhou, X. (2020) · Angewandte Chemie International Edition · doi:10.1002/anie.202014506 · Cited by 312
Early recovery following new onset anosmia during the COVID-19 pandemic – an observational cohort study
Hopkins, C. L., Šurda, P., Whitehead, E., & Kumar, B. N. (2020) · Journal of Otolaryngology - Head and Neck Surgery · doi:10.1186/s40463-020-00423-8 · Cited by 317
Rethinking wastewater risks and monitoring in light of the COVID-19 pandemic
Bogler, A., Packman, A. I., Furman, A., Gross, A., Kushmaro, A., Ronen, A., Dagot, C., Hill, C., Vaizel‐Ohayon, D., Morgenroth, E., et al. (2020) · Nature Sustainability · doi:10.1038/s41893-020-00605-2 · Cited by 316
SARS-CoV-2 genomic and subgenomic RNAs in diagnostic samples are not an indicator of active replication
Alexandersen, S., Chamings, A., & Bhatta, T. R. (2020) · Nature Communications · doi:10.1038/s41467-020-19883-7 · Cited by 305
Psychological factors and consumer behavior during the COVID-19 pandemic
Crosta, A. D., Ceccato, I., Marchetti, D., Malva, P. L., Maiella, R., Cannito, L., Cipi, M., Mammarella, N., Palumbo, R., Verrocchio, M. C., et al. (2021) · PLoS ONE · doi:10.1371/journal.pone.0256095 · Cited by 383
“Coronavirus disease 2019 (COVID-19) refers to an infection (SARS-CoV-2) of the lower respiratory tract [1, 2], which was first detected in Wuhan (China) in late December 2019.”
Background
A comparison of four serological assays for detecting anti–SARS-CoV-2 antibodies in human serum samples from different populations
Grzelak, L., Temmam, S., Planchais, C., Demeret, C., Tondeur, L., Huon, C., Guivel-Benhassine, F., Staropoli, I., Chazal, M., Dufloo, J., et al. (2020) · Science Translational Medicine · doi:10.1126/scitranslmed.abc3103 · Cited by 310
Field evaluation of a rapid antigen test (Panbio™ COVID-19 Ag Rapid Test Device) for COVID-19 diagnosis in primary healthcare centres
Albert, E., Torres, I., Bueno, F., Huntley, D., Molla, E., Fernández-Fuentes, M. Á., Martínez, M., Poujois, S., Forqué, L., Valdivia, A., et al. (2020) · Clinical Microbiology and Infection · doi:10.1016/j.cmi.2020.11.004 · Cited by 309
Multiplexed CRISPR-based microfluidic platform for clinical testing of respiratory viruses and identification of SARS-CoV-2 variants
Welch, N. L., Zhu, M., Hua, C., Weller, J., Mirhashemi, M. E., Nguyen, T. G., Mantena, S., Bauer, M. R., Shaw, B. M., Ackerman, C. M., et al. (2022) · Nature Medicine · doi:10.1038/s41591-022-01734-1 · Cited by 310
“An ideal diagnostic method would have surveillance capabilities to process hundreds of patient samples simultaneously, detect multiple viruses, differentiate between viral variants and quantify viral load 8,9 ; yet no such test currently exists.”
Implementation of environmental surveillance for SARS-CoV-2 virus to support public health decisions: Opportunities and challenges
Medema, G. J., Béen, F. M., Heijnen, L., & Petterson, S. (2020) · Current Opinion in Environmental Science & Health · doi:10.1016/j.coesh.2020.09.006 · Cited by 308
A modelling framework to assess the likely effectiveness of facemasks in combination with ‘lock-down’ in managing the COVID-19 pandemic
Stutt, R. O. J. H., Retkutė, R., Bradley, M. S. A., Gilligan, C. A., & Colvin, J. (2020) · Proceedings of the Royal Society A Mathematical Physical and Engineering Sciences · doi:10.1098/rspa.2020.0376 · Cited by 304
Managing cancer patients during the COVID-19 pandemic: an ESMO multidisciplinary expert consensus
Curigliano, G., Banerjee, S., Cervantes, A. M. R., Garassino, M. C., Garrido, P., Girard, N., Haanen, J. B. A. G., Jordan, K., Lordick, F., Machiels, J. P., et al. (2020) · Annals of Oncology · doi:10.1016/j.annonc.2020.07.010 · Cited by 306
SalivaDirect: A simplified and flexible platform to enhance SARS-CoV-2 testing capacity
Vogels, C. B. F., Watkins, A. E., Harden, C. A., Brackney, D. E., Shafer, J., Wang, J., Caraballo, C., Kalinich, C. C., Ott, I. M., Fauver, J. R., et al. (2020) · Med · doi:10.1016/j.medj.2020.12.010 · Cited by 306
“In the initial development, we included N2 (Fwd: TTACAAACATTGGCCGCAAA, Rev: GCGCGACATTCCGAAGAA, Probe: HEX-ACAATTTGCCCCCAGCGCTTCAG-IBFQ) (Lu et al., 2020), E (Fwd: ACAGGTACGTTAATAGTTAATAGCGT, Rev: ATATTGCAGCAGTACGCACACA, Probe: HEX-ACACTAGCCATCCTTACTGCGCTTCG-IBFQ) (Corman et al., 2020), or ORF1 (Fwd: TGGGGYTTTACRG…”
Potential intestinal infection and faecal–oral transmission of SARS-CoV-2
Guo, M., Tao, W., Flavell, R. A., & Zhu, S. (2021) · Nature Reviews Gastroenterology & Hepatology · doi:10.1038/s41575-021-00416-6 · Cited by 314
The SARS-COV-2 Spike Protein Binds Sialic Acids and Enables Rapid Detection in a Lateral Flow Point of Care Diagnostic Device
Baker, A. N., Richards, S., Guy, C. S., Congdon, T. R., Hasan, M., Zwetsloot, A. J., Gallo, A., Lewandowski, J. R., Stansfeld, P. J., Straube, A., et al. (2020) · ACS Central Science · doi:10.1021/acscentsci.0c00855 · Cited by 302
The Role of Antibody Testing for SARS-CoV-2: Is There One?
Theel, E. S., Slev, P. R., Wheeler, S., Couturier, M. R., Wong, S. J., & Kadkhoda, K. (2020) · Journal of Clinical Microbiology · doi:10.1128/jcm.00797-20 · Cited by 314
COVID-19 and immunomodulation in IBD
Neurath, M. F. (2020) · Gut · doi:10.1136/gutjnl-2020-321269 · Cited by 305
Viral Kinetics and Antibody Responses in Patients with COVID-19Preprint
Tan, W., Lu, Y., Zhang, J., Wang, J., Dan, Y., Tan, Z., He, X., Qian, C., Sun, Q., Hu, Q., et al. (2020) · medRxiv · doi:10.1101/2020.03.24.20042382 · Cited by 306
Tracking COVID-19 with wastewater
Larsen, D. A., & Wigginton, K. R. (2020) · Nature Biotechnology · doi:10.1038/s41587-020-0690-1 · Cited by 300
Correlates of protection against SARS ‐ CoV ‐2 infection and COVID‐19 disease
Goldblatt, D., Alter, G., Crotty, S., & Plotkin, S. A. (2022) · Immunological Reviews · doi:10.1111/imr.13091 · Cited by 301
Cross-reactive CD4 + T cells enhance SARS-CoV-2 immune responses upon infection and vaccination
Loyal, L., Braun, J., Henze, L., Kruse, B., Dingeldey, M., Reimer, U., Kern, F., Schwarz, T., Mangold, M., Unger, C., et al. (2021) · Science · doi:10.1126/science.abh1823 · Cited by 293
Self-citation
A metabolic handbook for the COVID-19 pandemic
Ayres, J. S. (2020) · Nature Metabolism · doi:10.1038/s42255-020-0237-2 · Cited by 293
A lab-on-a-chip for the concurrent electrochemical detection of SARS-CoV-2 RNA and anti-SARS-CoV-2 antibodies in saliva and plasma
Najjar, D., Rainbow, J., Sanjay, S. T., Jolly, P., de Puig, H., Yafia, M., Durr, N., Sallum, H. M., Alter, G., Li, J. Z., et al. (2022) · Nature Biomedical Engineering · doi:10.1038/s41551-022-00919-w · Cited by 304
“This platform incorporates multiple innovations including: (1) engineering of a high-specificity and high-sensitivity multiplexed EC sensor chip that enables detection of both proteins and nucleic acids with clinically relevant samples of biological fluids perfused through a single microfluidic channel; (2) developmen…”
MethodInfluential
In vitro and in vivo functions of SARS-CoV-2 infection-enhancing and neutralizing antibodies
Li, D., Edwards, R. J., Manne, K., Martinez, D. R., Schäfer, A., Alam, S. M., Wiehe, K. J., Lu, X., Parks, R., Sutherland, L. L., et al. (2021) · Cell · doi:10.1016/j.cell.2021.06.021 · Cited by 337
“Subgenomic mRNA assay SARS-CoV-2 E gene and N gene subgenomic mRNA (sgRNA) was measured by a one-step RT-qPCR adapted from previously described methods (Wölfel et al., 2020; Yu et al., 2020).”
Nasal ciliated cells are primary targets for SARS-CoV-2 replication in the early stage of COVID-19
Ahn, J. H., Kim, J., Hong, S. P., Choi, S. Y., Yang, M. J., Ju, Y. S., Kim, Y. T., Kim, H. M., Rahman, M. T., Chung, M. K., et al. (2021) · Journal of Clinical Investigation · doi:10.1172/jci148517 · Cited by 295
“(41) reported that live SARS-CoV-2 was not isolated in nasal cavity samples taken 8 days after symptom onset from patients with COVID-19, although its RNA was highly detected.”
Background
Antibody Tests in Detecting SARS-CoV-2 Infection: A Meta-Analysis
Kontou, P. I., Braliou, G. G., Dimou, N. L., Nikolopoulos, G. K., & Bagos, P. G. (2020) · Diagnostics · doi:10.3390/diagnostics10050319 · Cited by 287
Single-cell longitudinal analysis of SARS-CoV-2 infection in human airway epithelium identifies target cells, alterations in gene expression, and cell state changes
Ravindra, N. G., Alfajaro, M. M., Gasque, V., Huston, N. C., Wan, H., Szigeti-Buck, K., Yasumoto, Y., Greaney, A. M., Habet, V., Chow, R. D., et al. (2021) · PLOS Biology · doi:10.1371/journal.pbio.3001143 · Cited by 258
“Severe cases of COVID-19 progress to acute respiratory distress and acute lung injury that can lead to death [8,9].”
Background
The Long Road Toward COVID-19 Herd Immunity: Vaccine Platform Technologies and Mass Immunization Strategies
Frederiksen, L. S. F., Zhang, Y., Foged, C., & Thakur, A. (2020) · Frontiers in Immunology · doi:10.3389/fimmu.2020.01817 · Cited by 295
Immune correlates of protection by mRNA-1273 vaccine against SARS-CoV-2 in nonhuman primates
Corbett, K. S., Nason, M. C., Flach, B., Gagne, M., O’Connell, S., Johnston, T. S., Shah, S. N., Edara, V. V., Floyd, K., Lai, L., et al. (2021) · Science · doi:10.1126/science.abj0299 · Cited by 286
Ad26 vaccine protects against SARS-CoV-2 severe clinical disease in hamsters
Tostanoski, L. H., Wegmann, F., Martinot, A. J., Loos, C., McMahan, K., Mercado, N. B., Yu, J., Chan, C. N., Bondoc, S., Starke, C. E., et al. (2020) · Nature Medicine · doi:10.1038/s41591-020-1070-6 · Cited by 270
SARS-CoV-2 RNA monitoring in wastewater as a potential early warning system for COVID-19 transmission in the community: A temporal case study
Ahmed, W., Tscharke, B. J., Bertsch, P. M., Bibby, K. J., Bivins, A. W., Choi, P. M., Clarke, L. M., Dwyer, J., Edson, J., Nguyen, T. M. H., et al. (2020) · The Science of The Total Environment · doi:10.1016/j.scitotenv.2020.144216 · Cited by 288
Non-neuronal expression of SARS-CoV-2 entry genes in the olfactory system suggests mechanisms underlying COVID-19-associated anosmiaPreprint
Brann, D. H., Tsukahara, T., Weinreb, C., Lipovsek, M., den Berge, K. V., Gong, B., Chance, R., Macaulay, I. C., Chou, H.-J., Fletcher, R., et al. (2020) · bioRxiv (Cold Spring Harbor Laboratory) · doi:10.1101/2020.03.25.009084 · Cited by 306
Unspecific post-mortem findings despite multiorgan viral spread in COVID-19 patients
Remmelink, M., Mendonça, R. D., D’Haene, N., Clercq, S. D., Verocq, C., Lebrun, L., Lavis, P., Racu, M.-L., Trépant, A., Maris, C., et al. (2020) · Critical Care · doi:10.1186/s13054-020-03218-5 · Cited by 290
Three-dimensional human alveolar stem cell culture models reveal infection response to SARS-CoV-2
Youk, J., Kim, T., Evans, K. V., Jeong, Y.-I., Hur, Y., Hong, S. P., Kim, J. H., Yi, K., Kim, S. Y., Na, K. J., et al. (2020) · Cell Stem Cell · doi:10.1016/j.stem.2020.10.004 · Cited by 266
Prevalence of Chemosensory Dysfunction in COVID-19 Patients: A Systematic Review and Meta-analysis Reveals Significant Ethnic Differences
von Bartheld, C. S., Hagen, M. M., & Butowt, R. (2020) · ACS Chemical Neuroscience · doi:10.1021/acschemneuro.0c00460 · Cited by 294
Body Localization of ACE-2: On the Trail of the Keyhole of SARS-CoV-2
Salamanna, F., Maglio, M., Landini, M. P., & Fini, M. (2020) · Frontiers in Medicine · doi:10.3389/fmed.2020.594495 · Cited by 298
“An increasing number of data showed that stool samples contain high concentration of SARS-CoV-2 RNA during infection for a relatively long period of time (from 1 to 12 days) (193, 204, 206).”
Background
Viral Cultures for Coronavirus Disease 2019 Infectivity Assessment: A Systematic Review
Jefferson, T., Spencer, E. A., Brassey, J., & Heneghan, C. J. (2020) · Clinical Infectious Diseases · doi:10.1093/cid/ciaa1764 · Cited by 278
Insights to SARS-CoV-2 life cycle, pathophysiology, and rationalized treatments that target COVID-19 clinical complications
Trougakos, I. P., Stamatelopoulos, K. S., Terpos, E., Tsitsilonis, O., Aivalioti, E., Paraskevis, D. N., Kastritis, E., Pavlakis, G. N., & Dimopoulos, M. A. (2021) · Journal of Biomedical Science · doi:10.1186/s12929-020-00703-5 · Cited by 305
“Worth noting is, that although there is seemingly no detectable viremia during asymptomatic infection or in the absence of clinical disease [33], SARS-CoV-2 RNA has been detected in blood samples from patients with mild symptoms [34] and detectable viral RNA in blood is a strong prognostic factor for clinical deterior…”
Background
Reverse-transcribed SARS-CoV-2 RNA can integrate into the genome of cultured human cells and can be expressed in patient-derived tissues
Zhang, L., Richards, A. L., Barrasa, M. I., Hughes, S. H., Young, R. A., & Jaenisch, R. (2021) · Proceedings of the National Academy of Sciences · doi:10.1073/pnas.2105968118 · Cited by 279
Antigen-Based Testing but Not Real-Time Polymerase Chain Reaction Correlates With Severe Acute Respiratory Syndrome Coronavirus 2 Viral Culture
Pekosz, A. S., Parvu, V., Li, M., Andrews, J. C., Manabe, Y. C., Kodsi, S., Gary, D. S., Roger-Dalbert, C., Leitch, J. M., & Cooper, C. K. (2021) · Clinical Infectious Diseases · doi:10.1093/cid/ciaa1706 · Cited by 277
“detectable [34, 35], especially at time periods beyond 7 days from symptom onset [8, 10].”
CT imaging and clinical course of asymptomatic cases with COVID-19 pneumonia at admission in Wuhan, China
Meng, H., Xiong, R., He, R., Lin, W., Hao, B., Zhang, L., Lu, Z., Shen, X., Fan, T. T., Jiang, W., et al. (2020) · Journal of Infection · doi:10.1016/j.jinf.2020.04.004 · Cited by 274
Two distinct immunopathological profiles in autopsy lungs of COVID-19
Nienhold, R., Ciani, Y., Koelzer, V. H., Tzankov, A., Haslbauer, J. D., Menter, T., Schwab, N., Henkel, M., Frank, A., Zsikla, V., et al. (2020) · Nature Communications · doi:10.1038/s41467-020-18854-2 · Cited by 246
Adverse effects of COVID-19 mRNA vaccines: the spike hypothesis
Trougakos, I. P., Terpos, E., Alexopoulos, H., Politou, M., Paraskevis, D., Scorilas, A., Kastritis, E., Andreakos, E., & Dimopoulos, M. A. (2022) · Trends in Molecular Medicine · doi:10.1016/j.molmed.2022.04.007 · Cited by 273
The COVID-19 pandemic: Considerations for the waste and wastewater services sector
Nghiem, L. D., Morgan, B. S., Donner, E., & Short, M. D. (2020) · Case Studies in Chemical and Environmental Engineering · doi:10.1016/j.cscee.2020.100006 · Cited by 284
SARS-CoV-2 engages inflammasome and pyroptosis in human primary monocytes
Ferreira, A. C., Soares, V. C., de Azevedo-Quintanilha, I. G., Dias, S. D. S. G., Rodrigues, N. F., Sacramento, C. Q., Mattos, M., de Freitas, C. S., Temerozo, J. R., Teixeira, L., et al. (2021) · Cell Death Discovery · doi:10.1038/s41420-021-00428-w · Cited by 283
COVID-19 outcomes in patients with inflammatory rheumatic and musculoskeletal diseases treated with rituximab: a cohort study
Avouac, J., Drumez, É., HACHULLA, E., Séror, R., Georgin‐Lavialle, S., Mahou, S. E., Pertuiset, É., Pham, T., Marotte, H., Servettaz, A., et al. (2021) · The Lancet Rheumatology · doi:10.1016/s2665-9913(21)00059-x · Cited by 275
SARS-CoV-2 infection induces the dedifferentiation of multiciliated cells and impairs mucociliary clearance
Robinot, R., Hubert, M., de Melo, G. D., Lazarini, F., Bruel, T., Smith, N., Levallois, S., Larrous, F., Fernandes, J., Gellenoncourt, S., et al. (2021) · Nature Communications · doi:10.1038/s41467-021-24521-x · Cited by 298
Robust T cell immunity in convalescent individuals with asymptomatic or mild COVID-19Preprint
Sekine, T., Perez‐Potti, A., Rivera‐Ballesteros, O., Strålin, K., Gorin, J., Olsson, A., Llewellyn‐Lacey, S., Kamal, H., Bogdanović, G., Muschiol, S., et al. (2020) · bioRxiv (Cold Spring Harbor Laboratory) · doi:10.1101/2020.06.29.174888 · Cited by 272
Minimizing errors in RT-PCR detection and quantification of SARS-CoV-2 RNA for wastewater surveillance
Ahmed, W., Simpson, S. L., Bertsch, P. M., Bibby, K. J., Bivins, A. W., Blackall, L. L., Bofill-Mas, S., Bosch, A., Brandão, J. C., Choi, P. M., et al. (2021) · The Science of The Total Environment · doi:10.1016/j.scitotenv.2021.149877 · Cited by 271
“SARS-CoV-2 RNA concentration in the feces of infected individuals is highly variable and ranges from 10 2 to 10 9 GC/g of feces (Wölfel et al., 2020; Zhang et al., 2020).”
Influential
In vivo antiviral host transcriptional response to SARS-CoV-2 by viral load, sex, and age
Lieberman, N. A. P., Peddu, V., Xie, H. J., Shrestha, L., Huang, M.-L. W., Mears, M. C., Cajimat, M. N. B., Bente, D. A., Shi, P., Bovier, F. T., et al. (2020) · PLoS Biology · doi:10.1371/journal.pbio.3000849 · Cited by 267
Development of a SERS-based lateral flow immunoassay for rapid and ultra-sensitive detection of anti-SARS-CoV-2 IgM/IgG in clinical samples
Liu, H., Dai, E., Xiao, R., Zhou, Z., Zhang, M., Bai, Z., Shao, Y., Qi, K., Tu, J., Wang, C., et al. (2020) · Sensors and Actuators B Chemical · doi:10.1016/j.snb.2020.129196 · Cited by 272
Evaluation of Sampling, Analysis, and Normalization Methods for SARS-CoV-2 Concentrations in Wastewater to Assess COVID-19 Burdens in Wisconsin Communities
Feng, S., Roguet, A., McClary-Gutierrez, J. S., Newton, R. J., Kloczko, N., Meiman, J. G., & McLellan, S. L. (2021) · ACS ES&T Water · doi:10.1021/acsestwater.1c00160 · Cited by 265
SARS-CoV-2 ORF9b inhibits RIG-I-MAVS antiviral signaling by interrupting K63-linked ubiquitination of NEMO
Wu, J., Shi, Y., Pan, X., Wu, S., Hou, R., Zhang, Y., Zhong, T., Tang, H., Du, W., Wang, L., et al. (2021) · Cell Reports · doi:10.1016/j.celrep.2021.108761 · Cited by 278
Clinical features of covid-19
Vetter, P., Vu, D., L’Huillier, A. G., Schibler, M., Kaiser, L., & Jacquérioz, F. (2020) · BMJ · doi:10.1136/bmj.m1470 · Cited by 285
SARS-CoV-2 infection in schools in a northern French city: a retrospective serological cohort study in an area of high transmission, France, January to April 2020
Fontanet, A. L., Tondeur, L., Grant, R., Temmam, S., Madec, Y., Bigot, T., Grzelak, L., Cailleau, I., Besombes, C., Ungeheuer, M., et al. (2021) · Eurosurveillance · doi:10.2807/1560-7917.es.2021.26.15.2001695 · Cited by 286
“Symptoms were considered only if they occurred at least 7 days before the date of blood sample collection to allow time for seroconversion [29].”
Background
Effective Inhibition of SARS-CoV-2 Entry by Heparin and Enoxaparin Derivatives
Tandon, R., Sharp, J. S., Zhang, F., Pomin, V. H., Ashpole, N. M., Mitra, D., McCandless, M. G., Jin, W., Liu, H., Sharma, P. C., et al. (2020) · Journal of Virology · doi:10.1128/jvi.01987-20 · Cited by 263

Authors: Wölfel, R., Corman, V. M., Guggemos, W., Seilmaier, M., Zange, S., Müller, M. A., Niemeyer, D., Jones, T. C., Vollmar, P., Rothe, C., Hoelscher, M., Bleicker, T., Brünink, S., Schneider, J., Ehmann, R., Zwirglmaier, K., Drosten, C., & Wendtner, C.
Affiliations: Institut für Mikrobiologie der Bundeswehr (DE)
Charité – Universitätsmedizin Berlin (DE)
München Klinik Schwabing (DE)
University of Cambridge (GB)
LMU Klinikum (DE)
Corresponding author: Drosten, Christian
Wendtner, Clemens
ORCID: Wölfel, Roman
Corman, Victor M.
Seilmaier, Michael
Zange, Sabine
Müller, Marcel A.
Niemeyer, Daniela
Jones, Terry C.
Bleicker, Tobias
Schneider, Julia
Ehmann, Rosina
Zwirglmaier, Katrin
Drosten, Christian
Wendtner, Clemens
Venue: Nature
Publisher: Springer Science and Business Media LLC
Published: 2020-04-01
Volume: 581
Issue: 7809
Pages: 465-469
ISSN: 0028-0836 (ISSN-L)
1476-4687
DOI: 10.1038/s41586-020-2196-x
OpenAlex: W3013893137
Cited by: 6,661
References: 37
Citations by year: 2026: 92 · 2025: 165 · 2024: 328 · 2023: 526 · 2022: 1091 · 2021: 2228 · 2020: 2219
FWCI: 199.03
Type: journal article
Language: en
Update notices: correction (2020-12-11)
Open access: bronze
doi.org
Licence: www.springer.com/tdm (tdm)
www.springer.com/tdm (vor)
Locations: Nature (publishedVersion)
medRxiv (acceptedVersion)
PubMed (publishedVersion)
RePEc: Research Papers in Economics (submittedVersion)
Funders: European Commission (602525)
Topics: Health Sciences › Medicine › Infectious Diseases › SARS-CoV-2 and COVID-19 Research
Health Sciences › Medicine › Infectious Diseases › COVID-19 Clinical Research Studies
Health Sciences › Medicine › Infectious Diseases › SARS-CoV-2 detection and testing
Keywords: COVID-19 pandemic, SARS-CoV-2, upper respiratory tract, viral replication, seroconversion, viral load, hospitalized patients
MeSH terms: Seroconversion, Betacoronavirus, COVID-19, SARS-CoV-2, COVID-19 Testing, Coronavirus Envelope Proteins, Antibodies, Viral, Base Sequence, Blood, Feces, Hospitalization, Humans, Immunoglobulin G, Immunoglobulin M, Lung, Pharynx, Pneumonia, Viral, RNA, Viral, Sputum, Urine, Viral Envelope Proteins, Virus Replication, Virus Shedding, Coronavirus Infections, Clinical Laboratory Techniques, Viral Load, Polymorphism, Single Nucleotide, Pandemics

About these checks

Registry, retraction, Cites and statistics results are computed, not judged, with one exception: a printed reference that no index lists is read once by a model before it counts as a citation error. Claims are extracted by a model and kept only when their quote appears verbatim in the text; each cited source is then checked, with a model’s help, for whether it says what the claim relies on. Those verdicts can be wrong — read the claim’s quote and the cited source before relying on one.

Statistics and arithmetic are recomputed, not judged.

Confidence bands are shown only for fields calibrated on our annotated test set. None is calibrated yet, so no band is shown.

What counts as a claim ›How we measure confidence ›How we check this ›

Are you an author, or do you see a problem with this page? Request a review

Virological assessment of hospitalized patients with COVID-2019

Abstract

Overview

Integrity signals

Verification

Claims the paper makes

Claims other papers make about this one

Self-check

Citations

Cites

Cited by

Related

Metadata

Record

About these checks