MicroRNA-33-dependent regulation of macrophage metabolism directs immune cell polarization in atherosclerosis

Ouimet, Mireille; Ediriweera, Hasini N.; Gundra, U. Mahesh; Sheedy, Frederick J.; Ramkhelawon, Bhama; Hutchison, Susan B.; Rinehold, Kaitlyn; van Solingen, Coen; Fullerton, Morgan D.; Cecchini, Katharine; Rayner, Katey J.; Steinberg, Gregory R.; Zamore, Phillip D.; Fisher, Edward A.; Loke, P’ng; Moore, Kathryn J.

doi:10.1172/jci81676

Cited by 396Atherosclerosis and Cardiovascular DiseasesMicroRNA in disease regulationCholesterol and Lipid Metabolism

MicroRNA-33-dependent regulation of macrophage metabolism directs immune cell polarization in atherosclerosis

Open access

Ouimet, Mireille, Ediriweera, Hasini N., Gundra, U. Mahesh, Sheedy, Frederick J., Ramkhelawon, Bhama, Hutchison, Susan B., Rinehold, Kaitlyn, van Solingen, Coen +8 more·2015·Journal of Clinical Investigation

DOI 10.1172/jci81676PMC PMC4665799

Open this paper in CoChat — free account Open PDF

Abstract

Cellular metabolism is increasingly recognized as a controller of immune cell fate and function. MicroRNA-33 (miR-33) regulates cellular lipid metabolism and represses genes involved in cholesterol efflux, HDL biogenesis, and fatty acid oxidation. Here, we determined that miR-33-mediated disruption of the balance of aerobic glycolysis and mitochondrial oxidative phosphorylation instructs macrophage inflammatory polarization and shapes innate and adaptive immune responses. Macrophage-specific Mir33 deletion increased oxidative respiration, enhanced spare respiratory capacity, and induced an M2 macrophage polarization-associated gene profile. Furthermore, miR-33-mediated M2 polarization required miR-33 targeting of the energy sensor AMP-activated protein kinase (AMPK), but not cholesterol efflux. Notably, miR-33 inhibition increased macrophage expression of the retinoic acid-producing enzyme aldehyde dehydrogenase family 1, subfamily A2 (ALDH1A2) and retinal dehydrogenase activity both in vitro and in a mouse model. Consistent with the ability of retinoic acid to foster inducible Tregs, miR-33-depleted macrophages had an enhanced capacity to induce forkhead box P3 (FOXP3) expression in naive CD4(+) T cells. Finally, treatment of hypercholesterolemic mice with miR-33 inhibitors for 8 weeks resulted in accumulation of inflammation-suppressing M2 macrophages and FOXP3(+) Tregs in plaques and reduced atherosclerosis progression. Collectively, these results reveal that miR-33 regulates macrophage inflammation and demonstrate that miR-33 antagonism is atheroprotective, in part, by reducing plaque inflammation by promoting M2 macrophage polarization and Treg induction.

Integrity signals

Registry

Crossref · 10.1172/jci81676

Cites

67 of 67 references verified0 citation errors · 0 not checkable

Statistics

Recomputing p-values needs the paper’s full text.

Claims the paper makes

We couldn’t retrieve this paper’s full text, so its claims and self-check weren’t run. The registry and citation checks still apply.

Claims other papers make about this one

Each is checked against this paper’s own text: does it say what the citing paper says it does?

Several studies have found that antagonism of miR-33 can reduce atherosclerotic plaque burden.
“several studies have found that antagonism of miR-33 can reduce atherosclerotic plaque burden (Karunakaran et al., 2015; Ouimet et al., 2015; Rayner et al., 2011b; Rotllan et al., 2013).”
From Genetic dissection of the impact of miR-33a and miR-33b during the progression of atherosclerosis (2017) · cites this paper as Ouimet et al., 2015
Inhibition of miR-33a or miR-33a deletion in macrophages affects myeloid cell differentiation, induces M2 macrophage polarization with mitochondrial respiratory and metabolic changes, and enhances autophagy.
“Inhibition of miR-33a or miR-33a deletion in macrophages has been shown to affect myeloid cell differentiation 25) , induce M2 macrophage polarization with mitochondrial respiratory and metabolic changes 26 , 27) , and enhance autophagy 28 , 29) .”
From Critical Role of microRNA-33a/b in Cardiovascular and Metabolic Disease: Molecular Mechanisms and Therapeutic Perspectives (2026) · cites this paper as [26]
miR-33 is overexpressed in M1, thus promoting pro-inflammatory functions.
“Expression of miR-33 is also overexpressed in M1, thus promoting pro-inflammatory functions [132].”
From MicroRNAs as Regulators of Phagocytosis (2022) · cites this paper as [132]

Macrophage biology in development, homeostasis and disease
Wynn, T. A., Chawla, A., & Pollard, J. W. (2013) · Nature · doi:10.1038/nature12034 · Cited by 4,684 · cited 3× · see citing works
“In addition, macrophages play important roles in tissue homeostasis and resolution of inflammation (2).”
AMPK: a nutrient and energy sensor that maintains energy homeostasis
Hardie, D. G., Ross, F. A., & Hawley, S. A. (2012) · Nature Reviews Molecular Cell Biology · doi:10.1038/nrm3311 · Cited by 4,602 · see citing works
Succinate is an inflammatory signal that induces IL-1β through HIF-1α
Tannahill, G. M., Curtis, A. M., Adamik, J., Palsson-McDermott, E. M., McGettrick, A. F., Goel, G., Frezza, C., Bernard, N. J., Kelly, B., Foley, N. H., et al. (2013) · Nature · doi:10.1038/nature11986 · Cited by 4,176 · see citing works
Monocyte recruitment during infection and inflammation
Shi, C., & Pamer, E. G. (2011) · Nature Reviews Immunology · doi:10.1038/nri3070 · Cited by 3,015 · see citing works
Macrophages in the Pathogenesis of Atherosclerosis
Moore, K. J., & Tabas, I. (2011) · Cell · doi:10.1016/j.cell.2011.04.005 · Cited by 2,669 · see citing works
Self-citation
Macrophages in atherosclerosis: a dynamic balance
Moore, K. J., Sheedy, F. J., & Fisher, E. A. (2013) · Nature reviews. Immunology · doi:10.1038/nri3520 · Cited by 2,559 · see citing works
Self-citation
Metabolic control through the PGC-1 family of transcription coactivators
Lin, J., Handschin, C., & Spiegelman, B. M. (2005) · Cell Metabolism · doi:10.1016/j.cmet.2005.05.004 · Cited by 2,130 · cited 1× · see citing works
“…malonyl-CoA–mediated inhibition of CPT1 and stimulating uptake of activated fatty acids into the mitochondria (44, 45), and (b) enhancement of expression of SIRT1 and PGC-1 α , resulting in transcriptional activation of genes involved in mitochondrial FAO and mitochondrial biogenesis (46, 47).”
Cutting Edge: Distinct Glycolytic and Lipid Oxidative Metabolic Programs Are Essential for Effector and Regulatory CD4+ T Cell Subsets
Michalek, R. D., Gerriets, V. A., Jacobs, S. R., Macintyre, A. N., MacIver, N. J., Mason, E. F., Sullivan, S. A., Nichols, A. G., & Rathmell, J. C. (2011) · The Journal of Immunology · doi:10.4049/jimmunol.1003613 · Cited by 2,091 · see citing works
HIF1α–dependent glycolytic pathway orchestrates a metabolic checkpoint for the differentiation of TH17 and Treg cells
Shi, L. Z., Wang, R., Huang, G., Vogel, P., Neale, G., Green, D. R., & Chi, H. (2011) · Journal of Experimental Medicine · doi:10.1084/jem.20110278 · Cited by 1,803 · see citing works
Oxidative metabolism and PGC-1β attenuate macrophage-mediated inflammation
Vats, D., Mukundan, L., Odegaard, J. I., Zhang, L., Smith, K. L., Morel, C. R., Greaves, D. R., Murray, P. J., & Chawla, A. (2006) · Cell Metabolism · doi:10.1016/j.cmet.2006.05.011 · Cited by 1,369 · see citing works
MiR-33 Contributes to the Regulation of Cholesterol Homeostasis
Rayner, K. J., Suárez, Y., Dávalos, A., Parathath, S., Fitzgerald, M. L., Tamehiro, N., Fisher, E. A., Moore, K. J., & Fernández-Hernando, C. (2010) · Science · doi:10.1126/science.1189862 · Cited by 1,260 · see citing works
Self-citation
Toll-like receptor–induced changes in glycolytic metabolism regulate dendritic cell activation
Krawczyk, C. M., Holowka, T., Sun, J., Blagih, J., Amiel, E., DeBerardinis, R. J., Cross, J. R., Jung, E., Thompson, C. B., Jones, R. G., et al. (2010) · Blood · doi:10.1182/blood-2009-10-249540 · Cited by 1,246 · see citing works
Cell-intrinsic lysosomal lipolysis is essential for alternative activation of macrophages
Huang, S. C., Everts, B., Ivanova, Y., O’Sullivan, D., Nascimento, M., Smith, A. M., Beatty, W. L., Love-Gregory, L. D., Lam, W. Y., O’Neill, C. M., et al. (2014) · Nature Immunology · doi:10.1038/ni.2956 · Cited by 1,215 · see citing works
Substrate Fate in Activated Macrophages: A Comparison between Innate, Classic, and Alternative Activation
Rodríguez-Prados, J.-C., Través, P. G., Cuenca, J., Rico, D., Aragonés, J., Martín-Sanz, P., Cascante, M., & Boscá, L. (2010) · The Journal of Immunology · doi:10.4049/jimmunol.0901698 · Cited by 1,022 · see citing works
MicroRNA-33 and the SREBP Host Genes Cooperate to Control Cholesterol Homeostasis
Najafi-Shoushtari, S. H., Kristo, F., Li, Y., Shioda, T., Cohen, D. E., Gerszten, R. E., & Näär, A. M. (2010) · Science · doi:10.1126/science.1189123 · Cited by 957 · cited 2× · see citing works
“…with their host genes, SREBF2 and SREBF1 , which code for transcription factors that regulate cholesterol and fatty acid synthesis/uptake (24–26). miR-33a/b repress the expression of genes involved in pathways that these oppose SREBP-driven functions, including cholesterol efflux ( ABCA1 ,…”
Metabolic Reprogramming of Macrophages
Freemerman, A. J., Johnson, A. R., Sacks, G. N., Milner, J. J., Kirk, E. L., Troester, M. A., Macintyre, A. N., Goraksha-Hicks, P., Rathmell, J. C., & Makowski, L. (2014) · Journal of Biological Chemistry · doi:10.1074/jbc.m113.522037 · Cited by 956 · see citing works
Metabolic regulation of immune responses
Ganeshan, K., & Chawla, A. (2014) · Annual Review of Immunology · doi:10.1146/annurev-immunol-032713-120236 · Cited by 926 · see citing works
Intestinal tolerance requires gut homing and expansion of FoxP3+ regulatory T cells in the lamina propria.
Hadis, U., Wahl, B., Schulz, O., Hardtke-Wolenski, M., Schippers, A., Wagner, N., Müller, W., Sparwasser, T., Förster, R., & Pabst, O. (2011) · Immunity · doi:10.1016/j.immuni.2011.01.016 · Cited by 893 · see citing works
Single phosphorylation sites in Acc1 and Acc2 regulate lipid homeostasis and the insulin-sensitizing effects of metformin
Fullerton, M. D., Galic, S., Marcinko, K., Sikkema, S., Pulinilkunnil, T., Chen, Z.-P., O'Neill, H. M., Ford, R. J., Palanivel, R., O'Brien, M., et al. (2013) · Nature Medicine · doi:10.1038/nm.3372 · Cited by 893 · see citing works
Self-citation
IFN-gamma potentiates atherosclerosis in ApoE knock-out mice.
Gupta, S. K. S., Pablo, A. M., Jiang, X., Wang, N., Tall, A. R., & Schindler, C. (1997) · Journal of Clinical Investigation · doi:10.1172/jci119465 · Cited by 863 · see citing works
Adenosine 5′-Monophosphate-Activated Protein Kinase Promotes Macrophage Polarization to an Anti-Inflammatory Functional Phenotype
Sağ, D., Carling, D., Stout, R. D., & Suttles, J. (2008) · The Journal of Immunology · doi:10.4049/jimmunol.181.12.8633 · Cited by 798 · see citing works
Krüppel-like factor 4 regulates macrophage polarization
Liao, X., Sharma, N., Kapadia, F., Zhou, G., Lu, Y., Hong, H., Paruchuri, K., Mahabeleshwar, G. H., Dalmas, E., Venteclef, N., et al. (2011) · Journal of Clinical Investigation · doi:10.1172/jci45444 · Cited by 778 · see citing works
Inhibition of miR-33a/b in non-human primates raises plasma HDL and lowers VLDL triglycerides
Rayner, K. J., Esau, C. C., Hussain, F. N., McDaniel, A. L., Marshall, S. M., van Gils, J. M., Ray, T. D., Sheedy, F. J., Goedeke, L., Liu, X., et al. (2011) · Nature · doi:10.1038/nature10486 · Cited by 706 · see citing works
Self-citation
Antagonism of miR-33 in mice promotes reverse cholesterol transport and regression of atherosclerosis
Rayner, K. J., Sheedy, F. J., Esau, C. C., Hussain, F. N., Temel, R. E., Parathath, S., van Gils, J. M., Rayner, A. J., Chang, A. N., Suarez, Y., et al. (2011) · Journal of Clinical Investigation · doi:10.1172/jci57275 · Cited by 690 · cited 1× · see citing works
“The 2 ′ -fluoro-methoxyethyl–modified control (TTATCGCCATGTCCAATGAGGCT) or anti–miR-33 (TGCAATG-CAACTACAATGCAC) oligonucleotides were provided by Regulus Therapeutics and were characterized as described (30, 31).”
Self-citation
miR-33a/b contribute to the regulation of fatty acid metabolism and insulin signaling
Dávalos, A., Goedeke, L., Smibert, P., Ramírez, C. M., Warrier, N. P., Andreo, U., Cirera-Salinas, D., Rayner, K., Suresh, U., Pastor-Pareja, J. C., et al. (2011) · Proceedings of the National Academy of Sciences · doi:10.1073/pnas.1102281108 · Cited by 670 · cited 5× · see citing works
“We previously demonstrated that miR-33 targets genes involved in FAO in hepatocytes, including Cpt1a , Crot , Hadhb , and Prkaa1 (27), and show here that miR-33 overexpression and inhibition in macrophages reciprocally regulates the expression of Cpt1a , Crot , Hadhb , and Prkaa1 mRNA (Figure 2C).”
InfluentialSelf-citation
Efficient Clearance of Early Apoptotic Cells by Human Macrophages Requires M2c Polarization and MerTK Induction
Zizzo, G., Hilliard, B. A., Monestier, M., & Cohen, P. L. (2012) · The Journal of Immunology · doi:10.4049/jimmunol.1200662 · Cited by 650 · see citing works
Alternative macrophage activation and metabolism
Odegaard, J. I., & Chawla, A. (2011) · Annual Review of Pathology: Mechanisms of Disease · doi:10.1146/annurev-pathol-011110-130138 · Cited by 640 · see citing works
Carnitine palmitoyltransferase I. The site of inhibition of hepatic fatty acid oxidation by malonyl-CoA.
McGarry, J., Leatherman, G. F., & Foster, D. W. (1978) · Journal of Biological Chemistry · doi:10.1016/s0021-9258(17)34693-8 · Cited by 591 · see citing works
miR-33 links SREBP-2 induction to repression of sterol transporters
Marquart, T. J., Allen, R. M., Ory, D. S., & Baldán, Á. (2010) · Proceedings of the National Academy of Sciences · doi:10.1073/pnas.1005191107 · Cited by 562 · see citing works
The Role of Retinoic Acid in Tolerance and Immunity
Hall, J. A., Grainger, J. R., Spencer, S. P., & Belkaid, Y. (2011) · Immunity · doi:10.1016/j.immuni.2011.07.002 · Cited by 556 · see citing works
Type 2 immunity and wound healing: evolutionary refinement of adaptive immunity by helminths
Gause, W. C., Wynn, T. A., & Allen, J. E. (2013) · Nature reviews. Immunology · doi:10.1038/nri3476 · Cited by 467 · see citing works
Increased Inflammatory Gene Expression in ABC Transporter–Deficient Macrophages
Yvan‐Charvet, L., Welch, C. L., Pagler, T. A., Ranalletta, M., Lamkanfi, M., Han, S., Ishibashi, M., Li, R., Wang, N., & Tall, A. R. (2008) · Circulation · doi:10.1161/circulationaha.108.793869 · Cited by 456 · see citing works
NR4A1 (Nur77) Deletion Polarizes Macrophages Toward an Inflammatory Phenotype and Increases Atherosclerosis
Hanna, R. N., Shaked, I., Hubbeling, H., Punt, J. A., Wu, R., Herrley, E., Zaugg, C., Pei, H., Geissmann, F., Ley, K. F., et al. (2011) · Circulation Research · doi:10.1161/circresaha.111.253377 · Cited by 449 · see citing works
Disruption of TGF-β signaling in T cells accelerates atherosclerosis
Robertson, A.-K. L., Rudling, M. J., Zhou, X., Gorelik, L., Flavell, R. A., & Hansson, G. K. (2003) · Journal of Clinical Investigation · doi:10.1172/jci18607 · Cited by 440 · see citing works
Lymphotoxin β receptor signaling promotes tertiary lymphoid organogenesis in the aorta adventitia of aged ApoE −/− mice
Gräbner, R., Lötzer, K., Döpping, S., Hildner, M., Radke, D., Beer, M., Spanbroek, R., Lippert, B., Reardon, C. A., Getz, G. S., et al. (2009) · The Journal of Experimental Medicine · doi:10.1084/jem.20080752 · Cited by 398 · see citing works
Human Atherosclerotic Plaque Alternative Macrophages Display Low Cholesterol Handling but High Phagocytosis Because of Distinct Activities of the PPARγ and LXRα Pathways
Chinetti-Gbaguidi, G., Baron, M., Bouhlel, M. A., Vanhoutte, J., Copin, C., Sebti, Y., Derudas, B., Mayi, T., Bories, G., Tailleux, A., et al. (2011) · Circulation Research · doi:10.1161/circresaha.110.233775 · Cited by 387 · see citing works
MicroRNA-33 encoded by an intron of sterol regulatory element-binding protein 2 ( Srebp2 ) regulates HDL in vivo
Horie, T., Ono, K., Horiguchi, M., Nishi, H., Nakamura, T., Nagao, K., Kinoshita, M., Kuwabara, Y., Marusawa, H., Iwanaga, Y., et al. (2010) · Proceedings of the National Academy of Sciences · doi:10.1073/pnas.1008499107 · Cited by 384 · see citing works
Expression of miR-33 from an SREBP2 Intron Inhibits Cholesterol Export and Fatty Acid Oxidation*
Gerin, I., Clerbaux, L.-A., Haumont, O., Lanthier, N., Das, A. K., Burant, C. F., Leclercq, I. A., MacDougald, O. A., & Bommer, G. T. (2010) · Journal of Biological Chemistry · doi:10.1074/jbc.m110.152090 · Cited by 382 · see citing works
Exogenous Interferon-γ Enhances Atherosclerosis in Apolipoprotein E−/− Mice
Whitman, S. C., Ravisankar, P., Elam, H., & Daugherty, A. (2000) · American Journal Of Pathology · doi:10.1016/s0002-9440(10)64820-1 · Cited by 379 · see citing works
Loss of receptor-mediated lipid uptake via scavenger receptor A or CD36 pathways does not ameliorate atherosclerosis in hyperlipidemic mice
Moore, K. J., Kunjathoor, V. V., Koehn, S. L., Manning, J. J., Tseng, A. A., Silver, J. M., McKee, M. L., & Freeman, M. W. (2005) · Journal of Clinical Investigation · doi:10.1172/jci24061 · Cited by 371 · see citing works
Self-citation
Alternatively activated macrophages derived from monocytes and tissue macrophages are phenotypically and functionally distinct
Gundra, U. M., Girgis, N. M., Ruckerl, D., Jenkins, S., Ward, L. N., Kurtz, Z. D., Wiens, K. E., Tang, M. S., Basu-Roy, U., Mansukhani, A., et al. (2014) · Blood · doi:10.1182/blood-2013-08-520619 · Cited by 371 · see citing works
Self-citation
AMPK regulation of fatty acid metabolism and mitochondrial biogenesis: implications for obesity.
O’Neill, H. M., Holloway, G. P., & Steinberg, G. R. (2013) · Molecular and Cellular Endocrinology · doi:10.1016/j.mce.2012.06.019 · Cited by 364 · see citing works
Self-citation
Increased Cellular Free Cholesterol in Macrophage-specific Abca1 Knock-out Mice Enhances Pro-inflammatory Response of Macrophages
Zhu, X., Lee, J., Timmins, J. M., Brown, J. M., Boudyguina, E. Y., Mulya, A., Gebre, A. K., Willingham, M. C., Hiltbold, E. M., Mishra, N., et al. (2008) · Journal of Biological Chemistry · doi:10.1074/jbc.m801408200 · Cited by 350 · see citing works
Hematopoietic AMPK β1 reduces mouse adipose tissue macrophage inflammation and insulin resistance in obesity
Galić, S., Fullerton, M. D., Schertzer, J. D., Sikkema, S. R., Marcinko, K., Walkley, C. R., Izon, D. J., Honeyman, J. E., Chen, Z., van Denderen, B. J., et al. (2011) · Journal of Clinical Investigation · doi:10.1172/jci58577 · Cited by 344 · see citing works
Self-citation
Macrophage ABCA1 reduces MyD88-dependent Toll-like receptor trafficking to lipid rafts by reduction of lipid raft cholesterol
Zhu, X., Owen, J. S., Wilson, M. D., Li, H., Griffiths, G. L., Thomas, M. J., Hiltbold, E. M., Fessler, M. B., & Parks, J. S. (2010) · Journal of Lipid Research · doi:10.1194/jlr.m006486 · Cited by 331 · see citing works
HDL promotes rapid atherosclerosis regression in mice and alters inflammatory properties of plaque monocyte-derived cells
Feig, J. E., Rong, J. X., Shamir, R., Sanson, M., Vengrenyuk, Y., Liu, J., Rayner, K. J., Moore, K. J., Garabedian, M. J., & Fisher, E. A. A. (2011) · Proceedings of the National Academy of Sciences · doi:10.1073/pnas.1016086108 · Cited by 313 · see citing works
Self-citation
Interleukin‐13 protects from atherosclerosis and modulates plaque composition by skewing the macrophage phenotype
Cardilo‐Reis, L., Gruber, S., Schreier, S. M., Drechsler, M., Papac‐Milicevic, N., Weber, C., Wagner, O., Stangl, H., Soehnlein, O., & Binder, C. J. (2012) · EMBO Molecular Medicine · doi:10.1002/emmm.201201374 · Cited by 292 · see citing works
Influence of Interferon-γ on the Extent and Phenotype of Diet-Induced Atherosclerosis in the LDLR-Deficient Mouse
Buono, C., Come, C. E., Stavrakis, G., Maguire, G. F., Connelly, P. W., & Lichtman, A. H. (2003) · Arteriosclerosis Thrombosis and Vascular Biology · doi:10.1161/01.atv.0000059419.11002.6e · Cited by 288 · see citing works
Loss of SR-A and CD36 Activity Reduces Atherosclerotic Lesion Complexity Without Abrogating Foam Cell Formation in Hyperlipidemic Mice
Manning, J. J., Moore, K. J., Seimon, T. A., Bell, S. A., Sharuk, M., Alvarez-Leite, J. I., de Winther, M. P. J., Tabas, I. A., & Freeman, M. W. (2008) · Arteriosclerosis Thrombosis and Vascular Biology · doi:10.1161/atvbaha.108.176644 · Cited by 266 · see citing works
Self-citation
Reversal of Hyperlipidemia With a Genetic Switch Favorably Affects the Content and Inflammatory State of Macrophages in Atherosclerotic Plaques
Feig, J. E., Parathath, S., Rong, J. X., Mick, S. L., Vengrenyuk, Y., Grauer, L., Young, S. G., & Fisher, E. A. A. (2011) · Circulation · doi:10.1161/circulationaha.110.984146 · Cited by 236 · see citing works
Self-citation
MicroRNA‐33 Deficiency Reduces the Progression of Atherosclerotic Plaque in ApoE −/− Mice
Horie, T., Baba, O., Kuwabara, Y., Chujo, Y., Watanabe, S., Kinoshita, M., Horiguchi, M., Nakamura, T., Chonabayashi, K., Hishizawa, M., et al. (2012) · Journal of the American Heart Association · doi:10.1161/jaha.112.003376 · Cited by 220 · see citing works
The role of macrophages in the induction of antibody in x-irradiated animals.
Gallily, R., & Feldman, M. (1967) · PubMed Central · Cited by 214 · see citing works
Dynamic Aspects of Macrophage Polarization during Atherosclerosis Progression and Regression
Peled, M., & Fisher, E. A. A. (2014) · Frontiers in Immunology · doi:10.3389/fimmu.2014.00579 · Cited by 203 · see citing works
Self-citation
Treating Atherosclerosis With Regulatory T Cells
Foks, A. C., Lichtman, A. H., & Kuiper, J. (2014) · Arteriosclerosis Thrombosis and Vascular Biology · doi:10.1161/atvbaha.114.303568 · Cited by 203 · see citing works
PPARγ controls CD1d expression by turning on retinoic acid synthesis in developing human dendritic cells
Szatmári, I., Pap, A., Rühl, R., Ma, J.-X., Illarionov, P. A., Besra, G. S., Rajnavölgyi, É., Dezsö, B., & Nagy, L. (2006) · The Journal of Experimental Medicine · doi:10.1084/jem.20060141 · Cited by 186 · see citing works
Bone Marrow–Specific Deficiency of Nuclear Receptor Nur77 Enhances Atherosclerosis
Hamers, A. A. J., Vos, M., Rassam, F., Marinković, G., Kurakula, K., van Gorp, P. J., de Winther, M. P. J., Gijbels, M. J., de Waard, V., & de Vries, C. J. M. (2011) · Circulation Research · doi:10.1161/circresaha.111.260760 · Cited by 180 · see citing works
Therapeutic Silencing of MicroRNA-33 Inhibits the Progression of Atherosclerosis in Ldlr −/− Mice—Brief Report
Rotllan, N., Ramírez, C. M., Aryal, B., Esau, C. C., & Fernández-Hernando, C. (2013) · Arteriosclerosis, Thrombosis, and Vascular Biology · doi:10.1161/atvbaha.113.301732 · Cited by 174 · see citing works
Attenuation of atherogenesis by systemic and local adenovirus‐mediated gene transfer of interleukin‐10 in LDLr ‐/‐ Mice
von der Thüsen, J. H., Kuiper, J., Fekkes, M. L., de Vos, P., van Berkel, T. J. C., & Biessen, E. A. L. (2001) · The FASEB Journal · doi:10.1096/fj.01-0483fje · Cited by 167 · see citing works
Laser capture microdissection analysis of gene expression in macrophages from atherosclerotic lesions of apolipoprotein E-deficient mice
Trogan, E., Choudhury, R. P., Dansky, H. M., Rong, J. X., Breslow, J. L., & Fisher, E. A. A. (2002) · Proceedings of the National Academy of Sciences · doi:10.1073/pnas.042683999 · Cited by 163 · see citing works
Self-citation
Measurement of Fatty Acid Oxidation Rates in Animal Tissues and Cell Lines
Huynh, F. K., Green, M. F., Koves, T. R., & Hirschey, M. D. (2014) · Methods in enzymology on CD-ROM/Methods in enzymology · doi:10.1016/b978-0-12-416618-9.00020-0 · Cited by 154 · see citing works
MicroRNAs in metabolism and metabolic diseasesPreprint
Rottiers, V., Najafi-Shoushtari, S. H., Kristo, F., Gurumurthy, S., Zhong, L., Li, Y.-X., Cohen, D. E., Gerszten, R. E., Bardeesy, N., Mostoslavsky, R., et al. (2011) · Cold Spring Harbor Symposia on Quantitative Biology · doi:10.1101/sqb.2011.76.011049 · Cited by 130 · see citing works
Pharmacological inhibition of a microRNA family in nonhuman primates by a seed-targeting 8-mer antimiR
Rottiers, V., Obad, S., Petri, A., McGarrah, R., Lindholm, M. W., Black, J. C., Sinha, S., Goody, R. J., Lawrence, M. S., deLemos, A. S., et al. (2013) · Science Translational Medicine · doi:10.1126/scitranslmed.3006840 · Cited by 121 · see citing works
Anti-miR-33 therapy does not alter the progression of atherosclerosis in low-density lipoprotein receptor-deficient mice
Marquart, T. J., Wu, J., Lusis, A. J., & Baldán, Á. (2013) · Arteriosclerosis, Thrombosis, and Vascular Biology · doi:10.1161/atvbaha.112.300639 · Cited by 110 · see citing works
microRNA control of HDL Metabolism and Function
Rayner, K. J., & Moore, K. (2014) · Circulation Research · doi:10.1161/circresaha.114.300645 · Cited by 89 · see citing works
Self-citation
Reprogramming macrophages to an anti‐inflammatory phenotype by helminth antigens reduces murine atherosclerosis
Wolfs, I. M. J., Stöger, J. L., Goossens, P., Pöttgens, C. C. H., Gijbels, M. J., Wijnands, E., van der Vorst, E. P. C., van Gorp, P. J., Beckers, L., Engel, D. A., et al. (2013) · The FASEB Journal · doi:10.1096/fj.13-235911 · Cited by 78 · see citing works
Upregulation of Retinal Dehydrogenase 2 in Alternatively Activated Macrophages during Retinoid-dependent Type-2 Immunity to Helminth Infection in Mice
Broadhurst, M. J., Leung, J. M., Lim, K. C., Girgis, N. M., Gundra, U. M., Fallon, P. G., Premenko‐Lanier, M., McKerrow, J. H., McCune, J. M., & Loke, P. (2012) · PLoS Pathogens · doi:10.1371/journal.ppat.1002883 · Cited by 71 · see citing works
Self-citation
Endogenous apolipoprotein A‐I stabilizes ATP‐binding cassette transporter A1 and modulates Toll‐like receptor 4 signaling in human macrophages
Mogilenko, D. A., Orlov, S., Trulioff, A. S., Иванов, А. В., Nagumanov, V. K., Кудрявцев, И. В., Shavva, V. S., Tanyanskiy, D. A., & Ap, P. (2012) · The FASEB Journal · doi:10.1096/fj.11-193946 · Cited by 48 · see citing works

Flagged first, then by citations

Sorted by citations

Macrophage Polarization
Murray, P. J. (2017) · Annual Review of Physiology · doi:10.1146/annurev-physiol-022516-034339 · Cited by 2,981 · see citing works
Pathophysiology of Atherosclerosis
Jebari‐Benslaiman, S., Galicia-García, U., Larrea, A., Olaetxea, J. R., Alloza, I., Vandenbroeck, K., Benito‐Vicente, A., & Martı́n, C. (2022) · International Journal of Molecular Sciences · doi:10.3390/ijms23063346 · Cited by 1,078 · see citing works
Mitochondrial dysfunction prevents repolarization of inflammatory macrophages
Van den Bossche, J., Baardman, J., Otto, N. A., van der Velden, S., Neele, A. E., van den Berg, S. M., Luque-Martin, R., Chen, H.-J., Boshuizen, M. C. S., Ahmed, M., et al. (2016) · Cell Reports · doi:10.1016/j.celrep.2016.09.008 · Cited by 1,027 · see citing works
HDL and Reverse Cholesterol Transport: Basic Mechanisms and their Roles in Vascular Health and Disease
Ouimet, M., Barrett, T. J., & Fisher, E. (2019) · Circulation Research · doi:10.1161/circresaha.119.312617 · Cited by 416 · see citing works
Self-citation
AMP-activated protein kinase: the current landscape for drug development
Steinberg, G. R., & Carling, D. (2019) · Nature Reviews Drug Discovery · doi:10.1038/s41573-019-0019-2 · Cited by 757 · see citing works
Self-citation
New insights into oxidative stress and inflammation during diabetes mellitus-accelerated atherosclerosis
Yuan, T., Yang, T., Chen, H., Fu, D., Hu, Y., Wang, J., Yuan, Q., Yu, H., Xu, W., & Xie, X. (2018) · Redox Biology · doi:10.1016/j.redox.2018.09.025 · Cited by 749 · see citing works
Macrophages in inflammation, repair and regeneration
Oishi, Y., & Manabe, I. (2018) · International Immunology · doi:10.1093/intimm/dxy054 · Cited by 645 · see citing works
Monocyte-macrophages and T cells in atherosclerosis
Tabas, I., & Lichtman, A. H. (2017) · Immunity · doi:10.1016/j.immuni.2017.09.008 · Cited by 646 · see citing works
Macrophages in Atherosclerosis Regression
Barrett, T. J. (2019) · Arteriosclerosis Thrombosis and Vascular Biology · doi:10.1161/atvbaha.119.312802 · Cited by 633 · see citing works
MicroRNA Regulation of Atherosclerosis
Feinberg, M. W., & Moore, K. J. (2016) · Circulation Research · doi:10.1161/circresaha.115.306300 · Cited by 630 · see citing works
Self-citation
AMPK as a Therapeutic Target for Treating Metabolic Diseases
Day, E. A., Ford, R. J., & Steinberg, G. R. (2017) · Trends in Endocrinology and Metabolism · doi:10.1016/j.tem.2017.05.004 · Cited by 620 · see citing works
Self-citation
How the immune system shapes atherosclerosis: roles of innate and adaptive immunity
Roy, P., Orecchioni, M., & Ley, K. F. (2021) · Nature reviews. Immunology · doi:10.1038/s41577-021-00584-1 · Cited by 584 · see citing works
Regulation of macrophage immunometabolism in atherosclerosis
Koelwyn, G. J., Corr, E. M., Erbay, E., & Moore, K. J. (2018) · Nature Immunology · doi:10.1038/s41590-018-0113-3 · Cited by 557 · see citing works
Self-citation
Lipid Metabolism in Regulation of Macrophage Functions
Yan, J., & Horng, T. (2020) · Trends in Cell Biology · doi:10.1016/j.tcb.2020.09.006 · Cited by 554 · see citing works
Targeting Macrophages in Cancer: From Bench to Bedside
Poh, A. R., & Ernst, M. (2018) · Frontiers in Oncology · doi:10.3389/fonc.2018.00049 · Cited by 497 · see citing works
Macrophages and lipid metabolism
Remmerie, A., & Scott, C. L. (2018) · Cellular Immunology · doi:10.1016/j.cellimm.2018.01.020 · Cited by 385 · see citing works
Atherosclerotic Plaque Healing
Vergallo, R., & Crea, F. (2020) · New England Journal of Medicine · doi:10.1056/nejmra2000317 · Cited by 383 · see citing works
MicroRNA-mediated regulation of glucose and lipid metabolism
Agbu, P., & Carthew, R. W. (2021) · Nature Reviews Molecular Cell Biology · doi:10.1038/s41580-021-00354-w · Cited by 368 · see citing works
Macrophages in cardiovascular diseases: molecular mechanisms and therapeutic targets
Chen, R., Zhang, H., Tang, B., Luo, Y., Yang, Y., Zhong, X., Chen, S., Xu, X., Huang, S., & Liu, C. (2024) · Signal Transduction and Targeted Therapy · doi:10.1038/s41392-024-01840-1 · Cited by 387 · see citing works
SR-B1 drives endothelial cell LDL transcytosis via DOCK4 to promote atherosclerosis
Huang, L., Chambliss, K. L., Gao, X., Yuhanna, I. S., Behling‐Kelly, E. L., Bergaya, S., Ahmed, M. H., Michaely, P., Luby‐Phelps, K., Darehshouri, A., et al. (2019) · Nature · doi:10.1038/s41586-019-1140-4 · Cited by 354 · see citing works
Self-citation
Macrophage Metabolism As Therapeutic Target for Cancer, Atherosclerosis, and Obesity
Geeraerts, X., Bolli, E., Fendt, S., & Ginderachter, J. A. V. (2017) · Frontiers in Immunology · doi:10.3389/fimmu.2017.00289 · Cited by 315 · see citing works
Mitochondrial Priming by CD28
Geltink, R. I. K., O’Sullivan, D., Corrado, M., Bremser, A., Buck, M. D., Buescher, J. M., Firat, E., Zhu, X., Niedermann, G., Caputa, G., et al. (2017) · Cell · doi:10.1016/j.cell.2017.08.018 · Cited by 294 · see citing works
Regulatory T Cells License Macrophage Pro-Resolving Functions During Atherosclerosis Regression
Sharma, M., Schlegel, M., Afonso, M., Brown, E. J., Rahman, K., Weinstock, A., Sansbury, B. E., Corr, E. M., van Solingen, C., Koelwyn, G., et al. (2020) · Circulation Research · doi:10.1161/circresaha.119.316461 · Cited by 231 · see citing works
Self-citation
The Relationship Between Gut Microbiota and Inflammatory Diseases: The Role of Macrophages
Wang, J., Chen, W., & Wang, Y. (2020) · Frontiers in Microbiology · doi:10.3389/fmicb.2020.01065 · Cited by 256 · see citing works
Metabolic regulation of macrophage phenotype and function
Saha, S., Shalova, I. N., & Biswas, S. K. (2017) · Immunological Reviews · doi:10.1111/imr.12603 · Cited by 252 · see citing works
Monocyte and macrophage immunometabolism in atherosclerosis
Groh, L. A., Keating, S. T., Joosten, L. A. B., Netea, M. G., & Riksen, N. P. (2017) · Seminars in Immunopathology · doi:10.1007/s00281-017-0656-7 · Cited by 255 · see citing works
Macrophage Biology and Mechanisms of Immune Suppression in Breast Cancer
Mehta, A., Kadel, S., Townsend, M. G., Oliwa, M., & Guerriero, J. (2021) · Frontiers in Immunology · doi:10.3389/fimmu.2021.643771 · Cited by 206 · see citing works
Immune cells as targets for cardioprotection: new players and novel therapeutic opportunities
Andreadou, I., Cabrera-Fuentes, H. A., Devaux, Y., Frangogiannis, N. G., Frantz, S., Guzik, T. J., Liehn, E. A., Gomes, C. P. C., Schulz, R., & Hausenloy, D. J. (2019) · Cardiovascular Research · doi:10.1093/cvr/cvz050 · Cited by 213 · see citing works
microRNA-33 regulates macrophage autophagy in atherosclerosis
Ouimet, M., Ediriweera, H., Afonso, M. S., Ramkhelawon, B., Singaravelu, R., Liao, X., Bandler, R. C., Rahman, K., Fisher, E. A., Rayner, K. J., et al. (2017) · Arteriosclerosis, Thrombosis, and Vascular Biology · doi:10.1161/atvbaha.116.308916 · Cited by 221 · see citing works
Self-citation
MicroRNAs and lipid metabolism
Aryal, B. K., Singh, A. K., Rotllán, N., Price, N. D., & Fernandez-Hernando, C. F. (2017) · Current Opinion in Lipidology · doi:10.1097/mol.0000000000000420 · Cited by 203 · see citing works
Regulatory Mechanism of M1/M2 Macrophage Polarization in the Development of Autoimmune Diseases
Peng, Y., Zhou, M., Hong, Y., Qu, R., Qiu, Y., Hao, J., Bi, H., & Guo, D. (2023) · Mediators of Inflammation · doi:10.1155/2023/8821610 · Cited by 211 · see citing works
Non-coding RNAs in cardiovascular cell biology and atherosclerosis
Fasolo, F., Gregoli, K. D., Mäegdefessel, L., & Johnson, J. L. (2019) · Cardiovascular Research · doi:10.1093/cvr/cvz203 · Cited by 202 · see citing works
Specific and Complex Reprogramming of Cellular Metabolism in Myeloid Cells during Innate Immune Responses
Stienstra, R., Netea-Maier, R. T., Riksen, N. P., Joosten, L. A. B., & Netea, M. G. (2017) · Cell Metabolism · doi:10.1016/j.cmet.2017.06.001 · Cited by 194 · see citing works
M2 macrophages in kidney disease: biology, therapies, and perspectives
Chen, T., Cao, Q., Wang, Y., & Harris, D. C. H. (2019) · Kidney International · doi:10.1016/j.kint.2018.10.041 · Cited by 189 · see citing works
A narrative review of tumor-associated macrophages in lung cancer: regulation of macrophage polarization and therapeutic implications
Sedighzadeh, S. S., Khoshbin, A. P., Razi, S., Keshavarz‐Fathi, M., & Rezaei, N. (2021) · Translational Lung Cancer Research · doi:10.21037/tlcr-20-1241 · Cited by 188 · see citing works
Involvement of the Warburg effect in non‐tumor diseases processes
Chen, Z., Liu, M., Li, L., & Chen, L. (2017) · Journal of Cellular Physiology · doi:10.1002/jcp.25998 · Cited by 182 · see citing works
Inflammation and Cancer: Extra- and Intracellular Determinants of Tumor-Associated Macrophages as Tumor Promoters
Szebeni, G. J., Vízler, C., Kitajka, K., & Puskás, L. G. (2017) · Mediators of Inflammation · doi:10.1155/2017/9294018 · Cited by 190 · see citing works
Ogg1-Dependent DNA Repair Regulates NLRP3 Inflammasome and Prevents Atherosclerosis
Tumurkhuu, G., Shimada, K., Dagvadorj, J., Crother, T., Zhang, W., Luthringer, D., Gottlieb, R., Chen, S., & Arditi, M. (2016) · Circulation Research · doi:10.1161/circresaha.116.308362 · Cited by 164 · see citing works
STAT6 Upregulation Promotes M2 Macrophage Polarization to Suppress Atherosclerosis
Gong, M., Zhuo, X., & Ai-qun, M. (2017) · Medical science monitor basic research/Medical science monitor. Basic research · doi:10.12659/msmbr.904014 · Cited by 177 · see citing works
Boosting Inflammation Resolution in Atherosclerosis
Fredman, G., & Tabas, I. A. (2017) · American Journal Of Pathology · doi:10.1016/j.ajpath.2017.01.018 · Cited by 173 · see citing works
Metabolic influence on macrophage polarization and pathogenesis
Thapa, B., & Lee, K. (2019) · BMB Reports · doi:10.5483/bmbrep.2019.52.6.140 · Cited by 173 · see citing works
Tissue-resident macrophages: guardians of organ homeostasis
Nobs, S. P., & Köpf, M. (2021) · Trends in Immunology · doi:10.1016/j.it.2021.04.007 · Cited by 172 · see citing works
Macrophage fatty acid oxidation and its roles in macrophage polarization and fatty acid-induced inflammation
Namgaladze, D., & Brüne, B. (2016) · Biochimica et Biophysica Acta (BBA) - Molecular and Cell Biology of Lipids · doi:10.1016/j.bbalip.2016.09.002 · Cited by 163 · see citing works
The Role of Metabolic Remodeling in Macrophage Polarization and Its Effect on Skeletal Muscle Regeneration
Santa, F. D., Vitiello, L., Torcinaro, A., & Ferraro, E. (2018) · Antioxidants and Redox Signaling · doi:10.1089/ars.2017.7420 · Cited by 154 · see citing works
MicroRNAs in the Pathobiology and Therapy of Atherosclerosis
Laffont, B., & Rayner, K. J. (2017) · Canadian Journal of Cardiology · doi:10.1016/j.cjca.2017.01.001 · Cited by 151 · see citing works
Self-citation
M2 Macrophages as a Potential Target for Antiatherosclerosis Treatment
Bi, Y., Chen, J., Hu, F., Liu, J., Li, M., & Zhao, L. (2019) · Neural Plasticity · doi:10.1155/2019/6724903 · Cited by 153 · see citing works
Apoptotic tumor cell-derived microRNA-375 uses CD36 to alter the tumor-associated macrophage phenotype
Frank, A.-C., Ebersberger, S., Fink, A. F., Lampe, S., Weigert, A., Schmid, T., Ebersberger, I., Syed, S. N., & Brüne, B. (2019) · Nature Communications · doi:10.1038/s41467-019-08989-2 · Cited by 149 · see citing works
Epigenetic Mechanisms in Monocytes/Macrophages Regulate Inflammation in Cardiometabolic and Vascular Disease
Davis, F. M., & Gallagher, K. A. (2019) · Arteriosclerosis Thrombosis and Vascular Biology · doi:10.1161/atvbaha.118.312135 · Cited by 145 · see citing works
Macrophage metabolism in atherosclerosis
Bories, G. F. P., & Leitinger, N. (2017) · FEBS Letters · doi:10.1002/1873-3468.12786 · Cited by 145 · see citing works
Over-expression of miR-223 induces M2 macrophage through glycolysis alteration and attenuates LPS-induced sepsis mouse model, the cell-based therapy in sepsis
Dang, C. P., & Leelahavanichkul, A. (2020) · PLoS ONE · doi:10.1371/journal.pone.0236038 · Cited by 122 · see citing works
Myeloid Slc2a1 -Deficient Murine Model Revealed Macrophage Activation and Metabolic Phenotype Are Fueled by GLUT1
Freemerman, A. J., Zhao, L., Pingili, A. K., Teng, B., Cozzo, A. J., Fuller, A. M., Johnson, A., Milner, J. J., Lim, M. F., Galanko, J. A., et al. (2019) · The Journal of Immunology · doi:10.4049/jimmunol.1800002 · Cited by 132 · see citing works
Genetic dissection of the impact of miR-33a and miR-33b during the progression of atherosclerosis
Price, N. L., Rotllan, N., Canfrán-Duque, A., Zhang, X., Pati, P., Arias, N., Moen, J., Mayr, M., Ford, D. A., Baldán, Á., et al. (2017) · Cell reports · doi:10.1016/j.celrep.2017.10.023 · Cited by 129 · see citing works
miR-155 Regulated Inflammation Response by the SOCS1-STAT3-PDCD4 Axis in Atherogenesis
Ye, J., Guo, R., Shi, Y., Qi, F., Guo, C., & Yang, L. (2016) · Mediators of Inflammation · doi:10.1155/2016/8060182 · Cited by 127 · see citing works
Liver microRNAs: potential mediators and biomarkers for metabolic and cardiovascular disease?
Willeit, P., Skroblin, P., Kiechl, S., Fernández-Hernando, C., & Mayr, M. (2016) · European Heart Journal · doi:10.1093/eurheartj/ehw146 · Cited by 124 · see citing works
Emerging role of micro RNA s in regulating macrophage activation and polarization in immune response and inflammation
Wu, X., Dai, Y., Yang, Y., Huang, C. Z., Meng, X., Wu, B., & Li, J. (2016) · Immunology · doi:10.1111/imm.12608 · Cited by 116 · see citing works
Metabolic regulation of macrophages during tissue repair: insights from skeletal muscle regeneration
Juban, G., & Chazaud, B. (2017) · FEBS Letters · doi:10.1002/1873-3468.12703 · Cited by 103 · see citing works
microRNAs in lipoprotein metabolism and cardiometabolic disorders
Rotllán, N., Price, N. L., Pati, P., Goedeke, L., & Fernandez-Hernando, C. F. (2016) · Atherosclerosis · doi:10.1016/j.atherosclerosis.2016.01.025 · Cited by 111 · see citing works
Genetic Ablation of miR-33 Increases Food Intake, Enhances Adipose Tissue Expansion, and Promotes Obesity and Insulin Resistance
Price, N. L., Singh, A. K., Rotllan, N., Goedeke, L., Wing, A., Canfrán-Duque, A., Diaz-Ruiz, A., Araldi, E., Baldán, Á., Camporez, J.-P., et al. (2018) · Cell Reports · doi:10.1016/j.celrep.2018.01.074 · Cited by 110 · see citing works
Cadmium induces BNIP3-dependent autophagy in chicken spleen by modulating miR-33-AMPK axis.
Chen, M., Li, X., Fan, R.-F., Yang, J., Jin, X., Hamid, S., & Xu, S.-W. (2018) · Chemosphere · doi:10.1016/j.chemosphere.2017.12.026 · Cited by 104 · see citing works
CaMKK2 in myeloid cells is a key regulator of the immune-suppressive microenvironment in breast cancer
Racioppi, L., Nelson, E. R., Huang, W., Mukherjee, D., Lawrence, S. A., Lento, W. E., Masci, A. M., Jiao, Y., Park, S. H., York, B., et al. (2019) · Nature Communications · doi:10.1038/s41467-019-10424-5 · Cited by 103 · see citing works
Noncoding RNAs in cancer immunity: functions, regulatory mechanisms, and clinical application
Zhang, L., Xu, X., & Su, X. (2020) · Molecular Cancer · doi:10.1186/s12943-020-01154-0 · Cited by 104 · see citing works
M2 macrophage-derived exosomal miR-26b-5p regulates macrophage polarization and chondrocyte hypertrophy by targeting TLR3 and COL10A1 to alleviate osteoarthritis
Qian, Y., Chu, G., Zhang, L., Wu, Z., Wang, Q., Guo, J. J., & Zhou, F. (2024) · Journal of Nanobiotechnology · doi:10.1186/s12951-024-02336-4 · Cited by 109 · see citing works
Enhanced glycolysis and HIF-1α activation in adipose tissue macrophages sustains local and systemic interleukin-1β production in obesity
Sharma, M., Boytard, L., Hadi, T., Koelwyn, G. J., Simon, R., Ouimet, M. I., Seifert, L., Spiro, W., Yan, B., Hutchison, S. B., et al. (2020) · Scientific Reports · doi:10.1038/s41598-020-62272-9 · Cited by 105 · see citing works
Self-citation
IL-4 polarized human macrophage exosomes control cardiometabolic inflammation and diabetes in obesity
Phu, T. A., Ng, M., Vu, N. K., Bouchareychas, L., & Raffaı̈, R. L. (2022) · Molecular Therapy · doi:10.1016/j.ymthe.2022.03.008 · Cited by 104 · see citing works
microRNA in Cardiovascular Aging and Age-Related Cardiovascular Diseases
de Lucia, C., Komici, K., Borghetti, G., Femminella, G. D., Bencivenga, L., Cannavò, A., Corbi, G., Ferrara, N., Houser, S. R., Koch, W. J., et al. (2017) · Frontiers in Medicine · doi:10.3389/fmed.2017.00074 · Cited by 101 · see citing works
Specific Disruption of Abca1 Targeting Largely Mimics the Effects of miR-33 Knockout on Macrophage Cholesterol Efflux and Atherosclerotic Plaque Development
Price, N., Rotllan, N., Zhang, X.-B., Canfrán-Duque, A., Nottoli, T., Suárez, Y., & Fernández-Hernando, C. (2019) · Circulation Research · doi:10.1161/circresaha.118.314415 · Cited by 80 · see citing works
Metabolic regulation of immune responses: therapeutic opportunities
Aßmann, N., & Finlay, D. K. (2016) · Journal of Clinical Investigation · doi:10.1172/jci83005 · Cited by 96 · see citing works
Small Things Matter: Relevance of MicroRNAs in Cardiovascular Disease
Peters, L. J. F., Biessen, E. A. L., Hohl, M., Weber, C., van der Vorst, E. P. C., & Santovito, D. (2020) · Frontiers in Physiology · doi:10.3389/fphys.2020.00793 · Cited by 97 · see citing works
Site‐Specific MicroRNA‐33 Antagonism by pH‐Responsive Nanotherapies for Treatment of Atherosclerosis via Regulating Cholesterol Efflux and Adaptive Immunity
Li, C.-W., Dou, Y., Chen, Y.-D., Qi, Y., Li, L.-L., Han, S., Jin, T.-T., Guo, J.-W., Chen, J.-H., & Zhang, J.-X. (2020) · Advanced Functional Materials · doi:10.1002/adfm.202002131 · Cited by 91 · see citing works
Metabolic features of macrophages in inflammatory diseases and cancer
Na, Y. R., Je, S., & Seok, S. H. (2017) · Cancer Letters · doi:10.1016/j.canlet.2017.10.044 · Cited by 94 · see citing works
Macrophage monocarboxylate transporter 1 promotes peripheral nerve regeneration after injury in mice
Jha, M. K., Passero, J. V., Rawat, A. K., Ament, X. H., Yang, F. W., Vidensky, S., Collins, S. L., Horton, M. R., Höke, A., Rutter, G. A., et al. (2021) · Journal of Clinical Investigation · doi:10.1172/jci141964 · Cited by 89 · see citing works
miRNA in Macrophage Development and Function
Roy, S. (2016) · Antioxidants and Redox Signaling · doi:10.1089/ars.2016.6728 · Cited by 87 · see citing works
Role of Noncoding RNAs in the Pathogenesis of Abdominal Aortic Aneurysm
Kumar, S., Boon, R. A., Mäegdefessel, L., Dimmeler, S., & Jo, H. (2019) · Circulation Research · doi:10.1161/circresaha.118.312438 · Cited by 87 · see citing works
Epigenetic Modification in Coronary Atherosclerosis
Rizzacasa, B., Amati, F., Romeo, F., Novelli, G., & Mehta, J. L. (2019) · Journal of the American College of Cardiology · doi:10.1016/j.jacc.2019.07.043 · Cited by 87 · see citing works
MicroRNA Post-transcriptional Regulation of the NLRP3 Inflammasome in Immunopathologies
Tezcan, G., Martynova, E. V., Gilazieva, Z., McIntyre, A., Rizvanov, A. A., & Khaiboullina, S. F. (2019) · Frontiers in Pharmacology · doi:10.3389/fphar.2019.00451 · Cited by 87 · see citing works
Intestinal Macrophages in Resolving Inflammation
Hine, A. M., & Loke, P. (2019) · The Journal of Immunology · doi:10.4049/jimmunol.1900345 · Cited by 85 · see citing works
Self-citation
Modulation of ambient temperature promotes inflammation and initiates atherosclerosis in wild type C57BL/6 mice
Giles, D. A., Ramkhelawon, B., Donelan, E. M., Stankiewicz, T., Hutchison, S. B., Mukherjee, R., Cappelletti, M., Karns, R., Karp, C., Moore, K., et al. (2016) · Molecular Metabolism · doi:10.1016/j.molmet.2016.09.008 · Cited by 79 · see citing works
Self-citation
Noncoding RNAs link metabolic reprogramming to immune microenvironment in cancers
Zhang, Y., Mao, Q., Xia, Q., Cheng, J., Huang, Z., Li, Y., Chen, P., Yang, J., Fan, X., Liang, Y., et al. (2021) · Journal of Hematology & Oncology · doi:10.1186/s13045-021-01179-y · Cited by 84 · see citing works
All-Trans Retinoic Acid Promotes an M1- to M2-Phenotype Shift and Inhibits Macrophage-Mediated Immunity to Leishmania major
Vellozo, N. S., Pereira-Marques, S. T., Cabral-Piccin, M. P., Filardy, A. A., Ribeiro-Gomes, F. L., Rigoni, T. S., DosReis, G. A., & Lopes, M. F. (2017) · Frontiers in Immunology · doi:10.3389/fimmu.2017.01560 · Cited by 81 · see citing works
miR-155 in the Resolution of Atherosclerosis
Bruen, R., Fitzsimons, S., & Belton, O. (2019) · Frontiers in Pharmacology · doi:10.3389/fphar.2019.00463 · Cited by 80 · see citing works
MicroRNAs as important regulators of the NLRP3 inflammasome
Zamani, P., Oskuee, R. K., Atkin, S. L., Navashenaq, J. G., & Sahebkar, A. (2019) · Progress in Biophysics and Molecular Biology · doi:10.1016/j.pbiomolbio.2019.05.004 · Cited by 80 · see citing works
Mechanism overview and target mining of atherosclerosis: Endothelial cell injury in atherosclerosis is regulated by glycolysis (Review)
Wang, R., Wang, M., Ye, J., Sun, G., & Sun, X. (2020) · International Journal of Molecular Medicine · doi:10.3892/ijmm.2020.4798 · Cited by 83 · see citing works
Resolvin D1 Enhances Necroptotic Cell Clearance Through Promoting Macrophage Fatty Acid Oxidation and Oxidative Phosphorylation
Hosseini, Z., Marinello, M., Decker, C., Sansbury, B. E., Sadhu, S., Gerlach, B. D., Ramos, R. B., Adam, A. P., Spite, M. R., & Fredman, G. (2021) · Arteriosclerosis Thrombosis and Vascular Biology · doi:10.1161/atvbaha.120.315758 · Cited by 79 · see citing works
Enhanced IL-1β Release Following NLRP3 and AIM2 Inflammasome Stimulation Is Linked to mtROS in Airway Macrophages in Pulmonary Fibrosis
Trachalaki, A., Tsitoura, E., Mastrodimou, S., Invernizzi, R., Vasarmidi, E., Bibaki, E., Tzanakis, Ν., Molyneaux, P. L., Maher, T. M., & Antoniou, K. M. (2021) · Frontiers in Immunology · doi:10.3389/fimmu.2021.661811 · Cited by 80 · see citing works
Non-coding RNA regulation of endothelial and macrophage functions during atherosclerosis
Aryal, B. K., & Suárez, Y. (2018) · Vascular Pharmacology · doi:10.1016/j.vph.2018.03.001 · Cited by 78 · see citing works
Targeted Suppression of miRNA-33 Using pHLIP Improves Atherosclerosis Regression
Zhang, X., Rotllan, N., Canfrán-Duque, A., Sun, J., Toczek, J., Moshnikova, A., Malik, S., Price, N. L., Araldi, E., Zhong, W., et al. (2022) · Circulation Research · doi:10.1161/circresaha.121.320296 · Cited by 75 · see citing works
Genetic Ablation of MicroRNA-33 Attenuates Inflammation and Abdominal Aortic Aneurysm Formation via Several Anti-Inflammatory Pathways
Nakao, T., Horie, T., Baba, O., Nishiga, M., Nishino, T., Izuhara, M., Kuwabara, Y., Nishi, H., Usami, S., Nakazeki, F., et al. (2017) · Arteriosclerosis, Thrombosis, and Vascular Biology · doi:10.1161/atvbaha.117.309768 · Cited by 81 · see citing works
Exosome-mediated miR-33 transfer induces M1 polarization in mouse macrophages and exerts antitumor effect in 4T1 breast cancer cell line
Moradi‐Chaleshtori, M., Bandehpour, M., Heidari, N., Mohammadi‐Yeganeh, S., & Hashemi, S. M. (2020) · International Immunopharmacology · doi:10.1016/j.intimp.2020.107198 · Cited by 75 · see citing works
Metabolic reprogramming & inflammation: Fuelling the host response to pathogens
Gleeson, L. E., & Sheedy, F. J. (2016) · Seminars in Immunology · doi:10.1016/j.smim.2016.10.007 · Cited by 74 · see citing works
Self-citation
Tumor-derived Exosomal ENO2 Modulates Polarization of Tumor-associated Macrophages through Reprogramming Glycolysis to Promote Progression of Diffuse Large B-cell Lymphoma
Shao, R., Liu, C., Xue, R., Deng, X., Liu, L., Song, C., Xie, J., Tang, H., & Liu, W. (2024) · International Journal of Biological Sciences · doi:10.7150/ijbs.91154 · Cited by 73 · see citing works
The Role of miRNAs in Immune Cell Development, Immune Cell Activation, and Tumor Immunity: With a Focus on Macrophages and Natural Killer Cells
Xu, S., Hu, H.-T., Li, H. L., & Chang, S. (2019) · Cells · doi:10.3390/cells8101140 · Cited by 72 · see citing works
MiR-130b promotes obesity associated adipose tissue inflammation and insulin resistance in diabetes mice through alleviating M2 macrophage polarization via repression of PPAR-γ
Zhang, M., Zhou, Z., Wang, J., & Li, S. (2016) · Immunology Letters · doi:10.1016/j.imlet.2016.10.004 · Cited by 72 · see citing works
microRNA-33 deficiency in macrophages enhances autophagy, improves mitochondrial homeostasis, and protects against lung fibrosis
Ahangari, F., Price, N. L., Malik, S., Chioccioli, M., Bärnthaler, T., Adams, T. S., Kim, J., Pradeep, S. P., Ding, S., Cosmos, C., et al. (2023) · JCI Insight · doi:10.1172/jci.insight.158100 · Cited by 70 · see citing works
The role of β-carotene and vitamin A in atherogenesis: Evidences from preclinical and clinical studies
Miller, A. P., Coronel, J., & Amengual, J. (2020) · Biochimica et Biophysica Acta (BBA) - Molecular and Cell Biology of Lipids · doi:10.1016/j.bbalip.2020.158635 · Cited by 71 · see citing works
Aberrant mitochondrial DNA synthesis in macrophages exacerbates inflammation and atherosclerosis
Natarajan, N., Florentin, J., Johny, E., Xiao, H., O'Neil, S., Lei, L., Shen, J., Ohayon, L., Johnson, A. R., Rao, K., et al. (2024) · Nature Communications · doi:10.1038/s41467-024-51780-1 · Cited by 76 · see citing works
Inflammatory cells and their non-coding RNAs as targets for treating myocardial infarction
Jung, M., Dodsworth, M., & Thum, T. (2018) · Basic Research in Cardiology · doi:10.1007/s00395-018-0712-z · Cited by 70 · see citing works
MicroRNA-33 Controls Adaptive Fibrotic Response in the Remodeling Heart by Preserving Lipid Raft Cholesterol
Nishiga, M., Horie, T., Kuwabara, Y., Nagao, K., Baba, O., Nakao, T., Nishino, T., Hakuno, D., Nakashima, Y., Nishi, H., et al. (2016) · Circulation Research · doi:10.1161/circresaha.116.309528 · Cited by 71 · see citing works
Targeting foam cell formation and macrophage polarization in atherosclerosis: The Therapeutic potential of rhubarb
Liu, X., Wu, J., Tian, R., Su, S., Deng, S., & Meng, X. (2020) · Biomedicine & Pharmacotherapy · doi:10.1016/j.biopha.2020.110433 · Cited by 68 · see citing works
Cardiac repair after myocardial infarction: A two-sided role of inflammation-mediated
Li, T., Yan, Z., Fan, Y., Fan, X., Li, A., Qi, Z., & Zhang, J. (2023) · Frontiers in Cardiovascular Medicine · doi:10.3389/fcvm.2022.1077290 · Cited by 72 · see citing works
Sorting Nexin 10 Mediates Metabolic Reprogramming of Macrophages in Atherosclerosis Through the Lyn-Dependent TFEB Signaling Pathway
You, Y., Bao, W., Zhang, S., Li, H., Li, H., Dang, W., Zou, S., Cao, X., Wang, X., Liu, L., et al. (2020) · Circulation Research · doi:10.1161/circresaha.119.315516 · Cited by 68 · see citing works

Abstract 422: Metabolic Regulation by miR-33 in Macrophages Controls Immune Effector Responses
Ouimet, M. I., Ediriweera, H. N., Gundra, U. M., Rayner, K. J., Ramkhelawon, B., Rinehold, K., Solingen, C. V., Hutchison, S. B., Esau, C., Fullerton, M. D., et al. (2015) · Arteriosclerosis Thrombosis and Vascular Biology · doi:10.1161/atvb.35.suppl_1.422
Self-citation
Abstract 262: Anti-miR33 Therapy Promotes PGC1α Expression, Mitochondrial Function and Immunometabolic Pathways in Macrophages in Atherosclerosis
Karunakaran, D., Thrush, A. B., Ramphos, E. S., Wu, Z., Geoffrion, M., Esau, C., Moore, K. J., Harper, M., & Rayner, K. J. (2014) · Arteriosclerosis Thrombosis and Vascular Biology · doi:10.1161/atvb.34.suppl_1.262
Self-citation
Abstract 624: MiR-33 Antagonism Prevents the Progression of Atherosclerosis by Promoting an M2 Macrophage Phenotype
Ediriweera, H. N., Ouimet, M. I., Sheedy, F. J., Rayner, K. J., Salerno, A. G., Hutchison, S. B., Hamerling, S., Esau, C., Fisher, E. A. A., & Moore, K. J. (2014) · Arteriosclerosis Thrombosis and Vascular Biology · doi:10.1161/atvb.34.suppl_1.624 · Cited by 1 · see citing works
Self-citation
miR-33 Silencing Reprograms the Immune Cell Landscape in Atherosclerotic Plaques
Afonso, M. S., Sharma, M., Schlegel, M., van Solingen, C., Koelwyn, G. J., Shanley, L. C., Beckett, L., Peled, D., Rahman, K., Giannarelli, C., et al. (2021) · Circulation Research · doi:10.1161/circresaha.120.317914 · Cited by 53 · see citing works
Self-citation
Abstract 102: MicroRNA-33 Inhibition Reprograms Monocyte/macrophage Dynamics in Atherosclerosis to Promote Plaque Regression
Afonso, M. S., Sharma, M., Schlegel, P. M., Solingen, C. V., Koelwyn, G. J., Ouimet, M. I., Beckett, L., Rahman, K., Fisher, E. A. A., & Moore, K. J. (2019) · Arteriosclerosis Thrombosis and Vascular Biology · doi:10.1161/atvb.39.suppl_1.102
Self-citation

Authors: Ouimet, M., Ediriweera, H. N., Gundra, U. M., Sheedy, F. J., Ramkhelawon, B., Hutchison, S. B., Rinehold, K., van Solingen, C., Fullerton, M. D., Cecchini, K., Rayner, K. J., Steinberg, G. R., Zamore, P. D., Fisher, E. A., Loke, P., & Moore, K. J.
Affiliations: New York University (US)
University of Ottawa (CA)
Howard Hughes Medical Institute (US)
McMaster University (CA)
NYU Langone Health (US)
ORCID: Ouimet, Mireille
Sheedy, Frederick J.
Ramkhelawon, Bhama
Fullerton, Morgan D.
Cecchini, Katharine
Rayner, Katey J.
Steinberg, Gregory R.
Zamore, Phillip D.
Fisher, Edward A.
Loke, P’ng
Moore, Kathryn J.
Venue: Journal of Clinical Investigation
Publisher: American Society for Clinical Investigation
Published: 2015-10-26
Volume: 125
Issue: 12
Pages: 4334-4348
ISSN: 0021-9738 (ISSN-L)
1558-8238
DOI: 10.1172/jci81676
PMC: PMC4665799
OpenAlex: W2123366371
Cited by: 394
References: 67
Citations by year: 2026: 19 · 2025: 21 · 2024: 27 · 2023: 37 · 2022: 24 · 2021: 45 · 2020: 45 · 2019: 46 · 2018: 35 · 2017: 47 · 2016: 33 · 2015: 1 · 2014: 1 · 2012: 1
FWCI: 19.07
Type: journal article
Language: en
Open access: bronze
doi.org
Locations: Journal of Clinical Investigation (publishedVersion)
PubMed Central (publishedVersion)
PubMed (publishedVersion)
Funders: American Heart Association (14POST20180018, 15POST25090199)
NYU Langone Medical Center (P30CA016087)
Canada Research Chairs
National Institutes of Health (UL1TR000038, TR000038)
Canadian Institutes of Health Research
National Heart, Lung, and Blood Institute (R01HL084312, HL-084312, HL098055, P01HL098055, R01HL119047, R01HL108182, T32HL098129)
National Cancer Institute (P30CA016087)
National Institute of Allergy and Infectious Diseases (R21AI094166, R01AI093811, R01AI094166, T32AI007180)
National Center for Advancing Translational Sciences
Topics: Life Sciences › Immunology and Microbiology › Immunology › Atherosclerosis and Cardiovascular Diseases
Life Sciences › Biochemistry, Genetics and Molecular Biology › Cancer Research › MicroRNA in disease regulation
Health Sciences › Medicine › Surgery › Cholesterol and Lipid Metabolism
Keywords: microRNA-33, macrophage polarization, M2 macrophages, atherosclerosis, aerobic glycolysis, mitochondrial oxidative phosphorylation, AMPK, ALDH1A2, retinoic acid, regulatory T cells, Foxp3, plaque inflammation, hypercholesterolemia, atheroprotection, lipid metabolism
MeSH terms: Aldehyde Dehydrogenase 1 Family, Aldehyde Dehydrogenase, Animals, Gene Expression Regulation, Glycolysis, Oxygen Consumption, Macrophages, Peritoneal, Mice, Knockout, MicroRNAs, Atherosclerosis, T-Lymphocytes, Regulatory, Retinal Dehydrogenase, Mice, Forkhead Transcription Factors, AMP-Activated Protein Kinases, Plaque, Atherosclerotic

About these checks

Registry, retraction, Cites and statistics results are computed, not judged, with one exception: a printed reference that no index lists is read once by a model before it counts as a citation error. Claims are extracted by a model and kept only when their quote appears verbatim in the text; each cited source is then checked, with a model’s help, for whether it says what the claim relies on. Those verdicts can be wrong — read the claim’s quote and the cited source before relying on one.

Statistics and arithmetic are recomputed, not judged.

Confidence bands are shown only for fields calibrated on our annotated test set. None is calibrated yet, so no band is shown.

What counts as a claim ›How we measure confidence ›How we check this ›

Are you an author, or do you see a problem with this page? Request a review

MicroRNA-33-dependent regulation of macrophage metabolism directs immune cell polarization in atherosclerosis

Abstract

Integrity signals

Claims the paper makes

Claims other papers make about this one

Cites

Cited by

Related

Record

About these checks