Antagonism of miR-33 in mice promotes reverse cholesterol transport and regression of atherosclerosis
Open accessAbstract
Plasma HDL levels have a protective role in atherosclerosis, yet clinical therapies to raise HDL levels have remained elusive. Recent advances in the understanding of lipid metabolism have revealed that miR-33, an intronic microRNA located within the SREBF2 gene, suppresses expression of the cholesterol transporter ABC transporter A1 (ABCA1) and lowers HDL levels. Conversely, mechanisms that inhibit miR-33 increase ABCA1 and circulating HDL levels, suggesting that antagonism of miR-33 may be atheroprotective. As the regression of atherosclerosis is clinically desirable, we assessed the impact of miR-33 inhibition in mice deficient for the LDL receptor (Ldlr-/- mice), with established atherosclerotic plaques. Mice treated with anti-miR33 for 4 weeks showed an increase in circulating HDL levels and enhanced reverse cholesterol transport to the plasma, liver, and feces. Consistent with this, anti-miR33-treated mice showed reductions in plaque size and lipid content, increased markers of plaque stability, and decreased inflammatory gene expression. Notably, in addition to raising ABCA1 levels in the liver, anti-miR33 oligonucleotides directly targeted the plaque macrophages, in which they enhanced ABCA1 expression and cholesterol removal. These studies establish that raising HDL levels by anti-miR33 oligonucleotide treatment promotes reverse cholesterol transport and atherosclerosis regression and suggest that it may be a promising strategy to treat atherosclerotic vascular disease.
Integrity signals
Registry
Cites
Statistics
Claims the paper makes
Claims other papers make about this one
Each is checked against this paper’s own text: does it say what the citing paper says it does?
Macrophages within atherosclerotic lesions of these mice exhibit an anti-inflammatory phenotype characterized by enhanced cholesterol efflux, leading to a reduction in foam cell formation.
“Furthermore, macrophages within the atherosclerotic lesions of these mice exhibit an anti-inflammatory phenotype characterized by enhanced cholesterol efflux, which leads to a reduction in foam cell formation.”
From Critical Role of microRNA-33a/b in Cardiovascular and Metabolic Disease: Molecular Mechanisms and Therapeutic Perspectives (2026) · cites this paper as [21]
Inhibition or genetic ablation of miR-33a promotes regression of atherosclerosis or prevents its formation in mouse models such as LDL receptor-deficient or ApoE-deficient mice, conferring resistance to the disease.
“Inhibition or genetic ablation of miR-33a has been shown to either promote the regression of atherosclerosis or prevent its formation in mouse models, such as LDL receptor-deficient or apoprotein E (ApoE)-deficient mice, conferring resistance to the disease 21 - 23) .”
From Critical Role of microRNA-33a/b in Cardiovascular and Metabolic Disease: Molecular Mechanisms and Therapeutic Perspectives (2026) · cites this paper as [21]
The effect of miR-33 deletion in macrophages is not as simple as the shift from the M1 to M2 phenotype reported previously.
“Moreover, the effect of miR-33 deletion in macrophages is not as simple as the shift from the M1 to M2 phenotype reported previously.19”
From MicroRNA‐33 Deficiency Reduces the Progression of Atherosclerotic Plaque in ApoE <sup>−/−</sup> Mice (2012) · cites this paper as [19]
Antisense inhibition of miR-33 results in regression of atherosclerotic plaque volume in LDL-receptor-deficient mice.
“Moreover, antisense inhibition of miR-33 resulted in a regression of the atherosclerotic plaque volume in LDL-receptor-deficient mice.19”
From MicroRNA‐33 Deficiency Reduces the Progression of Atherosclerotic Plaque in ApoE <sup>−/−</sup> Mice (2012) · cites this paper as [19]
The effect of miR-33 deletion in macrophages is not as simple as a shift from the M1 to the M2 phenotype.
“In any case, the effect of miR-33 deletion in macrophages is not as simple as a shift from the M1 to the M2 phenotype, as described in a previous report.19”
From MicroRNA‐33 Deficiency Reduces the Progression of Atherosclerotic Plaque in ApoE <sup>−/−</sup> Mice (2012) · cites this paper as [19]
Cites
Alternative activation of macrophages
Gordon, S. (2003) · Nature Reviews Immunology · doi:10.1038/nri978 · Cited by 6,189 · see citing works
HDL cholesterol, very low levels of LDL cholesterol, and cardiovascular events
Barter, P., Gotto, A. M., LaRosa, J. C., Maroni, J., Szarek, M., Grundy, S. M., Kastelein, J. J. P., Bittner, V., & Fruchart, J.-C. (2007) · New England Journal of Medicine · doi:10.1056/nejmoa064278 · Cited by 1,610 · see citing works
Stewart, C. R., Stuart, L. M., Wilkinson, K., van Gils, J. M., Deng, J., Halle, A., Rayner, K. J., Boyer, L., Zhong, R., Frazier, W. A., et al. (2010) · Nature Immunology · doi:10.1038/ni.1836 · Cited by 1,513 · see citing works
Self-citationMicroRNA-33 and the SREBP Host Genes Cooperate to Control Cholesterol Homeostasis
Najafi-Shoushtari, S. H., Kristo, F., Li, Y., Shioda, T., Cohen, D. E., Gerszten, R. E., & Näär, A. M. (2010) · Science · doi:10.1126/science.1189123 · Cited by 957 · see citing works
Safety of anacetrapib in patients with or at high risk for coronary heart disease
Cannon, C. P., Shah, S., Dansky, H. M., Davidson, M., Brinton, E. A., Gotto, A. M., Stepanavage, M., Liu, S. X., Gibbons, P., Ashraf, T. B., et al. (2010) · New England Journal of Medicine · doi:10.1056/nejmoa1009744 · Cited by 749 · see citing works
miR-33a/b contribute to the regulation of fatty acid metabolism and insulin signaling
Dávalos, A., Goedeke, L., Smibert, P., Ramírez, C. M., Warrier, N. P., Andreo, U., Cirera-Salinas, D., Rayner, K., Suresh, U., Pastor-Pareja, J. C., et al. (2011) · Proceedings of the National Academy of Sciences · doi:10.1073/pnas.1102281108 · Cited by 670 · see citing works
Self-citationIncreased Atherosclerosis in Hyperlipidemic Mice With Inactivation of ABCA1 in Macrophages
Aiello, R. J., Brees, D., Bourassa, P.-A., Royer, L., Lindsey, S., Coskran, T., Haghpassand, M., & Francone, O. L. (2002) · Arteriosclerosis, Thrombosis, and Vascular Biology · doi:10.1161/01.atv.0000014804.35824.da · Cited by 390 · see citing works
Expression of miR-33 from an SREBP2 Intron Inhibits Cholesterol Export and Fatty Acid Oxidation*
Gerin, I., Clerbaux, L.-A., Haumont, O., Lanthier, N., Das, A. K., Burant, C. F., Leclercq, I. A., MacDougald, O. A., & Bommer, G. T. (2010) · Journal of Biological Chemistry · doi:10.1074/jbc.m110.152090 · Cited by 382 · see citing works
Increased ABCA1 activity protects against atherosclerosis
Singaraja, R. R., Fievet, C., Castro, G., James, E. R., Hennuyer, N., Clee, S. M., Bissada, N., Choy, J. C., Fruchart, J.-C., McManus, B. M., et al. (2002) · Journal of Clinical Investigation · doi:10.1172/jci15748 · Cited by 250 · see citing works
Flagged first, then by citations
Cited by
Sorted by citations
Macrophages in atherosclerosis: a dynamic balance
Moore, K. J., Sheedy, F. J., & Fisher, E. A. (2013) · Nature reviews. Immunology · doi:10.1038/nri3520 · Cited by 2,559 · see citing works
Self-citationMicroRNAs in metabolism and metabolic disorders
Rottiers, V., & Näär, A. M. (2012) · Nature Reviews Molecular Cell Biology · doi:10.1038/nrm3313 · Cited by 1,156 · see citing works
“Moreover, antisense inhibition of miR-33a in LDLR-knockout mice, a well-validated model for hypercholesterolaemia and cardiovascular disease, caused a reduction in atherosclerotic plaque size and lipid content in mice fed a high-fat diet and also promoted RCT, verifying the therapeutic potential of miR-33 targeting fo…”
MicroRNAs in metabolism and metabolic disorders
Rottiers, V., & Näär, A. (2012) · Nature reviews. Molecular cell biology · doi:10.1038/nrm3328 · Cited by 1,103 · see citing works
Cholesterol Efflux and Atheroprotection: Advancing the Concept of Reverse Cholesterol Transport
Rosenson, R. S., Brewer, H. B., Davidson, W. S., Fayad, Z. A., Fuster, V., Goldstein, J., Hellerstein, M., Jiang, X.-C., Phillips, M. C., Rader, D. J., et al. (2012) · Circulation · doi:10.1161/circulationaha.111.066589 · Cited by 953 · see citing works
“Antagonism of MiR-33 by oligonucleotides raised HDL-C and reduced atherosclerosis in a mouse model, and thus may represent a novel approach to enhancing macrophage cholesterol efflux and raising HDL-C levels in the future (62).”
BackgroundBile acid signaling in metabolic disease and drug therapy
Li, T., & Chiang, J. Y. L. (2014) · Pharmacological Reviews · doi:10.1124/pr.113.008201 · Cited by 935 · see citing works
“In addition, antagonism of miR-33a was shown to promote regression of atherosclerosis in ldlr mice and nonhuman primates (Rayner et al., 2011).”
BackgroundHDL and cardiovascular disease
Rader, D. J., & Hovingh, G. K. (2014) · The Lancet · doi:10.1016/s0140-6736(14)61217-4 · Cited by 870 · see citing works
Inhibition of miR-33a/b in non-human primates raises plasma HDL and lowers VLDL triglycerides
Rayner, K. J., Esau, C. C., Hussain, F. N., McDaniel, A. L., Marshall, S. M., van Gils, J. M., Ray, T. D., Sheedy, F. J., Goedeke, L., Liu, X., et al. (2011) · Nature · doi:10.1038/nature10486 · Cited by 706 · see citing works
Self-citationDevelopment of microRNA therapeutics is coming of age
van Rooij, E., & Kauppinen, S. (2014) · EMBO Molecular Medicine · doi:10.15252/emmm.201100899 · Cited by 625 · see citing works
“Rayner et al (2011b) showed that treat-ment of normal male African green monkeys by a subcutaneously delivered 2 0 F/MOE-modified antimiR targeting both miR-33a and miR-33b resulted in derepression of hepatic ABCA1 levels and sustained increase in plasma HDL cholesterol over 12 weeks (Rayner et al…”
InfluentialMicroRNA Regulation of Atherosclerosis
Feinberg, M. W., & Moore, K. J. (2016) · Circulation Research · doi:10.1161/circresaha.115.306300 · Cited by 630 · see citing works
“Inhibition of miR-33 using modified antisense or locked nucleic acid oligonucleotides increased hepatic ABCA1 expression and plasma HDL-C levels in both mice and monkeys by 40% to 50%, and enhanced cholesterol transport from macrophages to the plasma, liver, and feces by >80%.(27) This increase in reverse cholesterol…”
BackgroundInfluentialSelf-citationInhibition of microRNA function by antimiR oligonucleotides
Stenvang, J., Petri, A., Lindow, M., Obad, S., & Kauppinen, S. (2012) · Silence · doi:10.1186/1758-907x-3-1 · Cited by 556 · see citing works
“Indeed, several studies have reported efficient and long-lasting silencing of miRNAs in vivo using unconjugated 2’-F/ MOE-, 2’-MOE- and LNA-modified antimiRs harboring a complete PS backbone (Figure 2B) [11,77,90,96,97,102,106-108].”
BackgroundMethodInfluentialMicroRNA-155 promotes atherosclerosis by repressing Bcl6 in macrophages
Nazari-Jahantigh, M., Wei, Y., Noels, H., Akhtar, S., Zhou, Z., Koenen, R. R., Heyll, K., Gremse, F., Kiessling, F. M., Grommes, J., et al. (2012) · Journal of Clinical Investigation · doi:10.1172/jci61716 · Cited by 529 · see citing works
“In addition, miR-33 promotes the progression of atherosclerosis and impairs ABCA1-dependent cholesterol removal from lesional macrophages (40).”
Developing MicroRNA Therapeutics
van Rooij, E., Purcell, A. L., & Levin, A. A. (2012) · Circulation Research · doi:10.1161/circresaha.111.247916 · Cited by 498 · see citing works
Macrophages in Atherosclerosis Regression
Barrett, T. J. (2019) · Arteriosclerosis Thrombosis and Vascular Biology · doi:10.1161/atvbaha.119.312802 · Cited by 633 · see citing works
Regulation of macrophage immunometabolism in atherosclerosis
Koelwyn, G. J., Corr, E. M., Erbay, E., & Moore, K. J. (2018) · Nature Immunology · doi:10.1038/s41590-018-0113-3 · Cited by 557 · see citing works
Self-citationMembrane Cholesterol Efflux Drives Tumor-Associated Macrophage Reprogramming and Tumor Progression
Goossens, P., Rodriguez-Vita, J., Etzerodt, A., Masse, M., Rastoin, O., Gouirand, V., Ulas, T., Papantonopoulou, O., Van Eck, M., Auphan-Anezin, N., et al. (2019) · Cell Metabolism · doi:10.1016/j.cmet.2019.02.016 · Cited by 502 · see citing works
Metabolism of tissue macrophages in homeostasis and pathology
Wculek, S. K., Dunphy, G., Heras-Murillo, I., Mastrangelo, A., & Sancho, D. (2022) · Cellular & Molecular Immunology · doi:10.1038/s41423-021-00791-9 · Cited by 501 · see citing works
“Antagonism of miR-33 in ApoE or LDLR mice reduces aortic lesion size, lipid content, CD68 plaque macrophage presence and ABCA1 expression, as determined after laser-capture microdissection [241, 245].”
BackgroundInflammation and its Resolution as Determinants of Acute Coronary Syndromes
Libby, P., Tabas, I. A., Fredman, G., & Fisher, E. A. A. (2014) · Circulation Research · doi:10.1161/circresaha.114.302699 · Cited by 523 · see citing works
Self-citationMicroRNAs in cardiovascular disease: an introduction for clinicians
Romaine, S. P. R., Tomaszewski, M., Condorelli, G., & Samani, N. J. (2015) · Heart · doi:10.1136/heartjnl-2013-305402 · Cited by 479 · see citing works
Interplay between miRNAs and human diseases
Paul, P., Chakraborty, A., Sarkar, D., Langthasa, M., Rahman, M., Bari, M., Singha, R. S., Malakar, A. K., & Chakraborty, S. (2018) · Journal of Cellular Physiology · doi:10.1002/jcp.25854 · Cited by 420 · see citing works
“In gene regulation, miRNAs provide promising therapeutic targets that have been demonstrated in animal models (Montgomery et al., 2011; Rayner et al., 2011; Romaine et al., 2015;Wahlquist et al., 2014).”
BackgroundOuimet, M., Barrett, T. J., & Fisher, E. (2019) · Circulation Research · doi:10.1161/circresaha.119.312617 · Cited by 416 · see citing works
Self-citationOuimet, M., Ediriweera, H. N., Gundra, U. M., Sheedy, F. J., Ramkhelawon, B., Hutchison, S. B., Rinehold, K., van Solingen, C., Fullerton, M. D., Cecchini, K., et al. (2015) · Journal of Clinical Investigation · doi:10.1172/jci81676 · Cited by 394 · see citing works
“The 2 ′ -fluoro-methoxyethyl–modified control (TTATCGCCATGTCCAATGAGGCT) or anti–miR-33 (TGCAATG-CAACTACAATGCAC) oligonucleotides were provided by Regulus Therapeutics and were characterized as described (30, 31).”
Self-citationMicroRNA therapeutics: Discovering novel targets and developing specific therapy
Christopher, A., Kaur, R., Kaur, G., Kaur, A., Gupta, V., & Bansal, P. (2016) · Perspectives in Clinical Research · doi:10.4103/2229-3485.179431 · Cited by 394 · see citing works
“In a study, mice deficient for the low-density lipoprotein receptor (LDLr–/– mice), with established atherosclerotic plaques treated with anti-miR33 for 4 weeks, showed an increase in circulating HDL levels and enhanced reverse cholesterol transport to the plasma, liver, and feces.[13] Consistent with this, anti-miR33…”
BackgroundMacrophages and lipid metabolism
Remmerie, A., & Scott, C. L. (2018) · Cellular Immunology · doi:10.1016/j.cellimm.2018.01.020 · Cited by 385 · see citing works
HDL Function, Dysfunction, and Reverse Cholesterol Transport
Fisher, E., Feig, J. E., Hewing, B., Hazen, S., & Smith, J. D. (2012) · Arteriosclerosis, Thrombosis and Vascular Biology · doi:10.1161/atvbaha.112.300133 · Cited by 375 · see citing works
“In LDLr mice treated with an inhibitor of miR-33, HDL-C levels rose concomitant with enrichment of M2 markers in plaque CD68+ cells.(55) The treated mice also exhibited plaque regression with fewer macrophages and macrophage-derived foam cells.”
BackgroundSelf-citationHDL-targeted therapies: progress, failures and future
Kingwell, B. A., Chapman, M. J., Kontush, A., & Miller, N. E. (2014) · Nature Reviews Drug Discovery · doi:10.1038/nrd4279 · Cited by 354 · see citing works
Adult-specific functions of animal microRNAs
Sun, K., & Lai, E. C. (2013) · Nature Reviews Genetics · doi:10.1038/nrg3471 · Cited by 333 · see citing works
Deiuliis, J. A. (2015) · International Journal of Obesity · doi:10.1038/ijo.2015.170 · Cited by 352 · see citing works
Cyclodextrin promotes atherosclerosis regression via macrophage reprogramming
Zimmer, S., Grebe, A., Bakke, S. S., Bode, N., Halvorsen, B. L., Ulas, T., Skjelland, M., Nardo, D. D., Labzin, L. I., Kerksiek, A., et al. (2016) · Science Translational Medicine · doi:10.1126/scitranslmed.aad6100 · Cited by 363 · see citing works
“We adapted a less invasive regression protocol (20) in which ApoEmice were first fed a cholesterol-rich diet for 8 weeks to induce advanced atherosclerotic lesions and then switched to a normal chow diet for another 4 weeks during which CD or vehicle control was administered (Fig.”
MethodMicroRNA-mediated regulation of glucose and lipid metabolism
Agbu, P., & Carthew, R. W. (2021) · Nature Reviews Molecular Cell Biology · doi:10.1038/s41580-021-00354-w · Cited by 368 · see citing works
Rahman, K., Vengrenyuk, Y., Ramsey, S., Vila, N. R., Girgis, N., Liu, J.-H., Gusarova, V., Gromada, J., Weinstock, A., Moore, K., et al. (2017) · Journal of Clinical Investigation · doi:10.1172/jci75005 · Cited by 311 · see citing works
Self-citationRegulation of cholesterol homeostasis
Goedeke, L., & Fernández-Hernando, C. (2011) · Cellular and Molecular Life Sciences · doi:10.1007/s00018-011-0857-5 · Cited by 309 · see citing works
Transcriptional control of hepatic lipid metabolism by SREBP and ChREBP
Xu, X., So, J.-S., Park, J.-G., & Lee, A.-H. (2013) · Seminars in liver disease (Print) · doi:10.1055/s-0033-1358523 · Cited by 299 · see citing works
The not-so-simple HDL story: Is it time to revise the HDL cholesterol hypothesis?
Rader, D., & Tall, A. (2012) · Nature Medicine · doi:10.1038/nm.2937 · Cited by 293 · see citing works
Cardilo‐Reis, L., Gruber, S., Schreier, S. M., Drechsler, M., Papac‐Milicevic, N., Weber, C., Wagner, O., Stangl, H., Soehnlein, O., & Binder, C. J. (2012) · EMBO Molecular Medicine · doi:10.1002/emmm.201201374 · Cited by 292 · see citing works
“In this regard it is important to point out that Fisher and colleagues recently reported that regression of atherosclerotic lesions is associated with the up-regulation of markers of alternative macrophage activation (M2) (Feig et al, 2011a,b; Rayner et al, 2011).”
Wang, D.-L., Xia, M., Yan, X.-D., Li, D., Wang, L., Xu, Y., Jin, T.-R., & Ling, W. (2012) · Circulation Research · doi:10.1161/circresaha.112.266502 · Cited by 291 · see citing works
MicroRNAs in cardiovascular disease: from pathogenesis to prevention and treatment
Quiat, D., & Olson, E. N. (2013) · Journal of Clinical Investigation · doi:10.1172/jci62876 · Cited by 302 · see citing works
“of ABCA1 in resident plaque macrophages (61).”
Impaired Cholesterol Efflux in Senescent Macrophages Promotes Age-Related Macular Degeneration
Sene, A., Khan, A. A., Cox, D., Nakamura, R. E. I., Santeford, A., Kim, B. M., Sidhu, R., Onken, M. D., Harbour, J. W., Hagbi-Levi, S., et al. (2013) · Cell Metabolism · doi:10.1016/j.cmet.2013.03.009 · Cited by 277 · see citing works
“Recent studies have shown that a highly conservedmicroRNA, miR-33, regulates the expression of genes involved in cellular cholesterol metabolism, among them ABCA1 and ABCG1(Marquart et al., 2010; Najafi-Shoushtari et al., 2010; Rayner et al., 2010, 2011).”
Baumann, V., & Winkler, J. (2014) · Future Medicinal Chemistry · doi:10.4155/fmc.14.116 · Cited by 300 · see citing works
Kumar, S., Kim, C. W., Simmons, R., & Jo, H. (2014) · Arteriosclerosis, Thrombosis and Vascular Biology · doi:10.1161/atvbaha.114.303425 · Cited by 265 · see citing works
Genome-wide identification of microRNAs regulating cholesterol and triglyceride homeostasis
Wagschal, A., Najafi-Shoushtari, S. H., Wang, L., Goedeke, L., Sinha, S., deLemos, A. S., Black, J. C., Ramírez, C. M., Li, Y., Tewhey, R., et al. (2015) · Nature Medicine · doi:10.1038/nm.3980 · Cited by 266 · see citing works
Nutrition, Epigenetics, and Metabolic Syndrome
Wang, J.-J., Wu, Z.-L., Li, D.-F., Li, N., Dindot, S., Satterfield, M., Bazer, F., & Wu, G.-Y. (2012) · Antioxidants and Redox Signaling · doi:10.1089/ars.2011.4381 · Cited by 261 · see citing works
“…weekly for 4 weeks promoted the reversal transport of cholesterol from peripheral tissues to the plasma, liver, and feces, as well as regression of established atherosclerosis, and ameliorated dyslipidemia (as indicated by reduced concentrations of triacyglycerols and cholesterol in plasma) (141).”
MicroRNAs in Vascular and Metabolic Disease
Zampetaki, A., & Mayr, M. (2012) · Circulation Research · doi:10.1161/circresaha.111.247445 · Cited by 242 · see citing works
Xiao, H., Lu, M., Lin, T. Y., Chen, Z., Chen, G., Wang, W.-C., Marin, T., Shentu, T.-P., Wen, L., Gongol, B., et al. (2013) · Circulation · doi:10.1161/circulationaha.113.002714 · Cited by 257 · see citing works
“An antigomir against miR-33 decreases atherosclerosis in LDL receptor–null mice, with a concomitant increase in the level of high-density lipoprotein.(33) Inhibition of miR-33 also increases the level of high-density lipoprotein and lowers that of very LDL triglycerides in nonhuman primates.”
BackgroundMicroRNAs in Metabolic Disease
Fernández-Hernando, C., Ramírez, C. M., Goedeke, L., & Suárez, Y. (2013) · Arteriosclerosis, Thrombosis, and Vascular Biology · doi:10.1161/atvbaha.112.300144 · Cited by 257 · see citing works
ATP-Binding Cassette Transporters, Atherosclerosis, and Inflammation
Westerterp, M., Bochem, A. E., Yvan‐Charvet, L., Murphy, A. J., Wang, N., & Tall, A. R. (2014) · Circulation Research · doi:10.1161/circresaha.114.300738 · Cited by 257 · see citing works
“upregulation of cholesterol flux pathways by liver X receptor (LXR) activation,(11) or targeting microRNA (miR)-33 have antiatherogenic effects.(12) The role of the ATP-binding cassette”
BackgroundMonocyte and macrophage immunometabolism in atherosclerosis
Groh, L. A., Keating, S. T., Joosten, L. A. B., Netea, M. G., & Riksen, N. P. (2017) · Seminars in Immunopathology · doi:10.1007/s00281-017-0656-7 · Cited by 255 · see citing works
“Mir-33, which is triggered by a Western diet, specifically has been shown to be important in regulating a pro-inflammatory phenotype by inhibiting AMKP, which suppresses fatty acid oxidation (FAO) and enhances glycolysis [36, 37].”
InfluentialBesler, C., Lüscher, T. F., & Landmesser, U. (2012) · EMBO Molecular Medicine · doi:10.1002/emmm.201200224 · Cited by 219 · see citing works
“Increasing ABCA1 levels using anti-miR-33 treatment has recently been observed to reduce atherosclerotic plaque size and lipid content in LDL receptor-deficient mice (Rayner et al, 2011).”
Atherosclerosis – A matter of unresolved inflammation
Viola, J. R., & Soehnlein, O. (2015) · Seminars in Immunology · doi:10.1016/j.smim.2015.03.013 · Cited by 227 · see citing works
Regulatory T Cells License Macrophage Pro-Resolving Functions During Atherosclerosis Regression
Sharma, M., Schlegel, M., Afonso, M., Brown, E. J., Rahman, K., Weinstock, A., Sansbury, B. E., Corr, E. M., van Solingen, C., Koelwyn, G., et al. (2020) · Circulation Research · doi:10.1161/circresaha.119.316461 · Cited by 231 · see citing works
Self-citationMicroRNA-33 regulates sterol regulatory element-binding protein 1 expression in mice
Horie, T., Nishino, T., Baba, O., Kuwabara, Y., Nakao, T., Nishiga, M., Usami, S., Izuhara, M., Sowa, N., Yahagi, N., et al. (2013) · Nature Communications · doi:10.1038/ncomms3883 · Cited by 230 · see citing works
microRNA-33 regulates macrophage autophagy in atherosclerosis
Ouimet, M., Ediriweera, H., Afonso, M. S., Ramkhelawon, B., Singaravelu, R., Liao, X., Bandler, R. C., Rahman, K., Fisher, E. A., Rayner, K. J., et al. (2017) · Arteriosclerosis, Thrombosis, and Vascular Biology · doi:10.1161/atvbaha.116.308916 · Cited by 221 · see citing works
“reported that anti-miR-33 treatment reduced atherosclerotic plaque size by 35%, compared with control anti-miR.(27) To”
Self-citationMicroRNA‐33 Deficiency Reduces the Progression of Atherosclerotic Plaque in ApoE <sup>−/−</sup> Mice
Horie, T., Baba, O., Kuwabara, Y., Chujo, Y., Watanabe, S., Kinoshita, M., Horiguchi, M., Nakamura, T., Chonabayashi, K., Hishizawa, M., et al. (2012) · Journal of the American Heart Association · doi:10.1161/jaha.112.003376 · Cited by 220 · see citing works
“Moreover, antisense inhibition of miR-33 resulted in a regression of the atherosclerotic plaque volume in LDLreceptor-deficient mice.(19) Antisense inhibition of miRNA function is an important tool for elucidating miRNA biology and evaluating its therapeutic potential.”
BackgroundMethodResultInfluentialControl of Cholesterol Metabolism and Plasma High-Density Lipoprotein Levels by microRNA-144
Ramírez, C. M., Rotllan, N., Vlassov, A. V., Dávalos, A., Li, M., Goedeke, L., Aranda, J. F., Cirera-Salinas, D., Araldi, E., Salerno, A., et al. (2013) · Circulation Research · doi:10.1161/circresaha.112.300626 · Cited by 217 · see citing works
“Antagonists of miR-33 in mice increase liver and macrophage ABCA1 expression and promote reverse cholesterol transport and regression of atherosclerosis.(25) Of note, inhibition of miR-33a/b in nonhuman primates raises plasma HDL and lowers very LDL triglycerides (TG).”
BackgroundMicroRNA-148a regulates LDL receptor and ABCA1 expression to control circulating lipoprotein levels
Goedeke, L., Rotllán, N., Canfrán‐Duque, A., Aranda, J. F., Ramírez, C. M., Araldi, E., Lin, C., Anderson, N. N., Wagschal, A., de Cabo, R., et al. (2015) · Nature Medicine · doi:10.1038/nm.3949 · Cited by 270 · see citing works
“In particular, miR-33, miR-144, and miR-223 demonstrate the critical role of miRNAs in regulating cellular cholesterol efflux and HDL biogenesis 19–24 , while the liver-restricted miR-122 has been linked to the regulation of cholesterol and fatty acid synthesis through loss-of-function experiments…”
Dynamic Aspects of Macrophage Polarization during Atherosclerosis Progression and Regression
Peled, M., & Fisher, E. A. A. (2014) · Frontiers in Immunology · doi:10.3389/fimmu.2014.00579 · Cited by 203 · see citing works
“Consistent with that, and consistent with the apoA1 injection study, atherosclerotic lesions regressed by antimiR-33 treatment, as shown by reduced plaque size, lipid and macrophage content, increased collagen content and a diminished inflammatory state of the macrophages in the plaque (75).”
ResultSelf-citationPlatelet microparticles reprogram macrophage gene expression and function
Laffont, B., Corduan, A., Rousseau, M., Duchez, A., Lee, C.-H. C., Boilard, É., & Provost, P. (2015) · Thrombosis and Haemostasis · doi:10.1160/th15-05-0389 · Cited by 194 · see citing works
“In agreement with their results, we also observed by micro-array an upregulation of the IL-10 mRNA, a M2 macrophage marker (51).”
ResultMacrophage Trafficking, Inflammatory Resolution, and Genomics in Atherosclerosis
Moore, K. J., Koplev, S., Fisher, E. A. A., Tabas, I. A., Björkegren, J., Doran, A. C., & Kovacic, J. C. (2018) · Journal of the American College of Cardiology · doi:10.1016/j.jacc.2018.08.2147 · Cited by 221 · see citing works
Self-citationKarunakaran, D., Thrush, A. B., Nguyen, M.-A., Richards, L., Geoffrion, M., Singaravelu, R., Ramphos, E., Shangari, P., Ouimet, M., Pezacki, J. P., et al. (2015) · Circulation Research · doi:10.1161/circresaha.117.305624 · Cited by 188 · see citing works
Self-citationCholesterol transport system: An integrated cholesterol transport model involved in atherosclerosis.
Yu, X.-H., Zhang, D.-W., Zheng, X.-L., & Tang, C.-K. (2019) · Progress in lipid research · doi:10.1016/j.plipres.2018.12.002 · Cited by 179 · see citing works
Non-coding RNAs in cardiovascular cell biology and atherosclerosis
Fasolo, F., Gregoli, K. D., Mäegdefessel, L., & Johnson, J. L. (2019) · Cardiovascular Research · doi:10.1093/cvr/cvz203 · Cited by 202 · see citing works
MicroRNAs and lipid metabolism
Aryal, B. K., Singh, A. K., Rotllán, N., Price, N. D., & Fernandez-Hernando, C. F. (2017) · Current Opinion in Lipidology · doi:10.1097/mol.0000000000000420 · Cited by 203 · see citing works
Mir-33 regulates cell proliferation and cell cycle progression
Cirera-Salinas, D., Pauta, M., Allen, R. M., Salerno, A., Ramírez, C., Chamorro-Jorganes, A., Wanschel, A., Lasunción, M. A., Morales-Ruiz, M., Suárez, Y., et al. (2012) · Cell Cycle · doi:10.4161/cc.11.5.19421 · Cited by 177 · see citing works
“Of note, the inhibition of miR-33 using different strategies increases plasma high-density lipoproteins (HDL) in mouse and promotes the regression of atherosclerosis in mice.(20-22,25,26) Similarly to Srebp/miR-33 locus, the α-myosin heavy chain (alphaMHG) gene, in addition to encoding a major cardiac contractile prot…”
MethodRotllan, N., Ramírez, C. M., Aryal, B., Esau, C. C., & Fernández-Hernando, C. (2013) · Arteriosclerosis, Thrombosis, and Vascular Biology · doi:10.1161/atvbaha.113.301732 · Cited by 174 · see citing works
“Discussion Previous studies by Rayner et al(6) demonstrated that a 2′-fluoro/2′-methoxyethyl-modified anti–miR-33 was effective in an atherosclerosis regression model.(6) In Ldlr mice with established atherosclerotic plaques, anti–miR-33 treatment resulted in significant reduction in plaque size and elevated circulati…”
BackgroundSelf-citationKarunakaran, D., Nguyen, M.-A., Geoffrion, M., Vreeken, D., Lister, Z., Cheng, H. S., Otte, N., Essebier, P., Wyatt, H., Kandiah, J. W., et al. (2020) · Circulation · doi:10.1161/circulationaha.118.038379 · Cited by 219 · see citing works
Self-citationPreclinical and Clinical Development of Noncoding RNA Therapeutics for Cardiovascular Disease
Huang, C.-K., Kafert-Kasting, S., & Thum, T. (2020) · Circulation Research · doi:10.1161/circresaha.119.315856 · Cited by 213 · see citing works
MicroRNAs and cardiovascular diseases
Ono, K., Kuwabara, Y., & Han, J. (2011) · The FEBS Journal · doi:10.1111/j.1742-4658.2011.08090.x · Cited by 169 · see citing works
Zhang, M., Wu, J., Chen, W., Tang, S., Mo, Z., Tang, Y., Li, Y., Wang, J., Liu, X., Peng, J., et al. (2014) · Atherosclerosis · doi:10.1016/j.atherosclerosis.2014.02.008 · Cited by 177 · see citing works
“Renilla luciferase activity was normalized to the corresponding firefly luciferase activity and plotted as a percentage of the control (cells co-transfected with the corresponding concentration of control mimic) [21,22].”
MethodHDL-mediated mechanisms of protection in cardiovascular disease
Kontush, A. (2014) · Cardiovascular Research · doi:10.1093/cvr/cvu147 · Cited by 194 · see citing works
Ogg1-Dependent DNA Repair Regulates NLRP3 Inflammasome and Prevents Atherosclerosis
Tumurkhuu, G., Shimada, K., Dagvadorj, J., Crother, T., Zhang, W., Luthringer, D., Gottlieb, R., Chen, S., & Arditi, M. (2016) · Circulation Research · doi:10.1161/circresaha.116.308362 · Cited by 164 · see citing works
“Antagonizing miR-33a/b may be an effective strategy for raising plasma high-density lipoprotein levels and protecting against atherosclerosis in mice and nonhuman primates.(22,23) In this work, we show the atheroprotective role of OGG1 in a WD-induced model of atherosclerosis using Ldlr mice.”
BackgroundHigh-Density Lipoprotein and Atherosclerosis Regression
Feig, J. E., Hewing, B., Smith, J. D., Hazen, S. L., & Fisher, E. A. A. (2014) · Circulation Research · doi:10.1161/circresaha.114.300760 · Cited by 169 · see citing works
Self-citationWei, Y., Nazari-Jahantigh, M., Chan, L., Zhu, M., Heyll, K., Corbalán-Campos, J., Hartmann, P., Thiemann, A., Weber, C., & Schober, A. (2013) · Circulation · doi:10.1161/circulationaha.112.000736 · Cited by 233 · see citing works
Allen, R. M., Marquart, T. J., Albert, C. J., Suchy, F. J., Wang, D. Q. ‐., Ananthanarayanan, M., Ford, D. A., & Baldán, Á. (2012) · EMBO Molecular Medicine · doi:10.1002/emmm.201201228 · Cited by 159 · see citing works
“Manipulation of miR-33 levels in vivo results in changes in circulating levels of high-density lipoproteins (HDL) (Horie et al, 2010; Marquart et al, 2010; Najafi-Shoushtari et al, 2010; Rayner et al, 2010, 2011a,b).”
Regulation of cholesterol and bile acid homeostasis by the CYP7A1/SREBP2/miR-33a axis
Li, T.-G., Francl, J., Boehme, S., & Chiang, J. Y. L. (2013) · Hepatology · doi:10.1002/hep.26427 · Cited by 153 · see citing works
“Additionally, miR-33a antagonism promoted regression of atherosclerosis in mice and nonhuman primates.(13,14) These studies suggest that miR-33a acts in a synergistic manner with SREBP2 to regulate cellular cholesterol homeostasis.”
BackgroundMacrophages in Vascular Inflammation – From Atherosclerosis to Vasculitis
Shirai, T., Hilhorst, M., Harrison, D., Goronzy, J., & Weyand, C. (2015) · Autoimmunity · doi:10.3109/08916934.2015.1027815 · Cited by 152 · see citing works
“It has been predicted that increasing lipid efflux using LXR agonists or inhibition of microRNA-33 may favorably affect disease-sustaining macrophages [143,144].”
Macrophage Plasticity and Atherosclerosis Therapy
Lin, P. C., Ji, H., Li, Y., & Guo, S. (2021) · Frontiers in Molecular Biosciences · doi:10.3389/fmolb.2021.679797 · Cited by 166 · see citing works
miRNAs in atherosclerotic plaque initiation, progression, and rupture
Andreou, I., Sun, X., Stone, P. H., Edelman, E. R., & Feinberg, M. W. (2015) · Trends in Molecular Medicine · doi:10.1016/j.molmed.2015.02.003 · Cited by 153 · see citing works
“Treatment with anti-miR-33 oligonucleotides increased ABCA1 and ABCG1 expression, thus enhancing cholesterol efflux and regression of atherosclerotic plaques in LDLR−/− mice [51].”
Differential Expression of MicroRNAs in Different Disease States
Abdellatif, M. (2012) · Circulation Research · doi:10.1161/circresaha.111.247437 · Cited by 154 · see citing works
Hewing, B., Parathath, S., Barrett, T. J., Chung, W. K. K., Astudillo, Y., Hamada, T., Ramkhelawon, B., Tallant, T. C., Yusufishaq, M., DiDonato, J., et al. (2014) · Arteriosclerosis, Thrombosis and Vascular Biology · doi:10.1161/atvbaha.113.303044 · Cited by 147 · see citing works
Self-citationSaeed, O., Otsuka, F., Polavarapu, R., Karmali, V., Weiss, D., Davis, T., Rostad, B., Pachura, K., Adams, L., Elliott, J., et al. (2012) · Arteriosclerosis, Thrombosis, and Vascular Biology · doi:10.1161/atvbaha.111.240101 · Cited by 146 · see citing works
“…pharmacologic or genetic means to demonstrate that increasing macrophage cholesterol efflux proteins ABCA1 and ABCG1 might be another promising strategy to prevent atherosclerosis progression 23, 24 , a limited number of agents to increase macrophage cholesterol efflux are clinical development.”
Xu, L.-N., Li, Y., Yin, L., Qi, Y., Sun, H.-J., Sun, P., Xu, M., Tang, Z.-Y., & Peng, J.-Y. (2018) · Theranostics · doi:10.7150/thno.27425 · Cited by 146 · see citing works
Goedeke, L., Salerno, A., Ramírez, C. M., Guo, L., Allen, R. M., Yin, X., Langley, S. R., Esau, C., Wanschel, A., Fisher, E. A., et al. (2014) · EMBO Molecular Medicine · doi:10.15252/emmm.201404046 · Cited by 145 · see citing works
“Similarly, non-human primates treated with anti-miR-33 oligonucleotides also exhibit increased HDL-C levels (Rayner et al , 2011a; Rottiers et al , 2013).”
InfluentialSelf-citationMicroRNA-144 Regulates Hepatic ABCA1 and Plasma HDL Following Activation of the Nuclear Receptor FXR
Vallim, T. Q. D. A., Tarling, E., Kim, T., Civelek, M., Baldán, Á., Esau, C. C., & Edwards, P. (2013) · Circulation Research · doi:10.1161/circresaha.112.300648 · Cited by 142 · see citing works
Self-citationMolecular Pathways Underlying Cholesterol Homeostasis
Afonso, M., Machado, R., Lavrador, M. S., Quintão, E., Moore, K., & Lottenberg, A. M. (2018) · Nutrients · doi:10.3390/nu10060760 · Cited by 141 · see citing works
“In addition, miR-33, a microRNA located within an intron in the SREBF2 locus, is co-transcribed with SREBF2 and acts to repress cholesterol trafficking and export, so that the intracellular cholesterol concentrations can be quickly restored [25,26].”
BackgroundSelf-citationWijesekara, N., Zhang, L.-H., Kang, M. H., Abraham, T., Bhattacharjee, A., Warnock, G., Verchere, C., & Hayden, M. (2012) · Diabetes · doi:10.2337/db11-0944 · Cited by 141 · see citing works
New insights into the mechanism of low high-density lipoprotein cholesterol in obesity
Wang, H., & Peng, D.-Q. (2011) · Lipids in Health and Disease · doi:10.1186/1476-511x-10-176 · Cited by 140 · see citing works
“Rayner et al [87] studied the impact of miR-33 inhibition in mice deficient for LDL receptor (Ldlr mice), with established atherosclerotic plaques.”
BackgroundA Regulatory Role for MicroRNA 33* in Controlling Lipid Metabolism Gene Expression
Goedeke, L., Vales-Lara, F. M., Fenstermaker, M., Cirera-Salinas, D., Chamorro-Jorganes, A., Ramírez, C. M., Mattison, J. A., de Cabo, R., Suárez, Y., & Fernández-Hernando, C. (2013) · Molecular and Cellular Biology · doi:10.1128/mcb.01714-12 · Cited by 140 · see citing works
“This is particularly relevant, as previous works from our lab and others have highlighted the therapeutic potential of inhibiting miR-33 to treat atherosclerosis and metabolic syndrome (40, 41).”
BackgroundMicroRNAs in the Pathobiology and Therapy of Atherosclerosis
Laffont, B., & Rayner, K. J. (2017) · Canadian Journal of Cardiology · doi:10.1016/j.cjca.2017.01.001 · Cited by 151 · see citing works
Self-citationWanschel, A., Seibert, T., Hewing, B., Ramkhelawon, B., Ray, T. D., van Gils, J. V., Rayner, K. J., Feig, J. E., O'Brien, E., Fisher, E., et al. (2013) · Arteriosclerosis, Thrombosis and Vascular Biology · doi:10.1161/atvbaha.112.300941 · Cited by 139 · see citing works
“This decrease in macrophage Sema3E mRNA also correlated with a reduction in the inflammatory M1 macrophage marker Nos2 and an increase in the anti-inflammatory M2 macrophage marker Arg1 (Figure 2B), which we have previously shown to characterize plaques undergoing regression.(6,7,22) To investigate further whether Sem…”
Self-citationSu, Y.-W., Yuan, J., Zhang, F.-R., Lei, Q., Zhang, T.-T., Li, K., Guo, J.-W., Hong, Y.-S., Bu, G.-L., Lv, X., et al. (2019) · Cell Death and Disease · doi:10.1038/s41419-019-1599-9 · Cited by 138 · see citing works
Madrigal‐Matute, J., Rotllán, N., Aranda, J. F., & Fernandez-Hernando, C. F. (2013) · Current Atherosclerosis Reports · doi:10.1007/s11883-013-0322-z · Cited by 142 · see citing works
Cholesterol efflux and reverse cholesterol transport.
Favari, E., Chroni, A., Tietge, U., Zanotti, I., Escolà-Gil, J., & Bernini, F. (2015) · Handbook of Experimental Pharmacology · doi:10.1007/978-3-319-09665-0_4 · Cited by 137 · see citing works
Benatti, R., Melo, A. M., Borges, F., Ignácio-Souza, L., Simino, L. A. P., Milanski, M., Velloso, L., Torsoni, M., & Torsoni, A. (2014) · British Journal of Nutrition · doi:10.1017/s0007114514000579 · Cited by 135 · see citing works
MicroRNAs: Emerging roles in adipogenesis and obesity
Peng, Y., Yu, S., Li, H., Xiang, H., Peng, J., & Jiang, S. (2014) · Cellular Signalling · doi:10.1016/j.cellsig.2014.05.006 · Cited by 139 · see citing works
Hu, B., Lin, J., Yang, X., & Sang, X. (2020) · Cell Proliferation · doi:10.1111/cpr.12772 · Cited by 147 · see citing works
The long noncoding RNA CHROME regulates cholesterol homeostasis in primate
Hennessy, E., van Solingen, C., Scacalossi, K. R., Ouimet, M., Afonso, M., Prins, J., Koelwyn, G., Sharma, M., Ramkhelawon, B., Carpenter, S., et al. (2018) · Nature Metabolism · doi:10.1038/s42255-018-0004-9 · Cited by 132 · see citing works
Self-citationThe multifactorial nature of microRNAs in vascular remodelling.
Welten, S., Goossens, E. A. C., Quax, P., & Nossent, A. Y. (2016) · Cardiovascular Research · doi:10.1093/cvr/cvw039 · Cited by 130 · see citing works
MicroRNAs in metabolism and metabolic diseasesPreprint
Rottiers, V., Najafi-Shoushtari, S. H., Kristo, F., Gurumurthy, S., Zhong, L., Li, Y.-X., Cohen, D. E., Gerszten, R. E., Bardeesy, N., Mostoslavsky, R., et al. (2011) · Cold Spring Harbor Symposia on Quantitative Biology · doi:10.1101/sqb.2011.76.011049 · Cited by 130 · see citing works
“2010), it was recently reported that injecting LDLR mice on an atherogenic diet with an anti-miR-33 oligonucleotide reduces atherosclerotic plaque size (Rayner et al. 2011).”
Genetic dissection of the impact of miR-33a and miR-33b during the progression of atherosclerosis
Price, N. L., Rotllan, N., Canfrán-Duque, A., Zhang, X., Pati, P., Arias, N., Moen, J., Mayr, M., Ford, D. A., Baldán, Á., et al. (2017) · Cell reports · doi:10.1016/j.celrep.2017.10.023 · Cited by 129 · see citing works
“…efflux and HDL-C metabolism, miR-33 is an attractive target for the treatment of cardiovascular disease, and several studies have found that antagonism of miR-33 can reduce atherosclerotic plaque burden (Karunakaran et al., 2015; Ouimet et al., 2015; Rayner et al., 2011b; Rotllan et al., 2013).”
BackgroundInfluentialmicroRNA-33 Regulates ApoE Lipidation and Amyloid-β Metabolism in the Brain
Kim, J., Yoon, H., Horie, T., Burchett, J. M., Restivo, J. L., Rotllan, N., Ramírez, C. M., Verghese, P. B., Ihara, M., Hoe, H.-S., et al. (2015) · The Journal of Neuroscience · doi:10.1523/jneurosci.2053-15.2015 · Cited by 128 · see citing works
“Previously, we demonstrated that ABCA1 expression is regulated by miR-33 in the periphery (Horie et al., 2010; Rayner et al., 2010, 2011a,b).”
BackgroundMethodSelf-citationKurtz, C., Peck, B. C. E., Fannin, E. E., Beysen, C., Miao, J., Landstreet, S. R., Ding, S., Turaga, V., Lund, P., Turner, S., et al. (2014) · Diabetes · doi:10.2337/db13-1015 · Cited by 127 · see citing works
- Authors
- Rayner, K. J., Sheedy, F. J., Esau, C. C., Hussain, F. N., Temel, R. E., Parathath, S., van Gils, J. M., Rayner, A. J., Chang, A. N., Suarez, Y., Fernandez-Hernando, C., Fisher, E. A., & Moore, K. J.
- Affiliations
- New York University (US)
- Regulus Therapeutics (United States) (US)
- Wake Forest University Health Sciences (US)
- Corresponding author
- Moore, Kathryn J.
- ORCID
- Venue
- Journal of Clinical Investigation
- Published
- 2011-07-01
- Volume
- 121
- Issue
- 7
- Pages
- 2921-2931
- ISSN
- 0021-9738 (ISSN-L)
- PMC
- PMC3223840
- OpenAlex
- W2168964544
- Cited by
- 690
- References
- 0
- Citations by year
- 2026: 14 · 2025: 27 · 2024: 21 · 2023: 35 · 2022: 41 · 2021: 36 · 2020: 38 · 2019: 43 · 2018: 45 · 2017: 48 · 2016: 63 · 2015: 62 · 2014: 82 · 2013: 71 · 2012: 50
- FWCI
- 70.78
- Type
- journal article
- Language
- en
- Open access
- green
- www.ncbi.nlm.nih.gov
- Locations
- Journal of Clinical Investigation (publishedVersion)
- Europe PMC (PubMed Central) (publishedVersion)
- PubMed Central (publishedVersion)
- PubMed (publishedVersion)
- Data Archiving and Networked Services (DANS) (submittedVersion)
- Leiden Repository (Leiden University) (submittedVersion)
- Funders
- National Institutes of Health (5r00hl088528-05)
- Canadian Institutes of Health Research
- National Institute on Aging (R01AG020255)
- National Heart, Lung, and Blood Institute (R01HL084312, R00-HL088528, K99HL088528, P01HL098055, R01HL108182, R01HL107953)
- Topics
- Health Sciences › Medicine › Surgery › Cholesterol and Lipid Metabolism
- Life Sciences › Biochemistry, Genetics and Molecular Biology › Cancer Research › MicroRNA in disease regulation
- Life Sciences › Immunology and Microbiology › Immunology › Atherosclerosis and Cardiovascular Diseases
- Keywords
- miR-33, reverse cholesterol transport, HDL cholesterol, atherosclerosis regression, ABCA1, SREBF2, LDL receptor-deficient mice, atherosclerotic plaque, plaque macrophages, cholesterol efflux, plaque stability, inflammation
- MeSH terms
- Animals, Humans, Cholesterol, HDL, Liver, Macrophages, Mice, Inbred C57BL, Random Allocation, Receptors, LDL, Gene Expression, Mice, Knockout, ATP-Binding Cassette Transporters, MicroRNAs, Atherosclerosis, Lipid Metabolism, Mice, ATP Binding Cassette Transporter 1
About these checks
Registry, retraction, Cites and statistics results are computed, not judged, with one exception: a printed reference that no index lists is read once by a model before it counts as a citation error. Claims are extracted by a model and kept only when their quote appears verbatim in the text; each cited source is then checked, with a model’s help, for whether it says what the claim relies on. Those verdicts can be wrong — read the claim’s quote and the cited source before relying on one.
Statistics and arithmetic are recomputed, not judged.
Confidence bands are shown only for fields calibrated on our annotated test set. None is calibrated yet, so no band is shown.
What counts as a claim ›How we measure confidence ›How we check this ›
Are you an author, or do you see a problem with this page? Request a review
