The DOI matches its Crossref record; 67 of the 67 references it cites were found in a registry or an index.
MicroRNA-33-dependent regulation of macrophage metabolism directs immune cell polarization in atherosclerosis
Open accessAbstract
Cellular metabolism is increasingly recognized as a controller of immune cell fate and function. MicroRNA-33 (miR-33) regulates cellular lipid metabolism and represses genes involved in cholesterol efflux, HDL biogenesis, and fatty acid oxidation. Here, we determined that miR-33-mediated disruption of the balance of aerobic glycolysis and mitochondrial oxidative phosphorylation instructs macrophage inflammatory polarization and shapes innate and adaptive immune responses. Macrophage-specific Mir33 deletion increased oxidative respiration, enhanced spare respiratory capacity, and induced an M2 macrophage polarization-associated gene profile. Furthermore, miR-33-mediated M2 polarization required miR-33 targeting of the energy sensor AMP-activated protein kinase (AMPK), but not cholesterol efflux. Notably, miR-33 inhibition increased macrophage expression of the retinoic acid-producing enzyme aldehyde dehydrogenase family 1, subfamily A2 (ALDH1A2) and retinal dehydrogenase activity both in vitro and in a mouse model. Consistent with the ability of retinoic acid to foster inducible Tregs, miR-33-depleted macrophages had an enhanced capacity to induce forkhead box P3 (FOXP3) expression in naive CD4(+) T cells. Finally, treatment of hypercholesterolemic mice with miR-33 inhibitors for 8 weeks resulted in accumulation of inflammation-suppressing M2 macrophages and FOXP3(+) Tregs in plaques and reduced atherosclerosis progression. Collectively, these results reveal that miR-33 regulates macrophage inflammation and demonstrate that miR-33 antagonism is atheroprotective, in part, by reducing plaque inflammation by promoting M2 macrophage polarization and Treg induction.
Overview
The claims and statistics of this paper haven’t been checked yet.
Run the check — free, no account needed. It reads the open-access text and checks the sources it cites.
Integrity signals
Registry
Cites
Statistics
Verification
Claims the paper makes
The claims and statistics of this paper haven’t been checked yet.
Run the check — free, no account needed. It reads the open-access text and checks the sources it cites.
Claims other papers make about this one
Each is checked against this paper’s own text: does it say what the citing paper says it does?
In the citing paper
“several studies have found that antagonism of miR-33 can reduce atherosclerotic plaque burden (Karunakaran et al., 2015; Ouimet et al., 2015; Rayner et al., 2011b; Rotllan et al., 2013).”
From Genetic dissection of the impact of miR-33a and miR-33b during the progression of atherosclerosis (2017) · cites this paper as Ouimet et al., 2015
In the citing paper
“Inhibition of miR-33a or miR-33a deletion in macrophages has been shown to affect myeloid cell differentiation 25) , induce M2 macrophage polarization with mitochondrial respiratory and metabolic changes 26 , 27) , and enhance autophagy 28 , 29) .”
From Critical Role of microRNA-33a/b in Cardiovascular and Metabolic Disease: Molecular Mechanisms and Therapeutic Perspectives (2026) · cites this paper as [26]
In the citing paper
“Expression of miR-33 is also overexpressed in M1, thus promoting pro-inflammatory functions [132].”
From MicroRNAs as Regulators of Phagocytosis (2022) · cites this paper as [132]
Self-check
Percentages, sums and reported differences re-computed from the paper’s own numbers.
The self-check needs the paper’s full text.
Citations
Cites
Macrophage biology in development, homeostasis and disease
Wynn, T. A., Chawla, A., & Pollard, J. W. (2013) · Nature · doi:10.1038/nature12034 · Cited by 4,684 · cited 3×
“In addition, macrophages play important roles in tissue homeostasis and resolution of inflammation (2).”
AMPK: a nutrient and energy sensor that maintains energy homeostasis
Hardie, D. G., Ross, F. A., & Hawley, S. A. (2012) · Nature Reviews Molecular Cell Biology · doi:10.1038/nrm3311 · Cited by 4,602
Succinate is an inflammatory signal that induces IL-1β through HIF-1α
Tannahill, G. M., Curtis, A. M., Adamik, J., Palsson-McDermott, E. M., McGettrick, A. F., Goel, G., Frezza, C., Bernard, N. J., Kelly, B., Foley, N. H., et al. (2013) · Nature · doi:10.1038/nature11986 · Cited by 4,176
Monocyte recruitment during infection and inflammation
Shi, C., & Pamer, E. G. (2011) · Nature Reviews Immunology · doi:10.1038/nri3070 · Cited by 3,015
Macrophages in the Pathogenesis of Atherosclerosis
Moore, K. J., & Tabas, I. (2011) · Cell · doi:10.1016/j.cell.2011.04.005 · Cited by 2,669
Self-citationMacrophages in atherosclerosis: a dynamic balance
Moore, K. J., Sheedy, F. J., & Fisher, E. A. (2013) · Nature reviews. Immunology · doi:10.1038/nri3520 · Cited by 2,559
Self-citationMetabolic control through the PGC-1 family of transcription coactivators
Lin, J., Handschin, C., & Spiegelman, B. M. (2005) · Cell Metabolism · doi:10.1016/j.cmet.2005.05.004 · Cited by 2,130 · cited 1×
“…malonyl-CoA–mediated inhibition of CPT1 and stimulating uptake of activated fatty acids into the mitochondria (44, 45), and (b) enhancement of expression of SIRT1 and PGC-1 α , resulting in transcriptional activation of genes involved in mitochondrial FAO and mitochondrial biogenesis (46, 47).”
Michalek, R. D., Gerriets, V. A., Jacobs, S. R., Macintyre, A. N., MacIver, N. J., Mason, E. F., Sullivan, S. A., Nichols, A. G., & Rathmell, J. C. (2011) · The Journal of Immunology · doi:10.4049/jimmunol.1003613 · Cited by 2,091
Shi, L. Z., Wang, R., Huang, G., Vogel, P., Neale, G., Green, D. R., & Chi, H. (2011) · Journal of Experimental Medicine · doi:10.1084/jem.20110278 · Cited by 1,803
Oxidative metabolism and PGC-1β attenuate macrophage-mediated inflammation
Vats, D., Mukundan, L., Odegaard, J. I., Zhang, L., Smith, K. L., Morel, C. R., Greaves, D. R., Murray, P. J., & Chawla, A. (2006) · Cell Metabolism · doi:10.1016/j.cmet.2006.05.011 · Cited by 1,369
MiR-33 Contributes to the Regulation of Cholesterol Homeostasis
Rayner, K. J., Suárez, Y., Dávalos, A., Parathath, S., Fitzgerald, M. L., Tamehiro, N., Fisher, E. A., Moore, K. J., & Fernández-Hernando, C. (2010) · Science · doi:10.1126/science.1189862 · Cited by 1,260
Self-citationCell-intrinsic lysosomal lipolysis is essential for alternative activation of macrophages
Huang, S. C., Everts, B., Ivanova, Y., O’Sullivan, D., Nascimento, M., Smith, A. M., Beatty, W. L., Love-Gregory, L. D., Lam, W. Y., O’Neill, C. M., et al. (2014) · Nature Immunology · doi:10.1038/ni.2956 · Cited by 1,256
Toll-like receptor–induced changes in glycolytic metabolism regulate dendritic cell activation
Krawczyk, C. M., Holowka, T., Sun, J., Blagih, J., Amiel, E., DeBerardinis, R. J., Cross, J. R., Jung, E., Thompson, C. B., Jones, R. G., et al. (2010) · Blood · doi:10.1182/blood-2009-10-249540 · Cited by 1,246
Rodríguez-Prados, J.-C., Través, P. G., Cuenca, J., Rico, D., Aragonés, J., Martín-Sanz, P., Cascante, M., & Boscá, L. (2010) · The Journal of Immunology · doi:10.4049/jimmunol.0901698 · Cited by 1,022
Metabolic Reprogramming of Macrophages
Freemerman, A. J., Johnson, A. R., Sacks, G. N., Milner, J. J., Kirk, E. L., Troester, M. A., Macintyre, A. N., Goraksha-Hicks, P., Rathmell, J. C., & Makowski, L. (2014) · Journal of Biological Chemistry · doi:10.1074/jbc.m113.522037 · Cited by 1,007
MicroRNA-33 and the SREBP Host Genes Cooperate to Control Cholesterol Homeostasis
Najafi-Shoushtari, S. H., Kristo, F., Li, Y., Shioda, T., Cohen, D. E., Gerszten, R. E., & Näär, A. M. (2010) · Science · doi:10.1126/science.1189123 · Cited by 957 · cited 2×
“…with their host genes, SREBF2 and SREBF1 , which code for transcription factors that regulate cholesterol and fatty acid synthesis/uptake (24–26). miR-33a/b repress the expression of genes involved in pathways that these oppose SREBP-driven functions, including cholesterol efflux ( ABCA1 ,…”
Metabolic regulation of immune responses
Ganeshan, K., & Chawla, A. (2014) · Annual Review of Immunology · doi:10.1146/annurev-immunol-032713-120236 · Cited by 926
Hadis, U., Wahl, B., Schulz, O., Hardtke-Wolenski, M., Schippers, A., Wagner, N., Müller, W., Sparwasser, T., Förster, R., & Pabst, O. (2011) · Immunity · doi:10.1016/j.immuni.2011.01.016 · Cited by 893
Fullerton, M. D., Galic, S., Marcinko, K., Sikkema, S., Pulinilkunnil, T., Chen, Z.-P., O'Neill, H. M., Ford, R. J., Palanivel, R., O'Brien, M., et al. (2013) · Nature Medicine · doi:10.1038/nm.3372 · Cited by 893
Self-citationIFN-gamma potentiates atherosclerosis in ApoE knock-out mice.
Gupta, S. K. S., Pablo, A. M., Jiang, X., Wang, N., Tall, A. R., & Schindler, C. (1997) · Journal of Clinical Investigation · doi:10.1172/jci119465 · Cited by 885
Sağ, D., Carling, D., Stout, R. D., & Suttles, J. (2008) · The Journal of Immunology · doi:10.4049/jimmunol.181.12.8633 · Cited by 803
Krüppel-like factor 4 regulates macrophage polarization
Liao, X., Sharma, N., Kapadia, F., Zhou, G., Lu, Y., Hong, H., Paruchuri, K., Mahabeleshwar, G. H., Dalmas, E., Venteclef, N., et al. (2011) · Journal of Clinical Investigation · doi:10.1172/jci45444 · Cited by 778
Inhibition of miR-33a/b in non-human primates raises plasma HDL and lowers VLDL triglycerides
Rayner, K. J., Esau, C. C., Hussain, F. N., McDaniel, A. L., Marshall, S. M., van Gils, J. M., Ray, T. D., Sheedy, F. J., Goedeke, L., Liu, X., et al. (2011) · Nature · doi:10.1038/nature10486 · Cited by 706
Self-citationRayner, K. J., Sheedy, F. J., Esau, C. C., Hussain, F. N., Temel, R. E., Parathath, S., van Gils, J. M., Rayner, A. J., Chang, A. N., Suarez, Y., et al. (2011) · Journal of Clinical Investigation · doi:10.1172/jci57275 · Cited by 690 · cited 1×
“The 2 ′ -fluoro-methoxyethyl–modified control (TTATCGCCATGTCCAATGAGGCT) or anti–miR-33 (TGCAATG-CAACTACAATGCAC) oligonucleotides were provided by Regulus Therapeutics and were characterized as described (30, 31).”
Self-citationmiR-33a/b contribute to the regulation of fatty acid metabolism and insulin signaling
Dávalos, A., Goedeke, L., Smibert, P., Ramírez, C. M., Warrier, N. P., Andreo, U., Cirera-Salinas, D., Rayner, K., Suresh, U., Pastor-Pareja, J. C., et al. (2011) · Proceedings of the National Academy of Sciences · doi:10.1073/pnas.1102281108 · Cited by 670 · cited 5×
“We previously demonstrated that miR-33 targets genes involved in FAO in hepatocytes, including Cpt1a , Crot , Hadhb , and Prkaa1 (27), and show here that miR-33 overexpression and inhibition in macrophages reciprocally regulates the expression of Cpt1a , Crot , Hadhb , and Prkaa1 mRNA (Figure 2C).”
InfluentialSelf-citationZizzo, G., Hilliard, B. A., Monestier, M., & Cohen, P. L. (2012) · The Journal of Immunology · doi:10.4049/jimmunol.1200662 · Cited by 650
Alternative macrophage activation and metabolism
Odegaard, J. I., & Chawla, A. (2011) · Annual Review of Pathology: Mechanisms of Disease · doi:10.1146/annurev-pathol-011110-130138 · Cited by 640
McGarry, J., Leatherman, G. F., & Foster, D. W. (1978) · Journal of Biological Chemistry · doi:10.1016/s0021-9258(17)34693-8 · Cited by 591
miR-33 links SREBP-2 induction to repression of sterol transporters
Marquart, T. J., Allen, R. M., Ory, D. S., & Baldán, Á. (2010) · Proceedings of the National Academy of Sciences · doi:10.1073/pnas.1005191107 · Cited by 562
The Role of Retinoic Acid in Tolerance and Immunity
Hall, J. A., Grainger, J. R., Spencer, S. P., & Belkaid, Y. (2011) · Immunity · doi:10.1016/j.immuni.2011.07.002 · Cited by 559
Type 2 immunity and wound healing: evolutionary refinement of adaptive immunity by helminths
Gause, W. C., Wynn, T. A., & Allen, J. E. (2013) · Nature reviews. Immunology · doi:10.1038/nri3476 · Cited by 481
Hanna, R. N., Shaked, I., Hubbeling, H., Punt, J. A., Wu, R., Herrley, E., Zaugg, C., Pei, H., Geissmann, F., Ley, K. F., et al. (2011) · Circulation Research · doi:10.1161/circresaha.111.253377 · Cited by 464
Disruption of TGF-β signaling in T cells accelerates atherosclerosis
Robertson, A.-K. L., Rudling, M. J., Zhou, X., Gorelik, L., Flavell, R. A., & Hansson, G. K. (2003) · Journal of Clinical Investigation · doi:10.1172/jci18607 · Cited by 440
Yvan-Charvet, L., Welch, C., Pagler, T. A., Ranalletta, M., Lamkanfi, M., Han, S., Ishibashi, M., Li, R., Wang, N., & Tall, A. R. (2008) · Circulation · doi:10.1161/circulationaha.108.793869 · Cited by 439
Gräbner, R., Lötzer, K., Döpping, S., Hildner, M., Radke, D., Beer, M., Spanbroek, R., Lippert, B., Reardon, C. A., Getz, G. S., et al. (2009) · The Journal of Experimental Medicine · doi:10.1084/jem.20080752 · Cited by 409
Chinetti-Gbaguidi, G., Baron, M., Bouhlel, M. A., Vanhoutte, J., Copin, C., Sebti, Y., Derudas, B., Mayi, T., Bories, G., Tailleux, A., et al. (2011) · Circulation Research · doi:10.1161/circresaha.110.233775 · Cited by 387
Horie, T., Ono, K., Horiguchi, M., Nishi, H., Nakamura, T., Nagao, K., Kinoshita, M., Kuwabara, Y., Marusawa, H., Iwanaga, Y., et al. (2010) · Proceedings of the National Academy of Sciences · doi:10.1073/pnas.1008499107 · Cited by 384
Expression of miR-33 from an SREBP2 Intron Inhibits Cholesterol Export and Fatty Acid Oxidation*
Gerin, I., Clerbaux, L.-A., Haumont, O., Lanthier, N., Das, A. K., Burant, C. F., Leclercq, I. A., MacDougald, O. A., & Bommer, G. T. (2010) · Journal of Biological Chemistry · doi:10.1074/jbc.m110.152090 · Cited by 382
Exogenous Interferon-γ Enhances Atherosclerosis in Apolipoprotein E−/− Mice
Whitman, S. C., Ravisankar, P., Elam, H., & Daugherty, A. (2000) · American Journal Of Pathology · doi:10.1016/s0002-9440(10)64820-1 · Cited by 379
Moore, K. J., Kunjathoor, V. V., Koehn, S. L., Manning, J. J., Tseng, A. A., Silver, J. M., McKee, M. L., & Freeman, M. W. (2005) · Journal of Clinical Investigation · doi:10.1172/jci24061 · Cited by 371
Self-citationGundra, U. M., Girgis, N. M., Ruckerl, D., Jenkins, S., Ward, L. N., Kurtz, Z. D., Wiens, K. E., Tang, M. S., Basu-Roy, U., Mansukhani, A., et al. (2014) · Blood · doi:10.1182/blood-2013-08-520619 · Cited by 371
Self-citationAMPK regulation of fatty acid metabolism and mitochondrial biogenesis: implications for obesity.
O’Neill, H. M., Holloway, G. P., & Steinberg, G. R. (2013) · Molecular and Cellular Endocrinology · doi:10.1016/j.mce.2012.06.019 · Cited by 364
Self-citationZhu, X., Lee, J., Timmins, J. M., Brown, J. M., Boudyguina, E. Y., Mulya, A., Gebre, A. K., Willingham, M. C., Hiltbold, E. M., Mishra, N., et al. (2008) · Journal of Biological Chemistry · doi:10.1074/jbc.m801408200 · Cited by 356
Galić, S., Fullerton, M. D., Schertzer, J. D., Sikkema, S. R., Marcinko, K., Walkley, C. R., Izon, D. J., Honeyman, J. E., Chen, Z., van Denderen, B. J., et al. (2011) · Journal of Clinical Investigation · doi:10.1172/jci58577 · Cited by 352
Self-citationZhu, X., Owen, J. S., Wilson, M. D., Li, H., Griffiths, G. L., Thomas, M. J., Hiltbold, E. M., Fessler, M. B., & Parks, J. S. (2010) · Journal of Lipid Research · doi:10.1194/jlr.m006486 · Cited by 331
Feig, J. E., Rong, J. X., Shamir, R., Sanson, M., Vengrenyuk, Y., Liu, J., Rayner, K. J., Moore, K. J., Garabedian, M. J., & Fisher, E. A. A. (2011) · Proceedings of the National Academy of Sciences · doi:10.1073/pnas.1016086108 · Cited by 313
Self-citationCardilo‐Reis, L., Gruber, S., Schreier, S. M., Drechsler, M., Papac‐Milicevic, N., Weber, C., Wagner, O., Stangl, H., Soehnlein, O., & Binder, C. J. (2012) · EMBO Molecular Medicine · doi:10.1002/emmm.201201374 · Cited by 292
Buono, C., Come, C. E., Stavrakis, G., Maguire, G. F., Connelly, P. W., & Lichtman, A. H. (2003) · Arteriosclerosis Thrombosis and Vascular Biology · doi:10.1161/01.atv.0000059419.11002.6e · Cited by 292
Manning, J. J., Moore, K. J., Seimon, T. A., Bell, S. A., Sharuk, M., Alvarez-Leite, J. I., de Winther, M. P. J., Tabas, I. A., & Freeman, M. W. (2008) · Arteriosclerosis Thrombosis and Vascular Biology · doi:10.1161/atvbaha.108.176644 · Cited by 266
Self-citationFeig, J. E., Parathath, S., Rong, J. X., Mick, S. L., Vengrenyuk, Y., Grauer, L., Young, S. G., & Fisher, E. A. A. (2011) · Circulation · doi:10.1161/circulationaha.110.984146 · Cited by 237
Self-citationMicroRNA‐33 Deficiency Reduces the Progression of Atherosclerotic Plaque in ApoE −/− Mice
Horie, T., Baba, O., Kuwabara, Y., Chujo, Y., Watanabe, S., Kinoshita, M., Horiguchi, M., Nakamura, T., Chonabayashi, K., Hishizawa, M., et al. (2012) · Journal of the American Heart Association · doi:10.1161/jaha.112.003376 · Cited by 220
The role of macrophages in the induction of antibody in x-irradiated animals.
Gallily, R., & Feldman, M. (1967) · PubMed Central · Cited by 214
Dynamic Aspects of Macrophage Polarization during Atherosclerosis Progression and Regression
Peled, M., & Fisher, E. A. A. (2014) · Frontiers in Immunology · doi:10.3389/fimmu.2014.00579 · Cited by 212
Self-citationTreating Atherosclerosis With Regulatory T Cells
Foks, A. C., Lichtman, A. H., & Kuiper, J. (2014) · Arteriosclerosis Thrombosis and Vascular Biology · doi:10.1161/atvbaha.114.303568 · Cited by 203
Bone Marrow–Specific Deficiency of Nuclear Receptor Nur77 Enhances Atherosclerosis
Hamers, A. A. J., Vos, M., Rassam, F., Marinković, G., Kurakula, K., van Gorp, P. J., de Winther, M. P. J., Gijbels, M. J., de Waard, V., & de Vries, C. J. M. (2011) · Circulation Research · doi:10.1161/circresaha.111.260760 · Cited by 187
Szatmári, I., Pap, A., Rühl, R., Ma, J.-X., Illarionov, P. A., Besra, G. S., Rajnavölgyi, É., Dezsö, B., & Nagy, L. (2006) · The Journal of Experimental Medicine · doi:10.1084/jem.20060141 · Cited by 186
Rotllan, N., Ramírez, C. M., Aryal, B., Esau, C. C., & Fernández-Hernando, C. (2013) · Arteriosclerosis, Thrombosis, and Vascular Biology · doi:10.1161/atvbaha.113.301732 · Cited by 174
von der Thüsen, J. H., Kuiper, J., Fekkes, M. L., de Vos, P., van Berkel, T. J. C., & Biessen, E. A. L. (2001) · The FASEB Journal · doi:10.1096/fj.01-0483fje · Cited by 167
Trogan, E., Choudhury, R. P., Dansky, H. M., Rong, J. X., Breslow, J. L., & Fisher, E. A. A. (2002) · Proceedings of the National Academy of Sciences · doi:10.1073/pnas.042683999 · Cited by 163
Self-citationMeasurement of Fatty Acid Oxidation Rates in Animal Tissues and Cell Lines
Huynh, F. K., Green, M. F., Koves, T. R., & Hirschey, M. D. (2014) · Methods in enzymology on CD-ROM/Methods in enzymology · doi:10.1016/b978-0-12-416618-9.00020-0 · Cited by 154
MicroRNAs in Metabolism and Metabolic DiseasesPreprint
Rottiers, V., Najafi-Shoushtari, S. H., Kristo, F., Gurumurthy, S., Zhong, L., Li, Y., Cohen, D. E., Gerszten, R. E., Bardeesy, N. M., Mostoslavsky, R., et al. (2011) · Cold Spring Harbor Symposia on Quantitative Biology · doi:10.1101/sqb.2011.76.011049 · Cited by 126
Rottiers, V., Obad, S., Petri, A., McGarrah, R., Lindholm, M. W., Black, J. C., Sinha, S., Goody, R. J., Lawrence, M. S., deLemos, A. S., et al. (2013) · Science Translational Medicine · doi:10.1126/scitranslmed.3006840 · Cited by 121
Marquart, T. J., Wu, J., Lusis, A. J., & Baldán, Á. (2013) · Arteriosclerosis, Thrombosis, and Vascular Biology · doi:10.1161/atvbaha.112.300639 · Cited by 110
MicroRNA Control of High-Density Lipoprotein Metabolism and Function
Rayner, K. J., & Moore, K. J. (2014) · Circulation Research · doi:10.1161/circresaha.114.300645 · Cited by 91
Self-citationWolfs, I. M. J., Stöger, J. L., Goossens, P., Pöttgens, C. C. H., Gijbels, M. J., Wijnands, E., van der Vorst, E. P. C., van Gorp, P. J., Beckers, L., Engel, D. A., et al. (2013) · The FASEB Journal · doi:10.1096/fj.13-235911 · Cited by 78
Broadhurst, M. J., Leung, J. M., Lim, K. C., Girgis, N. M., Gundra, U. M., Fallon, P. G., Premenko‐Lanier, M., McKerrow, J. H., McCune, J. M., & Loke, P. (2012) · PLoS Pathogens · doi:10.1371/journal.ppat.1002883 · Cited by 72
Self-citationMogilenko, D. A., Orlov, S., Trulioff, A. S., Иванов, А. В., Nagumanov, V. K., Кудрявцев, И. В., Shavva, V. S., Tanyanskiy, D. A., & Ap, P. (2012) · The FASEB Journal · doi:10.1096/fj.11-193946 · Cited by 49
Flagged first, then by citations
Cited by
Sorted by citations
Murray, P. J. (2017) · Annual Review of Physiology · doi:10.1146/annurev-physiol-022516-034339 · Cited by 2,981
Pathophysiology of Atherosclerosis
Jebari‐Benslaiman, S., Galicia-García, U., Larrea, A., Olaetxea, J. R., Alloza, I., Vandenbroeck, K., Benito‐Vicente, A., & Martı́n, C. (2022) · International Journal of Molecular Sciences · doi:10.3390/ijms23063346 · Cited by 1,166
Mitochondrial dysfunction prevents repolarization of inflammatory macrophages
Van den Bossche, J., Baardman, J., Otto, N. A., van der Velden, S., Neele, A. E., van den Berg, S. M., Luque-Martin, R., Chen, H.-J., Boshuizen, M. C. S., Ahmed, M., et al. (2016) · Cell Reports · doi:10.1016/j.celrep.2016.09.008 · Cited by 1,027
HDL and Reverse Cholesterol Transport
Ouimet, M. I., Barrett, T. J., & Fisher, E. A. A. (2019) · Circulation Research · doi:10.1161/circresaha.119.312617 · Cited by 816
Self-citationAMP-activated protein kinase: the current landscape for drug development
Steinberg, G. R., & Carling, D. (2019) · Nature Reviews Drug Discovery · doi:10.1038/s41573-019-0019-2 · Cited by 785
Self-citation
Metadata
- Authors
- Ouimet, M., Ediriweera, H. N., Gundra, U. M., Sheedy, F. J., Ramkhelawon, B., Hutchison, S. B., Rinehold, K., van Solingen, C., Fullerton, M. D., Cecchini, K., Rayner, K. J., Steinberg, G. R., Zamore, P. D., Fisher, E. A., Loke, P., & Moore, K. J.
- Affiliations
- New York University (US)
- University of Ottawa (CA)
- Howard Hughes Medical Institute (US)
- McMaster University (CA)
- NYU Langone Health (US)
- ORCID
- Venue
- Journal of Clinical Investigation
- Published
- 2015-10-26
- Volume
- 125
- Issue
- 12
- Pages
- 4334-4348
- ISSN
- 0021-9738 (ISSN-L)
- 1558-8238
- PMC
- PMC4665799
- OpenAlex
- W2123366371
- Cited by
- 394
- References
- 67
- Citations by year
- 2026: 19 · 2025: 21 · 2024: 27 · 2023: 37 · 2022: 24 · 2021: 45 · 2020: 45 · 2019: 46 · 2018: 35 · 2017: 47 · 2016: 33 · 2015: 1
- FWCI
- 19.07
- Type
- journal article
- Language
- en
- Open access
- bronze
- doi.org
- Locations
- Journal of Clinical Investigation (publishedVersion)
- PubMed Central (publishedVersion)
- PubMed (publishedVersion)
- Funders
- American Heart Association (14POST20180018, 15POST25090199)
- NYU Langone Medical Center (P30CA016087)
- Canada Research Chairs
- National Institutes of Health (UL1TR000038, TR000038)
- Canadian Institutes of Health Research
- National Heart, Lung, and Blood Institute (R01HL084312, HL-084312, HL098055, P01HL098055, R01HL119047, R01HL108182, T32HL098129)
- National Cancer Institute (P30CA016087)
- National Institute of Allergy and Infectious Diseases (R21AI094166, R01AI093811, R01AI094166, T32AI007180)
- National Center for Advancing Translational Sciences
- Topics
- Life Sciences › Immunology and Microbiology › Immunology › Atherosclerosis and Cardiovascular Diseases
- Life Sciences › Biochemistry, Genetics and Molecular Biology › Cancer Research › MicroRNA in disease regulation
- Life Sciences › Biochemistry, Genetics and Molecular Biology › Biochemistry › Cholesterol and Lipid Metabolism
- Keywords
- microRNA-33, macrophage polarization, M2 macrophages, atherosclerosis, aerobic glycolysis, mitochondrial oxidative phosphorylation, AMPK, ALDH1A2, retinoic acid, regulatory T cells, Foxp3, plaque inflammation, hypercholesterolemia, atheroprotection, lipid metabolism
- MeSH terms
- Aldehyde Dehydrogenase 1 Family, Aldehyde Dehydrogenase, Animals, Gene Expression Regulation, Glycolysis, Oxygen Consumption, Macrophages, Peritoneal, Mice, Knockout, MicroRNAs, Atherosclerosis, T-Lymphocytes, Regulatory, Retinal Dehydrogenase, Mice, Forkhead Transcription Factors, AMP-Activated Protein Kinases, Plaque, Atherosclerotic
About these checks
Registry, retraction, Cites and statistics results are computed, not judged, with one exception: a printed reference that no index lists is read once by a model before it counts as a citation error. Claims are extracted by a model and kept only when their quote appears verbatim in the text; each cited source is then checked, with a model’s help, for whether it says what the claim relies on. Those verdicts can be wrong — read the claim’s quote and the cited source before relying on one.
Statistics and arithmetic are recomputed, not judged.
Confidence bands are shown only for fields calibrated on our annotated test set. None is calibrated yet, so no band is shown.
What counts as a claim ›How we measure confidence ›How we check this ›
Are you an author, or do you see a problem with this page? Request a review
